Sei sulla pagina 1di 51

Livelli di organizzazione

Organismo Apparato Organo Tessuto Cellula Organello Molecola Atomo

nello studio della vita sono identificabili numerosi

livelli di organizzazione;
diverse discipline biomediche studiano uno o pi di tali livelli

Organismo Apparato Organo Tessuto Cellula Organello Molecola Atomo

Anatomia

Istologia Citologia

La cellula procariotica
Lo spazio interno della cellula occupato da un liquido di consistenza gelatinosa (il citoplasma), in cui sono immersi dei piccoli organuli (ribosomi), necessari per la sintesi delle proteine. Il materiale genetico (DNA) si trova libero nel citoplasma, non esiste un nucleo Esiste invece una struttura rigida di protezione: la parete cellulare e pi internamente la membrana cellulare.

regione nucleare

membrana cellulare

parete cellulare

citoplasma ribosomi

X 50

Le cellule procariotiche sono molto pi piccole delle cellule eucariotiche

Zoom sulla punta di uno spillo

A vari ingrandimenti

X 1250

Si intravedono molte cellule procariotiche

X 6000
Si tratta di batteri dalla forma allungata.

X 30 000

La cellula eucariotica
E un tipo di cellula molto pi
voluminosa e complessa della cellula procariotica. Al suo interno lo spazio organizzato in settori,delimitati da membrane, a ciascuno dei quali compete una certa funzione in modo da assicurare la sopravvivenza e la riproduzione della cellula. La membrana nucleare. delimita il nucleo, in cui si trova il materiale genetico (DNA); esso controlla tutte le attivit della cellula stessa.

membrana nucleare

citoplasma
membrana cellulare

nucleo mitocondri
Reticolo endoplasmatico con ribosomi

La cellula eucariotica
possiede numerosi organuli, che svolgono specifiche funzioni.

VARI TIPI DI CELLULE


Cellule adipose

Cellule di epitelio di cipolla

Cellule in riproduzione

Le cellule staminali sono cellule il cui destino non ancora "deciso". Possono originare vari tipi di cellule diverse, attraverso un processo denominato "differenziamento".

Cellula come una fabbrica

Le macchine e la stanza di controllo

la stanza di controllo: i manuali e la fotocopiatrice

46

46 manuali che rappresentano i CROMOSOMI

TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAAATGC TAGTCGATCTATCGATCGGCTATTCGCAAAGCTGCGCGACTG CGATGCGCTAGCATGCGATTCGCGATCGCCGAGCGCTCGCG AGCGCGCTAGCGGAATACTATATAGCGCGGATCAGTCTAGA TCTATGAGATCGATAGCGATCTAGAGATAGGATCGAGATCG AGGCGAGATCATATGAGCGCGGCTATTTAGGCTTAGAGGAT TCGGAGATTCGGAGCTTAGGATTACAGAGAGCTTCTTAGGC GCTCCCGGTATCGCTCCCATCCCATATTAAAATCTATCGATC GAGCTCTCCAATGCGATCGATAGGACTAGTAGCTAGCTAGC TGAGCATGATAGGCTCGATGAGCATGAGATGCATGTACGAC TGCATAGGCATGACTGATCGACTGCATCATGACGCATGACT GCATGCATGACTGCATATGACGGACTCGCATTAGCACTACC GTATTTGCGCATTACCAGATTAGAGAAATGCTAGTCGATCTA TCGATCGGCTATTCGCAAAGCTGCGCGACTGCGATGCGCTA GCATGCGATTCGCGATCGCCGAGCGCTCGCGAGCGCGCTA GCGGAATACTATATAGCGCGGATCAGTCTAGATCTATGAGAT CGATAGCGATCTAGAGATAGGATCGAGATCGAGGCGAGATC ATATGAGCGCGGCTATTTAGGCTTAGAGGATTCGGAGATTC GGAGCTTAGGATTACAGAGAGCTTCTTAGGCGCTCCCGGTA TCGCTCCCATCCCATATTAAAATCTATCGATCGAGCTCTCCA ATGCGATCGATAGGACTAGTAGCTAGCTAGCTGAGCATGAT AGGCTCGATGAGCATGAGATGCATGTACGACTGCATAGGCA TGACTGATCGACTGCATCATGACGCATGACTGCATGCATGAC TGCATATGACGGACTCGCATTAGCACTACCGTATTTGCGCAT TACCAGATTAGAGAAATGCTAGTCGATCTATCGATCGGCTAT TCGCAAAGCTGCGCGACTGCGATGCGCTAGCATGCGATTCG CGATCGCCGAGCGCTCGCGAGCGCGCTAGCGGAATACTATA TAGCGCGGATCAGTCTAGATCTATGAGATCGATAGCGATCTA GAGATAGGATCGAGATCGAGGCGAGATCATATGAGCGCGG CTATTTAGGCTTAGAGGATTCGGAGATTCGGAGCTTAGGATT ACAGAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCATCCC ATATTAAAATCTATCGATCGAGCTCTCCAATGCGATCGATAG GACTAGTAGCTAGCTAGCTGAGCATGATAGGCTCGATGAGC ATGAGATGCATGTACGACTGCATAGGCATGACTGATCGACT GCATCATGACGCATGACTGCATGCATGACTGCATATGACGG ACTCGCA

TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAAATGC TAGTCGATCTATCGATCGGCTATTCGCAAAGCTGCGCGACTG CGATGCGCTAGCATGCGATTCGCGATCGCCGAGCGCTCGCG AGCGCGCTAGCGGAATACTATATAGCGCGGATCAGTCTAGA TCTATGAGATCGATAGCGATCTAGAGATAGGATCGAGATCG AGGCGAGATCATATGAGCGCGGCTATTTAGGCTTAGAGGAT TCGGAGATTCGGAGCTTAGGATTACAGAGAGCTTCTTAGGC GCTCCCGGTATCGCTCCCATCCCATATTAAAATCTATCGATC GAGCTCTCCAATGCGATCGATAGGACTAGTAGCTAGCTAGC TGAGCATGATAGGCTCGATGAGCATGAGATGCATGTACGAC TGCATAGGCATGACTGATCGACTGCATCATGACGCATGACT GCATGCATGACTGCATATGACGGACTCGCATTAGCACTACC GTATTTGCGCATTACCAGATTAGAGAAATGCTAGTCGATCTA TCGATCGGCTATTCGCAAAGCTGCGCGACTGCGATGCGCTA GCATGCGATTCGCGATCGCCGAGCGCTCGCGAGCGCGCTA GCGGAATACTATATAGCGCGGATCAGTCTAGATCTATGAGAT CGATAGCGATCTAGAGATAGGATCGAGATCGAGGCGAGATC ATATGAGCGCGGCTATTTAGGCTTAGAGGATTCGGAGATTC GGAGCTTAGGATTACAGAGAGCTTCTTAGGCGCTCCCGGTA TCGCTCCCATCCCATATTAAAATCTATCGATCGAGCTCTCCA ATGCGATCGATAGGACTAGTAGCTAGCTAGCTGAGCATGAT AGGCTCGATGAGCATGAGATGCATGTACGACTGCATAGGCA TGACTGATCGACTGCATCATGACGCATGACTGCATGCATGAC TGCATATGACGGACTCGCATTAGCACTACCGTATTTGCGCAT TACCAGATTAGAGAAATGCTAGTCGATCTATCGATCGGCTAT TCGCAAAGCTGCGCGACTGCGATGCGCTAGCATGCGATTCG CGATCGCCGAGCGCTCGCGAGCGCGCTAGCGGAATACTATA TAGCGCGGATCAGTCTAGATCTATGAGATCGATAGCGATCTA GAGATAGGATCGAGATCGAGGCGAGATCATATGAGCGCGG CTATTTAGGCTTAGAGGATTCGGAGATTCGGAGCTTAGGATT ACAGAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCATCCC ATATTAAAATCTATCGATCGAGCTCTCCAATGCGATCGATAG GACTAGTAGCTAGCTAGCTGAGCATGATAGGCTCGATGAGC ATGAGATGCATGTACGACTGCATAGGCATGACTGATCGACT GCATCATGACGCATGACTGCATGCATGACTGCATATGACGG ACTCGCA

IL LAVORO ALLINTERNO DELLA FABBRICA

Si eseguono fotocopie di quelle parti dei manuali che ci interessano

la fotocopia viene trasferita dalla stanza di controllo al resto del capannone attraverso una delle finestre

TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAA ATGCTAGTCGATCTATCGATCGGCTATTCGCAAAGCT GCGCGACTGCGATGCGCTAGCATGCGATTCGCGATC GCCGAGCGCTCGCGAGCGCGCTAGCGGAATACTATA TAGCGCGGATCAGTCTAGATCTATGAGATCGATAGCG ATCTAGAGATAGGATCGAGATCGAGGCGAGATCATAT GAGCGCGGCTATTTAGGCTTAGAGGATTCGGAGATTC GGAGCTTAGGATTACAGAGAGCTTCTTAGGCGCTCCC GGTATCGCTCCCATCCCATATTAAAATCTATCGATCGA GCTCTCCAATGCGATCGATAGGACTAGTAGCTAGCTA GCTGAGCATGATAGGCTCGATGAGCATGAGATGCATG TACGACTGCATAGGCATGACTGATCGACTGCATCATG ACGCATGACTGCATGCATGACTGCATATGACGGACTC GCATTAGCACTACCGTATTTGCGCATTACCAGATTAGA GAAATGCTAGTCGATCTATCGATCGGCTATTCGCAAA GCTGCGCGACTGCGATGCGCTAGCATGCGATTCGCG ATCGCCGAGCGCTCGCGAGCGCGCTAGCGGAATACT ATATAGCGCGGATCAGTCTAGATCTATGAGATCGATA GCGATCTAGAGATAGGATCGAGATCGAGGCGAGATC ATATGAGCGCGGCTATTTAGGCTTAGAGGATTCGGAG AAGGATTCGGAGATTCGGAGCTTAGGATTACAGAGAG CTTCTTAGGCGCTCCCGGTATCGCTCCCATCCCATATT AAAATCTATCGATCGAGCTCTCCAATGCGATCGATAG GACTAGTAGCTAGCTAGCTGAGCATGATAGGCTCGAT GAGCATGAGATGCATGTACGACTGCATAGGCATGACT GATCGACTGCATCATGACGCATGACTGCATGCATGAC TGCATATGACGGACTCGCA

uno degli operai, seguendo alla lettera la fotocopia, produce un nuovo macchinario o un pezzo di ricambio

proteine cellula

nucleo
TTAGCACTACCGTATTTGCGCA TTACCAGATTAGAGAAATGCTA GTCGATCTATCGATCGGCTATT CGCAAAGCTGCGCGACTGCGA TGCGCTAGCATGCGATTCGCG ATCGCCGAGCGCTCGCGAGCG CGCTAGCGGAATACTATATAGC GCGGATCAGTCTAGATCTATGA GATCGATAGCGATCTAGAGATA GGATCGAGATCGAGGCGAGAT CATATGAGCGCGGCTATTTAGG CTTAGAGGATTCGGAGATTCG GAGCTTAGGATTACAGAGAGC TTCTTAGGCGCTCCCGGTATCG CTCCCATCCCATATTAAAATCT ATCGA

ribosomi

cromosomi

acidi nucleici (DNA-RNA)

di tanto in tanto lintero set di manuali viene copiato, pagina per pagina, in modo da poter controllare il lavoro di due capannoni anzich di uno...

RIPRODUZIONE

IL NUCLEO: la centrale di controllo

NUCLEO
E delimitato dalla membrana nucleare, provvista di pori che consentono la comunicazione con il citoplasma All'interno del nucleo sono conservati i cromosomi composti da DNA e proteine e solitamente presenti in coppie, in un numero variabile e caratteristico di ciascuna specie. Il DNA una singola molecola, molto lunga e avvolta su se stessa a spirale, contenente una sequenza di geni I geni contengono le informazioni necessarie per la costruzione delle molecole indispensabili alla vita e alla riproduzione della cellula

NUCLEO

poro nucleare

costituito da cisterne del reticolo endoplasmatico rugoso

membrana nucleare

nucleo di neurone

involucro e pori nucleari


poro

nucleo

citoplasma

La membrana plasmatica

Struttura della membrana


(modello a mosaico fluido)
Fluido extracellulare

canale

proteine Citoplasma Doppio strato fosfolipidico

Il doppio strato di fosfolipidi

testa polare (idrofila)


sigillo impermeabile

acqua

acqua

coda non polare (idrofoba)

Diffusione semplice
la diffusione attraverso la membrana pu avvenire attraverso il doppio strato fosfolipidico... ... oppure attraverso i canali proteici

Fluido extracellulare

Citoplasma

Quali sostanze passano per diffusione semplice?


molte sostanze, tuttavia, non possono attraversare la membrana senza un aiuto speciale...

Glucoso

sostanze polari come lacqua e piccoli ioni utilizzano invece specifici canali proteici

Acqua
Alcol
alcune sostanze dotate di liposolubilit come lalcol possono attraversare senza problema la Citoplasma barriera

trasporto attivo

endocitosi

esocitosi

CITOPLASMA
Lo spazio interno della cellula occupato dal citoplasma. Si tratta di un gel acquoso (90% di acqua), contenente numerosissime molecole di varie dimensioni In esso sono adagiati gli organelli della cellula

MITOCONDRI

I mitocondri sono gli organuli

responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi; L'energia proviene dagli ultimi passaggi che portano alla completa demolizione degli alimenti. Queste reazioni,nel loro insieme costituiscono il processo di "respirazione cellulare",comportano il consumo di ossigeno e la produzione di anidride carbonica

Mitocondri osservati al microscopio ottico

Mitocondrio al microscopio elettronico

mRNA

Ribosoma

20 nm

proteina

APPARATO DEL GOLGI

Si presenta come un sistema di cisterne appiattite, che ricevono le proteine sintetizzate sui ribosomi, dopo aver operato le modifiche necessarie , le indirizzano verso le giuste destinazioni all interno o allesterno della cellula.

Golgi: maturazione e trasporto

complesso di Golgi

Esocitosi

LISOSOMI
LISOSOMI = Sono vescicole che svolgono la funzione di stomaco: digeriscono le sostanze nocive e di rifiuto per la cellula eliminendole. Se i lisosomi si rompono, la cellula stessa viene distrutta, poich gli enzimi che essi contengono sono capaci di scindere tutti i composti principali presenti nella cellula.

CLOROPLASTI
I cloroplasti fanno parte di un gruppo di organelli detti plastidi

Il loro colore dovuto alla presenza della clorofilla, che permette alle piante di svolgere la fotosintesi clorofilliana perch in grado di catturare lenergia solare. I cloroplasti hanno una struttura molto complessa e contengono proprie molecole di DNA

Cellule di foglia di muschio. Sono ben visibili i cloroplasti

VACUOLI
Un vacuolo una cavit citoplasmatica circondata da una membrana

e piena d'acqua e soluti e contenuta soprattutto nelle cellule vegetali. Le cellule vegetali immature hanno di solito molti vacuoli, ma, con la loro maturazione, quelli pi piccoli si riuniscono in un unico grosso vacuolo centrale pieno d'acqua che diventa il principale elemento di sostegno della cellula. Negli animali si riscontrano vacuoli contrattili per eliminare acqua in eccesso o vacuoli digestivi

Protozoo-Ameba=organismo unicellulare eucariote

Cellule vegetali con molti vacuoli

CITOSCHELETRO

E la struttura che d sostegno e forma alla cellula. I microtubuli e i microfilamenti che lo compongono, consentono il movimento delle molecole all'interno della cellula .

Ingrandimento e modelli del citoscheletro

Citoscheletro in alcune cellule marcato in verde