Sei sulla pagina 1di 129

TRASMISSIONE

MENDELIANA
TRASMISSIONE MENDELIANA
OMIM Sino ad ora sono stati catalogati più di 5000 fenotipi umani, ereditati in maniera mendeliana.
Più del 50% sono caratteri autosomici dominanti, il 36% sono autosomici recessivi e
meno del 10% sono X-linked.
Dei 5000 caratteri, circa 4000 sono
associati a malattie.
Di circa 600 di questi sono state
identificate una o più mutazioni
responsabili della malattia.

NCBI: Natl Center of


Biotechnology Information
TRASMISSIONE MENDELIANA
Le malattie mendeliane sono causate dalla mutazione di un singolo gene che ha un
notevole effetto sul fenotipo e sono ereditate in modo semplice simile o identico a
quello descritto da Mendel.

Le malattie mendeliane sono:


1. autosomiche: se i geni coinvolti si trovano su una delle 22 coppie di cromosomi
autosomi.
2. X-linked: se i geni coinvolti si trovano sul cromosoma X

Malattie dominanti: si manifestano negli eterozigoti (una copia di un allele normale)

Malattie recessive: si manifestano in individui omozigoti per l’allele mutato (doppia


dose del gene anormale).
PCR:
Polymerase Chain Reaction
PCR:
Polymerase
Chain
Reaction
Ricerca di sequenze virali, batteriche ecc.
PCR:
applicazioni

transilluminatore
Il sequenziamento
secondo Sanger
sintesi di DNA in presenza di
primer radioattivo dideossinucleotidi che terminano
la catena

Elettroforesi
autoradiografia

Migrazione
dei
frammenti
Sequenza del filamento
complementare
2’,3’ dideossinucleotide
Mappatura e sequenziamento di genomi completi: il genoma umano
Sequenziamento Filamento singolo di DNA
automatico del DNA Primer fluorescenti diversi con ciascun
dideossinucleotide

ddG ddA ddC ddT

Mescolamento dei prodotti


Elettroforesi
Fotomoltiplicatore

Migrazione dei frammenti

Raggio laser
Fluorescenza
Computer
Il sequenziamento automatico del DNA
Ibridazione di acidi nucleici
Miscela di molecole a Si usa per rivelare
doppio filamento di DNA sequenze specifiche di
cellulare totale acidi nucleici
accoppiandoli alle basi di
Denaturazione a filamenti complementari
95°C di DNA o RNA.
Separazione dei filamenti

Aggiunta di una sonda


radioattiva di DNA
complementare ad una Rinaturazione a 65°C
sequenza specifica di
DNA cellulare

Ibridazione della sonda


radioattiva con sequenze
complementari presenti nel
DNA cellulari
La marcatura radioattiva delle sonde
La sonda è uno specifico frammento di DNA, a sequenza nota,
che si utilizza per individuare un frammento di DNA o gene di
interesse in un pool di DNA totale.

La sonda per essere utile allo scopo deve essere marcata ad


esempio con il fosforo radioattivo P32.

Le sonde possono essere:


corte (20-30 oligonucleotidi)

oppure

lunghe (es. 2-3 kb)

La marcature delle due sonde avviene metodi diversi


La marcatura radioattiva delle sonde: sonde corte
22 oligo

5’ - ACTTAGTAAGGCTTGGAACCTC - 3’

g32ATP = A aP bP g32P

enzima: polinucleotide chinasi

5’ - g32PACTTAGTAAGGCTTGGAACCTC - 3’ La sonda è marcata


La marcatura radioattiva delle sonde: sonde lunghe
La nick translation
Ibridazione di acidi nucleici Utilizzando una sonda
marcata con radioattivo è
possibile individuare DNA o
Il DNA è digerito geni di interesse in un pool di
con una endonucleasi DNA totale attraverso
di restrizione l’ibridazione.

I frammenti di restrizione
Migrazione
di dimensione diverse
sono separati mediante
elettroforesi su gel.

Carta assorbente
Filtro Il DNA viene denaturato e trasferito su di
Gel un filtro mediante passaggio di una
Spugna soluzione attraverso il gel
Soluzione salina

Frammenti
di DNA
Filtro Il filtro viene ibridato
La sonda legata
ad una sonda al filtro è rivelata
radioattiva, che si in autoradiografia
lega a sequenze Lastra autoradiografica
complementari di DNA
Identifica delezioni nella sequenza

1 2 C
EcoRI EcoRI
C
EcoRI EcoRI
1
EcoRI EcoRI

2
Gli enzimi di restrizione
Tabella. Alcuni enzimi di restrizione e i loro siti di taglio sul DNA
Enzima Batterio Sito di taglio
___________________________________________________________________________________________

AluI Arthrobacter luteus 5’-A-G-C-T-3’


3’-T-C-G-A-5’

BamHI Bacillus amyloliquefaciens H 5’-G-G-A-T-C-C-3’


3’-C-C-T-A-G-G-5’

EcoRI Escherichia coli RY13 5’-G-A-A-C-C-T-3’


3’-C-T-T-G-G-A-5’

EcoRII Escherichia coli RY13 5’-C-C-T-G-G-3’


3’-G-G-A-C-C-5’

HaeIII Aemophilus aegyptius 5’-G-G-C-C-3’


3’-C-C-G-G-5’

HindIII Aemophilus influenzae b 5’-A-A-G-C-T-T-3’


3’-T-T-C-G-A-A-5’

PstI Providencia stuartii 5’-C-T-G-C-A-G-3’


3’-G-A-C-G-T-C-5’

SalI Streptomyces albus 5’-G-T-C-G-A-C-3’


3’-C-A-G-C-T-G-5’
___________________________________________________________________________________________
Tecnologia DNA Ricombinante
Enzimi di restrizione
TRASMISSIONE MENDELIANA
ALBERO GENEALOGICO

Coniugazionale

Generazionale

Fratria
TRASMISSIONE MENDELIANA
AUTOSOMICA DOMINANTE
MATRIMONIO PROTOTIPO
Trasmissione verticale
aa Aa
I
1 2

II
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

III
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

1. OGNI INDIVIDUO AFFETTO HA UN GENITORE AFFETTO ♀ A a



2. GLI INDIVIDUI AFFETTI ETEROZIGOTI SE SI UNISCONO IN
MATRIMONIO CON INDIVIDUI SANI - OMOZIGOTI RECESSIVI -
a Aa aa
(condizione più frequente) HANNO IL 50% DI PROBABILITA’ DI
TRASMETTERE LA MALATTIA AL FIGLIO
a Aa aa
3. MASCHI E FEMMINE EREDITANO CON LA STESSA FREQUENZA LA 50% Aa affetto
MALATTIA CONGENITA 50% aa sani
TRASMISSIONE MENDELIANA
AUTOSOMICA DOMINANTE
Trasmissione verticale MATRIMONIO MENO FREQUENTE MA POSSIBILE

Aa Aa
I
1 2
II
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

III
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

♀ A a

4. DUE INDIVIDUI ETEROZIGOTI (meno frequente) CHE HANNO
LA MALATTIA HANNO IL 75% DI PROBABILITA’ DI TRASMETTERE A AA Aa
LA MALATTIA AL FIGLIO
a Aa aa
25% AA affetti gravi
75%
50% Aa affetti
25% aa sani
TRASMISSIONE MENDELIANA
AUTOSOMICA DOMINANTE MATRIMONIO RARO
Trasmissione verticale

AA Aa
I
1 2

II
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

III
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

♀ A a

5. DUE INDIVIDUI, UNO OMOZIGOTE DOMINANTE (raro) E L’ALTRO
ETEROZIGOTE, ENTRAMBI EFFETTI HANNO IL 100% DI PROBABILITA’
A AA Aa
DI TRASMETTERE LA MALATTIA AI FIGLI
A AA Aa
50% AA affetti
100%
50% Aa affetti
TRASMISSIONE MENDELIANA
AUTOSOMICA DOMINANTE

Esempi di caratteri a trasmissione autosomica dominante

• Fossetta sul mento

• Mascella asburgica o prognatismo

• Capacità di arrotolare la lingua

• Capelli lanosi
TRASMISSIONE MENDELIANA

Capelli lanosi

Autosomico
dominante
TRASMISSIONE MENDELIANA
MALATTIE AUTOSOMICHE DOMINANTI
IPERCOLESTEROLEMIA FAMILIARE
Trasmissione: autosomica dominante
Frequenza: 1 malato: 500 nati sani
Patogenesi: mancata eliminazione delle LDL a livello epatico che determina un aumento dei livelli di LDL (e
quindi colesterolo) in circolo e conseguenti gravi manifestazioni cliniche
Causa: gli individui malati sono portatori di mutazioni sul gene che codifica per il recettore delle LDL
(cromosoma 19). Il difetto genico si fa risentire soprattutto a livello degli epatociti, preposti
all’endocitosi e degradazione delle LDL circolanti.

N:220 mg/dl
Aa P:300-600 mg/dl
AA P:600-1200 mg/dl
IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL

Gene: 45 Kb

HOOC
839 aa
NH2
IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL

apolipoproteina
core
(esteri del
LDL colesterolo)

La complessazione con l'LDL determina il "clustering" dei recettori che


prendono contatto con la clatrina. Quest'interazione è necessaria alla
formazione della fossetta rivestita e quindi all'internalizzazione delle LDL

fossetta rivestita
recettore per le LDL,
riconosce la
apolipoproteina clatrina
presente su LDL
vescicola
rivestita
IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL

recettore per LDL ri-esposto

Vescicola
rivestita
immagazzinamento vescicola
(sotto forma di esteri del
colesterolo)
di ricircolo

endosoma

Aminoacidi
sintesi di ACAT (metabolismo)
componenti
della
membrana
lisosoma
cellulare,
ormoni
steroidei,
acidi biliari Colesterolo libero
Acil-coenzima A-colesterolo aciltransferasi: acil-CoA + colesterolo ⇄ CoA + colesterolo estere
IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL

esterificazione
(immagazzinamento)
del colesterolo

enzima
ACAT apparato del
Golgi

+ disponibilità
eccessiva di
colesterolo
- ribosomi

enzima HMG-Coa RER


reduttasi - RNA

sintesi del recettore per le LDL


sintesi endogena
del colesterolo DNA

La idrossimetilglutaril-CoA reduttasi (o HMG-CoA reduttasi) è un enzima appartenente alla classe delle ossidoreduttasi che risiede nel reticolo endoplasmatico
liscio degli epatociti (cellule del fegato)
IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL
5'
Sequenze Dominio di
promotore
legame per
LDL (292 aa)
1
NH2
trascrizione
2 Dominio di
3 omologia per
4 l'EGF (400 aa)
5
splicing
6
7
8 Dominio di
9 traduzione
10 glicosilazione
11 (58 aa)
12
13 Modificazioni
14
15 post- Dominio trans-
traduzionali membrana (58
16
17 aa)
Dominio
HOOC
18 citoplasmatico
3' (50 aa)
IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL
Sono state finora evidenziate più di 400 mutazioni diverse sul gene che
codifica per il recettore delle LDL che a livello fenotipico danno origine ad
effetti raggruppabili in 5 classi
inserzione
Cromosoma 19
delezione
nonsenso G>A

missenso + 2 kb + 18 nt + 4 nt
D splicing

1 2 3 4 5 6 7 8 9 10 11 12 1314 15 16 17 18

-1 kb -4 kb -10 nt -5 kb -5 kb
+ 7 kb
(duplicazione) -7 kb

-20 kb
-25 kb
IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL

I soggetti affetti da FH in condizioni di omozigosi, rappresentano un modello sperimentale prezioso


per lo studio della funzionalità del gene, in quanto permettono di analizzare le alterazioni a carico
del recettore LDLR, causate dall’allele mutante, in assenza completa degli effetti di fondo prodotti
dall’allele normale. Questi studi sono effettuati mediante un modello in vitro nel quale si valuta
l’interazione tra fibroblasti in coltura (ottenuti da biopsie cutanee di soggetti omozigoti per
mutazioni perfettamente caratterizzate dal punto di vista molecolare) e LDL marcate. Si è così
stabilito che esistono 5 diverse classi di fenotipi difettivi, secondo la fase del meccanismo di
funzionamento del recettore LDLR che è compromessa.

Precisamente:
– Classe 1: fenotipo “allele nullo”
– Classe 2: fenotipo “trasporto difettivo”
– Classe 3: fenotipo “legame difettivo”
– Classe 4: fenotipo “internalizzazione difettiva”
– Classe 5: fenotipo “riciclo difettivo”
IPERCOLESTEROLEMIA FAMILIARE

RECETTORE LDL

CLASSE 1: FENOTIPO «ALLELE NULLO» Legame ligando EGF omology O-gli trans citoplasm

Mancata sintesi
(recettore negativo)
1 2 3 4 5 6 7 8 9 10 11 12 1314 15 16 17 18

DELEZIONE
-20 kb

No mRNA
No recettore

• Mancanza del promotore che impedisce la trascrizione


dell'allele mutato (allele nullo)

• Deficit quantitativo del recettore LDL sulla superficie delle


cellule
IPERCOLESTEROLEMIA FAMILIARE

RECETTORE LDL

CLASSE 1: FENOTIPO «ALLELE NULLO» Legame ligando EGF omology O-gli trans citoplasm

Mancata sintesi
(recettore negativo)
1 2 3 4 5 6 7 8 9 10 11 12 1314 15 16 17 18

NONSENSO

Sì mRNA
No recettore

• mRNA contiene codoni di stop (allele nullo)

• Deficit quantitativo del recettore LDL sulla superficie delle


cellule
IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL
O-gli

CLASSE 2: FENOTIPO «TRASPORTO DIFETTIVO»

b. mancata 1 2 3 4 5 6 7 8 9 10 1112 1314 15 16 17 18


N- o O-glicosilazione
MSSENSO missenso

Mutazione missenso nell’esone 15 che


comporta la mancata modificazione post-
traduzionale nel Golgi. La mancata
glicosilazione O-linked impedisce ai recettori
LDL di raggiungere la membrana
citoplasmatica.
Oppure mutazioni che non consentono la Alterazione
delle
glicosilazione N-linked nel RER (no modificazioni HOOC

trasporto nel Golgi) post-traduzionali


IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL

CLASSE 3: FENOTIPO «LEGAME DIFETTIVO»

a. anomala interazione 1 2 3 456 7 8 9 10 1112 1314 15 16 17 18

recettore-ligando
DUPLICAZIONE 8 kb

Duplicazione degli esoni 3-6 che determina


la duplicazione del dominio di legame del NH2

recettore LDL. Nel RER la proteina è


Duplicazione
altamente instabile ed è frequentemente del dominio
degradata o inserita sulle membrane del di legame
RER con molta difficoltà. Il recettore è
trasportato alla membrana cellulare ma ha
poca affinità con LDL (30% del wild type) HOOC
IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL

missenso
CLASSE 3: FENOTIPO «LEGAME DIFETTIVO»

b. anomala interazione
recettore-ligando
1 2 3 4 5 6 7 8 9 10 1112 1314 15 16 17 18
DELEZIONI
MISSENSO delezioni

Delezioni negli esoni 3, 4 e 7,8


che eliminano rispettivamente i 7repeat
repeats 2, 3, 4, 5, e A e B nel
3
recettore LDL. La mancanza di r
questi repeats riduce l’affinità e
p
del recettore con le LDL.
e
a
Mutazioni missenso negli stessi t

esoni che eliminano dei reapet.


IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL
Trans Cit
CLASSE 4: FENOTIPO «INTERNALIZZAZIONE DIFETTIVA»

a. Deficit recettoriale
1 2 3 4 5 6 7 8 9 10 1112 131415 16 17 18
MISSENSO

Mutazione missenso (Tyr790 in Cys) nella


sequenza del dominio citoplasmatico

Il recettore ha una lunghezza corretta ma perde la Tyr Cys


struttura 3D e non può interagire con la clatrina.
No internalizzazione
IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL
Trans Cit
CLASSE 4: FENOTIPO «INTERNALIZZAZIONE DIFETTIVA»

b. Assenza recettoriale
NONSENSO 1 2 3 4 56 7 8 9 10 1112 1314 15 16 17 18

• Mutazione nonsenso nella sequenza del


dominio intracellulare
Stop

• Il recettore non reagisce correttamente


con la clatrina e non consente il clustering
dei recettori. No internalizzazione
IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL EGF omology

CLASSE 5: FENOTIPO «RICICLO DIFETTIVO» missenso

Deficit recettoriale
1 2 3 4 5 6 7 8 9 10 1112 1314 15 16 17 18
DELEZIONI
delezioni
MISSENSO

Mutazioni missenso o delezioni 7repeat


nei repeats della sequenza del
3
dominio di omologia per l’EGF r
e
p
Il recettore dopo internalizzazione e
non ritorna sulla membrana. a
t

No riciclaggio
IPERCOLESTEROLEMIA FAMILIARE

RECETTORE LDL

1. Allele 3. Assenza di 5. Assenza di 2. Trasporto 4. Assenza di


nullo legame riutilizzazione assente internalizzazione
IPERCOLESTEROLEMIA FAMILIARE

RECETTORE LDL

D200g (FH Padova-1): la più frequente in


Italia.
Mutazione missenso esone 4: A:G =
D200g= acido aspartico in glicina

FH Ferrara-1: Ex 4 c.557 del G


IPERCOLESTEROLEMIA FAMILIARE
RECETTORE LDL

- Classe 1: fenotipo “allele nullo”


– Classe 2: fenotipo “trasporto difettivo”
– Classe 3: fenotipo “legame difettivo”
– Classe 4: fenotipo “internalizzazione difettiva”
– Classe 5: fenotipo “riciclo difettivo”
IPERCOLESTEROLEMIA FAMILIARE

• Il deposito di colesterolo a livello della


valvola aortica può provocare una
stenosi aortica sintomatica con
conseguente infarto del miocardio.

• I sintomi si sviluppano nella seconda


(omozigoti) o terza/quarta decade di vita
(etrozigoti).

• All'età di sessant'anni più dell' 85% degli


eterozigoti ha avuto un infarto
miocardico.
IPERCOLESTEROLEMIA FAMILIARE
DIAGNOSI

SANGUE: 1. analisi della concentrazione del colesterolo;


2. elettroforesi delle LDL

MOLECOLARE: è importante conoscere il tipo di mutazione nell’ambito delle etnie (effetto del
fondatore). PCR o IBRIDAZIONE IN SOUTHERN BLOT (previa digestione
enzimatica del DNA con enzimi di restrizione)

DIAGNOSI NEONATALE

SANGUE DAL CORDONE OMBELICALE: 1. analisi della concentrazione del colesterolo (risulta
doppio o triplo negli eterozigoti e 6-8 volte > negli
omozigoti);
2. elettroforesi delle LDL
MOLECOLARE: è importante conoscere il tipo di mutazione nell’ambito delle etnie (effetto del
fondatore). PCR o IBRIDAZIONE IN SOUTHERN BLOT (previa digestione
enzimatica del DNA con enzimi di restrizione)

DIAGNOSI PRENATALE

CELLULE DEL LIQUIDO AMNIOTICO E CARATTERIZZAZIONE MOLECOLARE


COREA DI HUNTINGTON còrea (greco) = danza
Descritta da George Huntington nel 1872
Trasmissione: autosomica dominante

Frequenza: 1 malato: 10.000 nati sani

Patogenesi: malattia neurodegenerativa; manifestazioni cliniche a livello neurologico e motorio.

Causa: gli individui malati sono portatori di mutazioni sul gene che codifica per la proteina huntingtina
(cromosoma 4). Il difetto genico si fa risentire a livello dei neuroni.

Gene HTT o IT-15. Scoperto nel 1993; codifica per l’huntingtina (3144aa)

CAG repeat

glutammine

La proteina è necessaria per la sopravvivenza dei neuroni.


COREA DI HUNTINGTON

gene normale huntingtina normale neurone sano

10-35 CAG repeat 10-35 glutammine

> 35 CAG repeat poliglutammina

gene mutato huntingtina mutata neurone malato


COREA DI HUNTINGTON

HUNTINGTINA
COREA DI HUNTINGTON

HUNTINGTINA
COREA DI HUNTINGTON
HUNTINGTINA

BDNF

BDNF: brain-derived neurotrophic factor


COREA DI HUNTINGTON
HUNTINGTINA
COREA DI HUNTINGTON

ANTICIPAZIONE
COREA DI HUNTINGTON

DIAGNOSTICA MOLECOLARE

• PCR
• SEQUENZIAMENTO AUTOMATICO
OSTEOGENESI IMPERFETTA
Trasmissione: autosomica dominante

Frequenza: 1 malato: 15.000 nati sani

Patogenesi: malattia apparato scheletrico (fragilità ossea).

Causa: gli individui malati sono portatori di mutazioni sul gene che codifica per il collagene, tipo 1, alfa 1
(cromosoma 17). Il difetto genico si fa risentire a livello degli osteoblasti.

Two RNA of 5,8 kb and 4,8 kb differing by their Ô3 terminus non coding sequence and giving rise to a single 140 kDa protein. The COL1A1
gene is 18 kb in size and is composed of 52 exons. Exons 6 to 49 encode the alpha helical domain.

1464 aa

Type I collagen is the most abundant protein in vertebrates and a


constituent of the extra cellular matrix in connective tissue of bone, skin,
tendon, ligament and dentine. It is mostly produced and secreted by
fibroblasts and osteoblasts. Member of the collagen family.
OSTEOGENESI IMPERFETTA
OSTEOGENESI IMPERFETTA

Collagene: Proteina a struttura quaternaria

Col1alfa1 sul cromosoma 17

Col1alfa2 sul cromosoma 7


OSTEOGENESI IMPERFETTA

Sintesi del collagene


OSTEOGENESI IMPERFETTA
OI tipo 1: allele null. Le mutazioni sono
2 fenotipi patologici diverse: delezioni e inserzioni in più esoni,
mutazioni nonsenso e di splicing; viene
prodotto il 50% in meno di collagene.
Compatibile con la vita. Gli individui affetti
hanno fragilità ossea e sono suscettibili a
fratture multiple delle ossa lunga delle
gambe, dello sterno e delle ossa piccole
delle mani e piedi. In 50% dei casi perdita
di udito a partire dalla seconda decade di
vita. Sclera blu.

OI tipo 2: allele mutato. E’ una malattia


molto grave che porta alla morte nelle
prime settimane o mesi di vita (ancora
prima della nascita numerose fratture
delle ossa in tutto il corpo). Il difetto
dipende da mutazioni puntiformi de novo
(sostituzioni di glicine) o riarrangiamenti
negli alleli alfa1 o alfa2. Le mutazioni in
COOH più gravi che in NH2. Le fibre non si
assemblano correttamente e vengono
degradate, oppure se si assemblano non
funzionano correttamente

Allele null: delezioni, Allele mutato: mutazioni puntiformi, riarrangiamenti


inserzioni, mutazioni
splicing, nonsenso
OSTEOGENESI IMPERFETTA

OI1

OI2
TRASMISSIONE MENDELIANA
MALATTIE AUTOSOMICHE RECESSIVE

1. Le malattie autosomiche recessive sono caratterizzate da manifestazioni cliniche soltanto


negli individui omozigoti per il gene mutante.
2. Il pedigree tipico è orizzontale in quanto gli individui affetti tendono a rimanere limitati ad
una singola fratria e la malattia non si presenta nelle generazioni successive.
3. I maschi e le femmine sono affetti con uguale probabilità.
Ereditarietà autosomica recessiva altre possibili combinazioni
A. NORMALE AFFETTO B. ETEROZIGOTE AFFETTO
GENITORI

MEIOSI

GAMETI

FECONDAZIONE
Portatori
eterozigoti PROLE
obbligati

ETEROZIGOTE ETEROZIGOTI AFFETTI


GAMETI GAMETI
PATERNI PATERNI

MATERNI
GAMETI
MATERNI
GAMETI

Tutti
A = NORMALE, a = MUTANTE A = NORMALE, a = MUTANTE
Ereditarietà autosomica recessiva
ETEROZIGOTI
Fibrosi cistica,
Anemia falciforme, Talassemie, GENITORI

MEIOSI

GAMETI

FECONDAZIONE

PROLE

NORMALE AFFETTA
ETEROZIGOTI

GAMETI
PATERNI

MATERNI
GAMETI

A = NORMALE, a = MUTANTE
TRASMISSIONE MENDELIANA
MALATTIE AUTOSOMICHE RECESSIVE
La fibrosi cistica è un carattere recessivo 1/2.000
La fibrosi cistica (CF, Cystic Fibrosis) (MIM/OMIM 219700) è una
patologia genetica disabilitante e letale che si eredita come carattere
autosomico recessivo; colpisce le ghiandole esocrine (mucose –muco- e parotide
sierose-enzimi della digestione- e del sudore). Se le ghiandole del
sudore non funzionano bene rilasciano una quantità eccessiva di sale.
La malattia viene spesso diagnosticata analizzando la quantità di sale polmone
nel sudore. In base ad alcune leggende popolari, le nutrici un tempo
leccavano la fronte dei neonati: se il sudore aveva un sapore troppo
salato, predicevano che il bambino sarebbe morto prematuramente di
congestione polmonare. La malattia ha effetti ad ampio spettro perché
le ghiandole colpite svolgono alcune importanti funzioni vitali. La CF ghiandola fegato
comporta la produzione di un muco spesso, che ostruisce i dotti che sudoripara pancreas
portano gli enzimi della digestione dal pancreas all’intestino tenue, cistifellea
riducendo gli effetti della digestione. Come conseguenza, i bambini
colpiti spesso soffrono di malnutrizione, nonostante un aumento di intestino
appetito e di quantità di cibo consumato. Col progredire della malattia, ovaio
si formano delle cisti nel pancreas e la ghiandola degenera in una
struttura fibrosa, che dà il nome alla malattia. Dal momento che il muco utero (il muco deferente
spesso provocato dalla CF blocca anche le vie aeree dei polmoni, la blocca l’ingresso
testicolo
maggior parte dei pazienti colpiti da fibrosi cistica sviluppa patologie dell’utero) cervice
ostruttive dei polmoni e infezioni, che portano a morte prematura.
(il muco
Quasi tutti i casi di CF si registrano in figli di genitori fenotipicamente blocca i
normali, eterozigoti. dotti che
portano lo
sperma, e
solo circa il
2-3% dei
Ha una frequenza molto alta: 1/2000 maschi
Diversa incidenza tra le popolazioni: 1/25 portatori sani tra gli americani; 1/46 colpiti è
ispanici; 1/65 afroamericani; 1/150 asiatici. Molto grave, molto debilitante, fertile).
invalidante e porta alla morte.
FIBROSI CISTICA 250.000 pb
1480 aa
Il prodotto del gene CF è una proteina che si inserisce
nella membrana plasmatica di alcune cellule ghiandolari.
La proteina è chiamata regolatore della conduttanza
transmembrana della fibrosi cistica o CFTR. Il CFTR
regola il flusso di ioni cloro attraverso la membrana
plasmatica della cellula.

Gene CFTR:
FIBROSI CISTICA
Negli individui affetti da CF la proteina CFTR è assente o difettosa. Dal momento che i fluidi si muovono attraverso le membrane del plasma in
risposta a movimenti degli ioni, una proteina CFTR difettosa comporta una diminuzione dei fluidi che devono aggiungersi alla secrezione delle
ghiandole. Le secrezioni ispessite provocano i sintomi caratteristici della CF.

Esone 10 Una delezione CTT nell’esone 10 causa la


Mutazione delta F508: delezione perdita di una fenilalanina nella posizione 508
della proteina. La isoleucina nella posizione 507
70% dei casi rimane inalterata perché ATC e ATT entrambi
codificano per una isoleucina.
MALATTIE AUTOSOMICHE RECESSIVE
MALATTIE AUTOSOMICHE RECESSIVE
MALATTIE AUTOSOMICHE RECESSIVE
Terza, quarta settimana: sacco vitellino e fegato rispettivamente Adulta: alfa/beta 97/98% - HbA1
Inizio secondo trimestre: milza alfa/delta 2/3% - HbA2
Fine secondo trimestre: ossa alfa/gamma <1% - HbF

(beta) alfa

(beta)

(alfa)
MALATTIE AUTOSOMICHE RECESSIVE
MALATTIE AUTOSOMICHE RECESSIVE
MALATTIE AUTOSOMICHE RECESSIVE
Sickle=falce
HbS
ANEMIA FALCIFORME: 1: 500 (afroamericani)

L'anemia falciforme è una malattia ereditaria, che si


esprime in forma conclamata solo negli omozigoti, vale a
dire nei figli che ricevono il gene anomalo da entrambi i
genitori. Negli omozigoti la Hb-S é la sola forma di
emoglobina presente negli eritrociti. Gli omozigoti non
vivono generalmente oltre l'età di 25 anni.
MALATTIE AUTOSOMICHE RECESSIVE

ANEMIA FALCIFORME
Effetto pleiotropico
MALATTIE AUTOSOMICHE RECESSIVE

ANEMIA FALCIFORME

ESONE 1, CODONE 6
MALATTIE AUTOSOMICHE RECESSIVE

ANEMIA FALCIFORME
MALATTIE AUTOSOMICHE RECESSIVE

ANEMIA FALCIFORME

HbA
MstII MstII
364 pb
201 pb
90 pb
74 pb
HbS
291 pb
74 pb
MALATTIE AUTOSOMICHE RECESSIVE

ANEMIA FALCIFORME
CTC transizione TTC: mRNA=AAG=lisina

Malattia da emoglobina C: anemia lieve, l’emoglobina precipita solo quando è in alte concentrazioni
MALATTIE AUTOSOMICHE RECESSIVE

ANEMIA FALCIFORME Dominanza incompleta

Gli eterozigoti, cioè i figli che


ricevono il gene anomalo da uno
solo dei genitori, posseggono il 50%
di Hb-S ed il 50% di Hb-A. In essi
l'anemia falciforme è asintomatica,
salvo crisi sporadiche che possono
verificarsi in condizioni di bassa
tensione di O2 (montagna,
sott’acqua, anestesia): maschio
falciforme (sickle cell trait).
MALATTIE AUTOSOMICHE RECESSIVE

ANEMIA FALCIFORME
MALATTIE AUTOSOMICHE RECESSIVE

TALASSEMIA
Comuni in tutto il mondo; ma soprattutto mediterraneo e sud est asiatico (20-30% affetti)
Talassa=mare Mediterraneo)
Malattie monofattoriali: ereditarietà autosomica recessiva. Talassemie
Sono un gruppo si malattie ereditarie determinate da anomalie nell’emoglobina, nelle quali il fenotipo deriva da
un’alterazione del rapporto reciproco tra globine alfa e beta. La sintesi di una delle globine può essere ridotta o anche
assente, causando la formazione di molecole di emoglobina aberranti con uno squilibrio tra le subunità. Questo tipo di
molecole non lega l’ossigeno efficientemente e determina effetti gravi se non addirittura fatali.

Le talassemie sono comuni in


diverse aree del mondo,
soprattutto nel Mediterraneo e
nel Sud Ovest asiatico, dove il 20-
30% della popolazione risulta
affetta. Il nome “talassemia”
deriva dal greco thalassa, ovvero
mare, quindi il nome della
malattia enfatizza una condizione
caratteristica di individui del
bacino del Mediterraneo.
Malattie monofattoriali: ereditarietà autosomica recessiva. Talassemie
Le talassemie sono anomalie ereditarie della produzione di emoglobina in cui il problema principale è un difetto
quantitativo della alfa-globina (alfa Talassemia) o della beta-globina (beta Talassemie). Come nel caso dell’anemia falciforme
la distribuzione della Talassemia coincide con quella della malaria.
L’alfa Talassemia è caratterizzata da un difetto relativo di sintesi delle catene alfa-globiniche, con normale produzione di
catene beta. Se alcune catene alfa possono ancora essere prodotte, si formerà una piccola quantità di tetrameri normali, ma
ci sarà un forte eccesso di catene beta. In queste circostanze beta è in grado di formare omotetrameri (beta4). Questa
emoglobina detta emoglobina H (HbH), può essere visualizzata sotto forma di corpi inclusi all’interno dei globuli rossi degli
individui affetti da alfa-Talassemia. La HbH ha una capacità marcatamente ridotta di trasportare ossigeno. La conseguenza di
questo eccesso di catene beta e del difetto di catene alfa è che i globuli rossi hanno dimensioni e numero ridotti, con
conseguente anemia.
Nella beta-Talassemia c’è un difetto delle catene beta. In queste circostanze l’alfa globina è in eccesso forma degli
omotetrameri che precipitano in aggregati moto insolubili. Gli eritrociti vengono distrutti precocemente distruzione nel
midollo osseo e milza.
Normale alfa-Tal beta-Tal
ab ab b bb ab aa a
ab
ba ba bb ba aa
tetrameri ab ba bb aa aa
ba b
bb aa a aa

globuli
rossi

Corpi inclusi di Precipitazione di alfa4


beta4 (HbH) (molto insolubile)
Malattie monofattoriali: ereditarietà autosomica recessiva. Talassemie
Ci sono due tipi di Talassemie: 1. Talassemia alfa, in cui la sintesi della globina alfa è
ridotta o assente;
2. Talassemia beta, che riguarda la sintesi ridotta o
assente della globina beta.
In entrambi i casi vi possono essere cause differenti e benché queste condizioni siano ereditabili
come caratteri autosomici recessivi, entrambe le forme di talassemia danno effetti fenotipici in
eterozigosi.
MALATTIE AUTOSOMICHE RECESSIVE

TALASSEMIA alfa
MALATTIE AUTOSOMICHE RECESSIVE

TALASSEMIA alfa
Malattie monofattoriali: ereditarietà autosomica recessiva. Beta-talassemie

Nelle beta Talassemie si riscontra un deficit delle catene beta. Minor

Tal-minor
asintomatici

Sintomatica,
Major
anemia
significativa ma
non richiede
trasfusioni

Trasfusione dipendenti
Morbo di Cooley (precipitazione tetrameri)
MALATTIE AUTOSOMICHE RECESSIVE

TALASSEMIA beta Mutazione comune in Sardegna e Sicilia T39 (codone 39)


CAG glutammina con TAG stop: talassemia beta 0

Solo 10% prodotta con mutazione


nel promotore

Almeno 100 mutazioni Le mutazioni nella frazione COOH sono meno dannose
MALATTIE AUTOSOMICHE RECESSIVE

TALASSEMIA beta

Nel mediterraneo e in Italia la più frequente: Tal beta+

Mutazione puntiforme introne 1


MALATTIE AUTOSOMICHE RECESSIVE
TALASSEMIA beta
TRASMISSIONE X-LINKED

IL CROMOSOMA Y: 70 geni IL CROMOSOMA X: 1200 geni

I maschi sono emizogoti


IL CROMOSOMA X

LAYONIZZAZIONE
LYONIZZAZIONE
IL CROMOSOMA X
L’ipotesi di Lyon stabilisce che nelle cellule somatiche:
a) L’inattivazione del cromosoma X si verifica precocemente durante la vita embrionale
(stadio di blastocisti avanzata, nell’uomo).
b) L’inattivazione è casuale.
c) L’inattivazione dell’X è completa.
d) L’inattivazione è permanente e si propaga clonalmente.
LYONIZZAZIONE

IL CROMOSOMA X

XIST= X Inactivation Specific Transcript

RNA= 15 kb
Il fenomeno della lyonizzazione
Eccezioni all’ipotesi di Lyon
a) Sebbene l’inattivazione sia solitamente casuale, un cromosoma X
strutturalmente anomalo, ad es. delezione, viene inattivato preferenzialmente.
b) Sebbene l’inattivazione della X sia estensiva, tuttavia non è completa; sono
noti almeno 16 umani che sfuggono all’inattivazione.
Allele A= codifica l’enzima che converte eumelanina in feomelanina (rosso)
Allele a= manca enzima (nero)
Mosaicismo e chimere
I mosaici posseggono due o più linee cellulari geneticamente differenti, che derivano da un unico zigote. La mutazione
genetica indicata può essere una mutazione genica, una mutazione cromosomica numerica o strutturale o, nel caso particolare
della lyonizzazione, l’inattivazione dell’X.
Una chimera deriva da due zigoti, che solitamente sono entrambi normali, ma geneticamente differenti.
Mosaicismo della pelle

Mosaicismo dell’occhio
Ereditarietà X-linked

Le malattie X-linked sono provocate da geni mutati sul cromosoma X.

I geni mutati X-linked sono completamente espressi nei maschi che hanno un
solo cromosoma X e sono quindi emizigoti per i geni X-linked (eredità diaginica).

Una malattia prodotta da un gene mutato X-linked può essere o non essere
espressa clinicamente nelle femmine eterozigoti (fenomeno della lyonizzazione).

Le malattie che raramente hanno una espressione clinica nelle femmine


eterozigoti sono X-linked recessive, mentre le eterozigoti per malattie X-
linked dominanti solitamente sono affette in modo lieve e variabile dei maschi

Non esistono malattie legate all’Y

I geni legati all’Y codificano caratteri non essenziali o funzioni strettamente


maschili, ed è improbabile che loro difetti causino alterazioni patologiche, a parte
l’infertilità maschile. Trasmissione olandrica dei caratteri.
Ereditarietà X-linked dominante: es. Ipofosfatemia = bassi livelli di fosfato nel sangue = deformità dello sheletro: rachitismo

1. Gli individui maschi affetti generano solo figlie femmine affette e nessun figlio maschio affetto:
X Y
1

X XX XY

X XX XY

2. Una femmina eterozigote affetta


trasmetterà il carattere a metà dei suoi figli e
maschi e femmine ne saranno ugualmente
affetti

X Y

X XX XY

X XX XY
Ereditarietà X-linked dominante

1 3. Come atteso una femmina omozigote


trasmetterà il carattere a tutti i suoi figli

2 X Y

X XX XY

X XX XY
3
Variazioni del modello di ereditarietà
La letalità dei maschi
Le condizioni legate all’X letali nei maschi
Per alcune condizioni dominanti legate all’X l’assenza dell’allele normale è
letale prime della nascita. Quindi non nascono maschi affetti e si osserva la
malattia solo nelle femmine, che la trasmettono a metà delle loro figlie
femmine.
2. Una femmina eterozigote affetta
trasmetterà il carattere a metà dei suoi figli e
maschi e femmine ne saranno ugualmente
affetti

X Y

X XX XY
I maschi
affetti vengono
abortiti spontaneamente
X XX XY
Ereditarietà X-linked recessiva
Ereditarietà X-linked recessiva
L’ereditarietà X-linked può essere meglio compresa seguendo il cromosoma X.
L’incrocio meno comune è tra una donna Un secondo incrocio tipico è tra un uomo
omozigote e un uomo normale affetto e una donna omozigote normale.
A. FEMMINA OMOZIGOTE MASCHIO NORMALE B. FEMMINA NORMALE MASCHIO AFFETTO

GENITORI

MEIOSI

GAMETI

FECONDAZIONE

PROLE

FEMMINA M. MASCHIO
ETEROZIGOTE AFFETTO AFFETTO FEMMINA MASCHIO
FEMMINA
ETEROZIGOTE NORMALE
ETEROZIGOTE
GAMETI PATERNI
GAMETI PATERNI
XA I maschi
GAMETI MATERNI
GAMETI MATERNI

Le femmine trasmettono l’X


XaXA trasmettono l’X a tutte le figlie
a tutti i figli femmine
XaXA
A = NORMALE, a = MUTANTE
Ereditarietà X-linked recessiva
L’ereditarietà X-linked può essere meglio compresa seguendo il cromosoma X.
L’incrocio più comune è tra una donna
portatrice eterozigote e un uomo normale
C. FEMMINA ETEROZIGOTE MASCHIO NORMALE

GENITORI

MEIOSI

GAMETI

FECONDAZIONE

PROLE
F M.
NORMALE NORMALE MASCHIO
AFFETTO
FEMMINA
ETEROZIGOTE

GAMETI PATERNI

Le femmine
GAMETI MATERNI

trasmettono l’X
al 50% dei figli.
Maschi e
femmine
Ereditarietà X-linked recessiva
Daltonismo
Europa occidentale:
Cecità al rosso e al verde 8% maschi, 0,7% femmine
Ereditarietà X-linked recessiva
Daltonismo

fotopsine
Ereditarietà X-linked recessiva
Daltonismo
Ereditarietà X-linked recessiva
Emofilia A
Ereditarietà X-linked recessiva
Emofilia A

Gene mutato: Fattore VIII della coagulazione

Manca la conversione del

fibrinogeno (solubile) in fibrina (insolubile)


Ereditarietà X-linked recessiva
Emofilia A

VIII
Ereditarietà X-linked recessiva
Emofilia A
Ereditarietà X-linked recessiva
Emofilia A

142 pb
99 pb
43 pb
Ereditarietà X-linked recessiva
Diastrofia muscolare

1/3500 maschi
Degenerazione muscolare
Esito infausto nell’arco dei primi 20 anni
Femmine eterozigoti normali (casi in
omozigosi)
Ereditarietà X-linked recessiva
Distrofina

Gene distrofina

Occupa l’1% del cromosoma X


Ereditarietà X-linked recessiva

60% delezioni
30% mutazioni puntiformi
10% duplicazioni intrageniche
Ereditarietà X-linked recessiva Distrofina
Fibre muscolari

Normale Becker Duchenne

Fila 1-2: D. Becker

Fila 3: Normale

File 4-5: D. Duchenne

Western blot
Ereditarietà X-linked recessiva
Ereditarietà mitocondriale
matrilineare
Ereditarietà mitocondriale
matrilineare
Ereditarietà mitocondriale
Ereditarietà mitocondriale
Ereditarietà mitocondriale
Ereditarietà mitocondriale
Ereditarietà mitocondriale
Riarrangiamenti del DNA mitocondriale
(delezioni)**
Sindrome di Kearns-Sayre (KSS)
Oftalmoplegia Esterna Progressiva (PEO)

Sindrome di Pearson (anemia sideroblastica e malassorbimento


connatali)

Mutazioni puntiformi*
Neuropatia ottica ereditaria di Leber (LHON)

Sindrome di NARP (neuropatia, atassia, retinite pigmentosa)

Sindrome MILS (Sindrome di Leigh ereditata per via matrilineare)

Encefalopatia mitocondriale con acidosi lattica e strokes (MELAS)

Mioclono-epilessia con fibre "ragged-red"(MERRF)


Miopatia e cardiomiopatia (MIMYCA)
Ereditarietà mitocondriale
Ereditarietà mitocondriale
Ereditarietà mitocondriale
Ereditarietà mitocondriale
Soltanto le femmine possono trasmettere le malattie mitocondriali e
passano la mutazione a tutti i figli di entrambi i sessi.
Le malattie mitocondriali sono spesso caratterizzate da miopatie ed
encefalopatie (il cuore, i muscoli scheletrici e il sistema nervoso
centrale dipendono maggiormente dalla fosforilazione ossidativa).

Il pedigree di una famiglia con


una encefalopatia mitocondriale.
Si osservi la trasmissione materna
a tutti i figli maschi che femmine
e l’assenza della trasmissione per
via paterna.