Sei sulla pagina 1di 40

Analisi del DNA genomico mediante

Southern Blot Hybridization


Permette la mappatura dei siti di restrizione attorno al frammento di DNA
genomico per il quale si dispone di una sonda specifica

a) Il DNA genomico viene digerito con uno o più enzimi di restrizione


10 µg di DNA genomico se la sonda è > 500bp
30-50 µg di DNA genomico se la sonda è piccola (oligonucleotide)

b) I frammenti di digestione vengono separati mediante elettroforesi su gel di


agarosio(0.7%) ± Bromuro di Etidio
DNA non dig.
DNA marker

HindIII

BamHI

EcoRI

c) Il DNA viene denaturato in situ e trasferito a un supporto solido (Filtro di


nitrocellulosa o membrana di nylon)

- (facoltativo) Il gel viene immerso in HC1 (0.2M)


Depurinazione blanda

- Il gel viene immerso in NaOH (0.5N):


Denaturazione del DNA e idrolisi nelle regioni depurinate (rottura del
DNA in frammenti pii piccoli per facilitare il trasferimento

- Il gel viene immerso in un tampone


Neutralizzazione dell’NaOH
Il trasferimento sul filtro può essere fatto mediante

1) Trasferimento capillare (Capillary transfer)

2) Trasferimento elettroforetico (Electro-blotting)

3) Trasferimento col vuoto (Vacuurn blotting)

Il filtro viene fatto essiccare all’aria e successivamente il DNA viene fissato


al filtro mediante:
a) riscaldamento a 80°C, l h se il filtro e di nitrocellulosa
b) riscaldamento a 70°C, l h e/o irraggiamento all’UV se il filtro e di nylon
d) La membrana viene sottoposta a preibridazione

- Soluzione di preibridaziòne:

- Contenitore per la preibridazione:

SEAL

FILTER

CELLOPHANE

FILTER

e) La membrana viene sottoposta a ibridazione con la sonda radioattiva

Soluzione di ibridazione: Soluzione di preibridazione + Sonda denaturata


(bollitura della sonda per 5’)

Stesse condizioni di temperatura della preibridazione, o/n


f) La membrana viene sottoposta a differenti lavaggi, prima meno stringenti (alto
sale, bassa temperatura) poi via via più stringenti (basso sale, alta temperatura)

I) 2X SSC, 0.1% SDS RT 5’


II) 2X SSC, 0.1% SDS 37°C 20’
III) 2X SSC, 0.1 % SDS 60°C 20’
IV) 0.IX SSC, 0.1% SDS 68°C 1h

Sonda
HindIII HindIII

BamHI BamHI BamHI DNA


genomico
EcoRI EcoRI
Elettroforesi

Blotting

Preibridazione
e ibridazione

Lavaggi

Rivelazione
Fattori che influenzano la rivelazione di un segnale in
“Southern Blot Hybridization”

1) La frazione di genoma complementare con la sonda (Es. geni. a


singola copia o multipli)

2) La grandezza della sonda (Sonde grandi forniscono segnali più


intensi di sonde piccole)

3) L’attività specifica della sonda (Sonde ad attività specifica più


elevata forniscono segnali più intensi di sonde ad attività
specifica bassa)

4) La frazione del DNA genomico trasferito sul filtro

Es. 0.1 pg di un frammento di DNA di 1000 bp


presente una sola volta in un genoma (es. genoma umano ~3 109bp)
DNA genomico da digerire: 3 109/1000 x 0.1 pg = 0.3 106 pg = 0.3 µg

Ibridazione con 25 ng di una sonda di dimensioni > 500 bp


Attività specifica>106 cpm/ng

Visibile in autoradiografia dopo alcuni giorni


Caratteristiche dei filtri utilizzati per “blotting”

Filtri di nitrocellulosa:
a) Il legame degli acidi nucleici al filtro è idrofobico (fissaggio a
80°C in stufa). Durante l’ibridazione e i lavaggi si ha rilascio di
acidi nucleici.
b) Il filtro dopo essiccamento è fragile e non sopporta molti cicli di
ibridazione e lavaggio

Filtro di nylon:
a) Il legame degli acidi nucleici al filtro è covalente e duraturo. Il
fissaggio viene fatto in stufa a 70°C, o con alcali deboli oppure
mediante UV (254nm) (fissaggio di tipo covalente)
b) Il legame avviene a bassa forza ionica (solo in questo caso è
possibile usare l’electroblotting). Quando il trasferimento su filtro
avviene da gel di poliacrilamide il vacuum- e capillary-blotting
sono inefficienti
c) Dà alto background ed è necessario usare più agenti bloccanti
d) Esistono due tipi principali di filtro: nylon non modificato e nylon
carico positivamente (con maggiore capacità)
Southern blot su frammenti di DNA
(Determinazione delle mappe di restrizione)

Ibridazione
DNA fingerprinting

DNA fingerprinting di
differenti individui
Polimorfismo nella lunghezza dei frammenti di restrizione
(RFLP)
DNA genomico estratto oppure PCR sul DNA genomico con primer che si
appaiano su regioni invariabili

Pattern di bande meno complesso di un DNA fingerprinting

Se si utilizzano 5-6 sonde è possibile identificare un individuo con una accuratezza


paragonabile al complesso DNA fingerprinting
Isolamento di un promotore di un gene quando è
nota la sequenza di tutto il genoma
Nota la sequenza del cDNA di interesse si può ricercare la regione del genoma che
contiene il gene corrispondente

Il gene contiene 2 esoni ed


è nel contig 7.31
Cromosoma V Contig 7.31
Prelevata la sequenza compresa tra 310000 e 330000 bp

Gene di interesse

Sequenza compresa tra


320000 e 322700 bp
Prelevata la sequenza compresa tra 320000 e 322700 bp
TGTAAACCTCGATGGACTGAATTCAACTGGAAAGGGTGACGAAAGGCCGC
TCTCTATCCTCATTATAGACACAGACAACGCTCACCTACGGGTACACTTC
ACACACGAGTTTCTCCCTACAAACTTTGTCTTACGTTCATTTTCTCATCA
ATCCACAATGCTGTCCCGTTTCATGGGCCATGCCATTTTACATTGCACTT
TTGGCTGGTAACAATGACTGGCGCTTGTCCGCAAACGATCAAGTTCCTCA
CTTCATCCTCCCAGGGTCAAAGTCAGTCGGCGCTTTAATTTCGCCGCCGC
TTCAATCCAAACACCTCCATTCAGAAGACACTCAAAGTGCTGATTAGATT
GCAGCATATGTGTGGCTTGGTTTCAGAGCATCGCCATTGCTTGTACATAA
CGACATGATCTTTCCACCGCCACTAGAGGCGGTTCTCTGATACTTGGTCT
ACCGGCGTGGTATCTTGCAGTCCGCGAACAGAACTCGGCTTGATTTATCC
ATCGTCAAGTATCCATCACCCGTCACCCGACCAACCCCACAGATATACCT
ACCGCTTATGTTGTAACCGGCACAACTCAACAATTCTTCCGGCCTCCTCT
CCTACCTTACCCACCAGTAACGGCTGGTCCTATCCCAGTCCAAGCAAGTT
CCCAACGTCTTGGCTCTTGAATCACCGGGAATGTAACCCCATCTTGCTGA
AAGAGGATCGACTGTGGATGCCAAGACGTGATGAAACCTACGTGCCTTGC
ATGGATACTGTAGTAGTAACTAGTATCCGTTCGCAGTTTCTTTCTGTTCT
CACCTCCCCAAGCTACATATGAGAAAACGTACGCAATGCTGTGTGATGAC
TGGGTCAGACACCGATACCGATACCGGTGGGACTTCTAGGCTCTTCCAAC
CCCCAAAGGCCCATTCTCAGTACACATCGGCTTATAACTTTCGTATGTTG Regione contenente il
TTGGTGTAAGTTGGGAAAAGAAAGGATTCTTGTCTTCTTTCCGCTTTTGT promotore
GAAAGAGTGAGCTCCGCCGTGAGGGGATTCGGGGCAAGGGCATGGCGTTA
AAGGGCTTCAATTAGGTAGTGTCCTCCGGATCGACGGTCTTGGTCTCAAC
AAGGCTCCTGGAGGTTAACATCTGCCGGGCGGTTGCGTCCATGGCTCCTC
TCCACCGTCAACCTCCAATCACGGTCAACTACCAAAATTTCTCTGTACCA
TTCTCAAGATTTTCTAGCATTTTCTTGAGCAGAATGGTAAGGAAACAACC
AATCAAAGCTCCAACTTGAACCACTACTTATAAATCTTAGTCACAGATGA
CCTTGTAGCTCTTCCTGTTATACCCATCTTCAACTAAAGAAGCCATGTCA
GGTTACCATTCCCCTCTCTCATGCTACCCTCTTGCTCTTTCGGGTCTGGT
AAAACAGAGTGGAAGACTACCAGAGGGTGTGAAGAATGCATATACTCTTC
GCCCACGAATAAAATGTAAGCCTACAAGCACGCCAAACAAAACGTCCACC
ACACATCCGCACCGCATTTTCTTAAACGGCCGACAAGTGACGGGCATCAT
TGCCCATTAAGGCAGGTTACAATCCGTGATGATGGGATAGTATATCACAT
AACCGCTCTGGGAGGAAGAGGGGAAACATCGTGGTTCATGTCAAGTGTGT
GTGTGTGTGTGGTGTGTGTTTGACTCGTCGATCGACACCTTACATGCTAA
CTTCGACGTCGAGAGCCCGCACAGAGAGAGGGAAGGGGGGGGGGGGGGGG
GGGGGGGGGGGGGGGGAGAGGCACCGAGAAGGGAGGTATAAGGACCGGGC
CGTCTGGCCCAGTTGAGAATAAAAGGAATCCTTCTCTTCTATGTGCCAGC
ACTTCAGCAATCCACGGTTCTACCTGGTTCCTCATCTTCATCTACCATCA
AGATGAAGTTCTTCTCTGCCCTCGCCCTCTCCTCTCTCCTGCCGACGGCC
GCATGGGCCTGGACCGGCAGCGAAAGCGACAGTACCGGCGCCGACTCCCT
CTTCCGCCGCGCCGAAACCATCCAGCAGACGACGGACCGATACCTTTTTA
GGATCACGCTCCCGCAATTTACTGCCTATCGCAACGCCAGAAGCCCGGCG
ACACTGGACTGGTCCTCAGACAGCTGCAGCTACTCGCCCGATAACCCGTT
GGGATTCCCCTTTTCGCCTGCTTGCAATCGTCATGATTTCGGGTATCGCA
ACTACAAGGCTCAGTCGAGGTTTACGGATAATAATAAGTTGAAGATTGAT
GGAAACTTTAAGACTGAGTATGTCCCTTTTTTTTTTTCTCTCTCTTTCTC
TCTCTCTCTCTTTTCCTCCCTCGTTTTATTCCTCTTGTCTCATCCTTCCC
CTTGCTTACCTACCTACCCTTCTCCCTTTTTACCCGTCAACGGTCTCCAT Gene di interesse
CTCTCTTCACATCCTCCTCCGTGAGTAGATTTGATAAAACAGATAGCTAA
TCCAACCCTCAACCAACTACATAGTCTCTACTACCAGTGCGACACCCACG
GCTACGGCTCCACCTGCCACGCTCTCGCCAACGTCTACTACGCCGCCGTC
CGCGAATTTGGTCGCACCAAGGGCGAGCTCCAGGAGGAATACGATCTGCT
GCTGGCTCACTACAACGAGCTCGTGGCCGAGGCTATTGCCAAGGGCGAGG
ATCCGTTGTATTATTAGCTTTCTGTATATCGGAGGAGGAGGATGAAGGCT
TGTAAACCTCGATGGACTGAATTCAACTGGAAAGGGTGACGAAAGGCCGC
TCTCTATCCTCATTATAGACACAGACAACGCTCACCTACGGGTACACTTC
ACACACGAGTTTCTCCCTACAAACTTTGTCTTACGTTCATTTTCTCATCA
ATCCACAATGCTGTCCCGTTTCATGGGCCATGCCATTTTACATTGCACTT
TTGGCTGGTAACAATGACTGGCGCTTGTCCGCAAACGATCAAGTTCCTCA
CTTCATCCTCCCAGGGTCAAAGTCAGTCGGCGCTTTAATTTCGCCGCCGC
TTCAATCCAAACACCTCCATTCAGAAGACACTCAAAGTGCTGATTAGATT
GCAGCATATGTGTGGCTTGGTTTCAGAGCATCGCCATTGCTTGTACATAA
CGACATGATCTTTCCACCGCCACTAGAGGCGGTTCTCTGATACTTGGTCT
ACCGGCGTGGTATCTTGCAGTCCGCGAACAGAACTCGGCTTGATTTATCC
ATCGTCAAGTATCCATCACCCGTCACCCGACCAACCCCACAGATATACCT
ACCGCTTATGTTGTAACCGGCACAACTCAACAATTCTTCCGGCCTCCTCT
CCTACCTTACCCACCAGTAACGGCTGGTCCTATCCCAGTCCAAGCAAGTT
CCCAACGTCTTGGCTCTTGAATCACCGGGAATGTAACCCCATCTTGCTGA
AAGAGGATCGACTGTGGATGCCAAGACGTGATGAAACCTACGTGCCTTGC
ATGGATACTGTAGTAGTAACTAGTATCCGTTCGCAGTTTCTTTCTGTTCT
CACCTCCCCAAGCTACATATGAGAAAACGTACGCAATGCTGTGTGATGAC
TGGGTCAGACACCGATACCGATACCGGTGGGACTTCTAGGCTCTTCCAAC
CCCCAAAGGCCCATTCTCAGTACACATCGGCTTATAACTTTCGTATGTTG Primer da utilizzare in
TTGGTGTAAGTTGGGAAAAGAAAGGATTCTTGTCTTCTTTCCGCTTTTGT una PCR sul DNA
GAAAGAGTGAGCTCCGCCGTGAGGGGATTCGGGGCAAGGGCATGGCGTTA
AAGGGCTTCAATTAGGTAGTGTCCTCCGGATCGACGGTCTTGGTCTCAAC genomico o sul DNA
AAGGCTCCTGGAGGTTAACATCTGCCGGGCGGTTGCGTCCATGGCTCCTC di una libreria
TCCACCGTCAACCTCCAATCACGGTCAACTACCAAAATTTCTCTGTACCA
TTCTCAAGATTTTCTAGCATTTTCTTGAGCAGAATGGTAAGGAAACAACC
genomica
AATCAAAGCTCCAACTTGAACCACTACTTATAAATCTTAGTCACAGATGA
CCTTGTAGCTCTTCCTGTTATACCCATCTTCAACTAAAGAAGCCATGTCA
GGTTACCATTCCCCTCTCTCATGCTACCCTCTTGCTCTTTCGGGTCTGGT
AAAACAGAGTGGAAGACTACCAGAGGGTGTGAAGAATGCATATACTCTTC
GCCCACGAATAAAATGTAAGCCTACAAGCACGCCAAACAAAACGTCCACC
ACACATCCGCACCGCATTTTCTTAAACGGCCGACAAGTGACGGGCATCAT
TGCCCATTAAGGCAGGTTACAATCCGTGATGATGGGATAGTATATCACAT
AACCGCTCTGGGAGGAAGAGGGGAAACATCGTGGTTCATGTCAAGTGTGT
GTGTGTGTGTGGTGTGTGTTTGACTCGTCGATCGACACCTTACATGCTAA
CTTCGACGTCGAGAGCCCGCACAGAGAGAGGGAAGGGGGGGGGGGGGGGG
GGGGGGGGGGGGGGGGAGAGGCACCGAGAAGGGAGGTATAAGGACCGGGC
CGTCTGGCCCAGTTGAGAATAAAAGGAATCCTTCTCTTCTATGTGCCAGC 5’ UTR
ACTTCAGCAATCCACGGTTCTACCTGGTTCCTCATCTTCATCTACCATCA
AGATGAAGTTCTTCTCTGCCCTCGCCCTCTCCTCTCTCCTGCCGACGGCC
GCATGGGCCTGGACCGGCAGCGAAAGCGACAGTACCGGCGCCGACTCCCT
CTTCCGCCGCGCCGAAACCATCCAGCAGACGACGGACCGATACCTTTTTA
GGATCACGCTCCCGCAATTTACTGCCTATCGCAACGCCAGAAGCCCGGCG Esone 1
ACACTGGACTGGTCCTCAGACAGCTGCAGCTACTCGCCCGATAACCCGTT
GGGATTCCCCTTTTCGCCTGCTTGCAATCGTCATGATTTCGGGTATCGCA
ACTACAAGGCTCAGTCGAGGTTTACGGATAATAATAAGTTGAAGATTGAT
GGAAACTTTAAGACTGAGTATGTCCCTTTTTTTTTTTCTCTCTCTTTCTC
TCTCTCTCTCTTTTCCTCCCTCGTTTTATTCCTCTTGTCTCATCCTTCCC Introne
CTTGCTTACCTACCTACCCTTCTCCCTTTTTACCCGTCAACGGTCTCCAT
CTCTCTTCACATCCTCCTCCGTGAGTAGATTTGATAAAACAGATAGCTAA
TCCAACCCTCAACCAACTACATAGTCTCTACTACCAGTGCGACACCCACG
GCTACGGCTCCACCTGCCACGCTCTCGCCAACGTCTACTACGCCGCCGTC Esone 2
CGCGAATTTGGTCGCACCAAGGGCGAGCTCCAGGAGGAATACGATCTGCT
GCTGGCTCACTACAACGAGCTCGTGGCCGAGGCTATTGCCAAGGGCGAGG
ATCCGTTGTATTATTAGCTTTCTGTATATCGGAGGAGGAGGATGAAGGCT 3’ UTR
Isolamento del frammento di DNA genomico
contenente il gene di interesse (es. isolamento del
promotore, struttura del gene, ecc)
Placque (o colony) hybridization
Prelievo della placca (o colonia) positiva

Isolamento del DNA del clone λ


o del plasmide

Crescita su larga scala Sequenziamento


PCR inversa (inverse—PCR)
Permette di amplificare frammenti di DNA, a sequenza ignota, che si trovano
esternamente ai primer utilizzati. Viene usata, in sostituzione allo screening di
librerie genomiche, per isolare sequenze fiancheggianti un gene, come ad es. un
promotore.

a) Il DNA genomico viene digerito con un enzima di restrizione che non taglia
nella regione a sequenza nota, compresa tra i due primer
b) I frammenti di digestione vengono sottoposti a ligasi in condizioni da favorire
una ligazione intramolecolare (ad es. condizioni di elevata diluizione del DNA)
c) Il DNA circolarizzato viene utilizzato come templato per una PCR con i due
primer appaiantisi al frammento di DNA a sequenza nota, ma diretti in direzione
opposta l’uno rispetto all’altro.
Elettroforesi classica di frammenti di DNA

Modello a setaccio
Le molecole di DNA più grandi sono separate da quelle più piccole dall’azione di
setaccio dovuta alla matrice del gel

Molecole a struttura
“random coil”
Elettroforesi “pulsed-field”
PFGE (Pulsed-Field Gel Electrophoresis)
DNA di dimensioni > 40 Kb non possono essere separati con un’elettroforesi su gel
di agarosio a campo elettrico costante

Mobilità elettroforetica del DNA in


funzione della dimensione molecolare
in un campo elettrico costante.

La PFGE permette di separare DNA fino a 5 Mb.

L’elettroforesi viene realizzata con un campo elettrico che cambia periodicamente


in due direzioni con un intervallo di tempo che varia da 0.1 sec, a qualche ora.

A e B rappresentano 2 coppie di
elettrodi. Quando i due elettrodi A sono
attivati, il DNA caricato nei pozzetti si
sposta verso l’anodo a destra, come
indicato dalla prima freccia. Non
appena gli elettrodi A vengono spenti,
gli elettrodi B vengono attivati. A
questo punto il DNA inizia a muoversi
verso sinistra.
Al variare della direzione del campo
elettrico, le molecole di DNA seguono
un percorso a zig-zag come mostrato
dalle frecce.
Modello a serpente

Il meccanismo di migrazione del DNA attraverso le maglie del gel (più strette
delle dimensioni della molecola) sembra essere differente e ricorda lo
spostamento di un serpente.

Nel modello a serpente, le molecole di DNA più larghe della dimensione dei
pori del gel di agarosio devono srotolarsi dalla loro iniziale forma a “random
coil” in modo da poter migrare durante l’elettroforesi. Il DNA si muove con una
estremità che conduce lo spostamento (testa) mentre il resto della molecola
(coda) la segue, lungo lo stesso percorso.
Nel spostamento del DNA in una PFGE si distinguono 2 fasi:

1) Riorientamento: una delle estremità del frammento di DNA si orienta


verso in polo positivo (capo della molecola)

2) Migrazione: il capo della molecola migra verso il polo positivo trascinando


l’altra estremità (coda della molecola)

Fintantoché il tempo di riorientamento è inferiore alla durata del campo


elettrico (pulse time), la mobilità della molecola dipende linearmente dalla sua
lunghezza.

La mobilità di una molecola dipende dalla frazione del “pulse time” che
rimane per la migrazione (migration time):

a) Molecole piccole: si riorientano velocemente nel nuovo campo elettrico e


spendono la maggior parte del “pulse time” per la migrazione, prima che il
campo elettrico cambi nuovamente.

b) Molecole grandi: si riorientano lentamente nel nuovo campo elettrico e


spendono solo una piccola parte del “pulse time” per la migrazione
Tipi di apparati per PFGE

A) Transverse Alternating Field Electrophoresis (TAFE)

B) Field Inversion Gel Electrophoresis (FIGE)

C) Contour-Clamped Homogeneous Electric Field apparatus (CHEF)

D) Rotating Gels
Isolamento del cDNA quando è nota la sequenza di
molte EST correlate
Allineamento multiplo delle sequenze EST
(CUSTAL W) e determinazione del Contig di EST
Mappa di traduzione del Contig di EST, definizione del
CDS e progettazione dei prime per PCR
Isolamento del cDNA intero o della sola CDS mediante PCR
L’amplificazione di un cDNA può essere eseguita:

1) mediante PCR utilizzando come templato il DNA (plasmidico o fagico) totale di


una libreria di cDNA.

2) mediante la RT-PCR direttamente dall’mRNA


a) L’mRNA viene retrotrascritto a cDNA a singolo filamento mediante la
trascrittasi inversa.
Il primer utilizzabile può essere:
- un primer specifico (gene-specific primer, GSP)
- un primer oligo(dT)
- una miscela di primer random (esameri)
b) Il cDNA a singolo filamento viene usato come templato per la reazione
specifica di PCR successiva.
Procarioti
+1

Promotore Terminatore
batterico batterico

RNA-polimerasi batterica

Trascrizione 5’ 3’ mRNA
Monocistronico o
policistronico

Eucarioti
Esone 1 Esone 2 Esone 3

Promotore +1 Terminatore
eucariotico eucariotico

RNA-polimerasi II

Trascrizione 5’ 3’ Trascritto
primario

- Capping
Modificazioni - Poliadenilazione
post-trascrizionali - Splicing (anche alternativo)

5’ AAAAAAAAAAAAAAAA 3’ mRNA
Cap Poli A Monocistronico
(200-300A)
5’ AAAAAAAAAAAAAAAA 3’ mRNA
Cap Poli A Monocistronico
(200-300A)

ATG TAA TTTTTTTTTTTTTTTT


AAAAAAAAAAAAAAAA cDNA

CDS

Vettore batterico Vettore eucariotico episomico


(lievito)
cDNA eucariotico cDNA eucariotico terminatore
terminatore eucariotico
AT
G batterico
G
AT
Promotore Sequenza SD
batterico
Promotore
eucariotico

Gene per la Origine di


Origine di relicazione
resistenza ad
relicazione eucariotica
Origine di un antibiotico
batterica
relicazione
batterica Gene per la
resistenza ad Gene per la
un antibiotico selezione in
eucariote

Frammento di gene
batterico cDNA eucariotico
ATG ATG TAA TTTTTTTTTTTTTTTT
AAAAAAAAAAAAAAAA

Punto di fusione 3 possibili fasi di lettura


Complementazione funzionale in E.coli

Es. Via metabolica di riduzione del solfato

SO42-

ATP solforilasi (Cys D)


APS
DPNPasi APS chinasi (Cys C)

PAPS
PAPS reduttasi (Cys H)
SO32-

Solfito reduttasi (Cys J)


S2-
Cisteina sintasi (Cys K)
cisteina
Complementazione funzionale
Batterio mutante per la solfito reduttasi (Cys J) trasformato con una
libreria di cDNA di espressione

Terreno minimo +Cys Terreno minimo -Cys

1 2 3 4 ecc.
Crescita batterica (1.5 ml)

1 2 3 4 ecc.
Minipreparazione
Plasmidica (2-5 µg)
Ricomplementazione

Le varie minipreparazioni plasmidiche vengono utilizzate per


ritrasformare il ceppo di batteri mutanti

Trasformazione
1 2 3 4 ecc.
Minipreparazione
Terreno minimo +Cys Terreno minimo -Cys

Miniprep 1

Miniprep 2

Miniprep 3