Report
The Lateral Root Cap Acts as an Auxin Sink that
Controls Meristem Size
Highlights
d Cytokinin acts in the LRC to coordinate cell differentiation of
the root meristem
d Cytokinin controls auxin levels via PIN5 and GH3.17 to trigger
cell differentiation
d PIN5 and GH3.17 control auxin levels specifically in the LRC
d LRC serves as an auxin sink which controls meristem size
thus organ growth
Di Mambro et al., 2019, Current Biology 29, 1199–1205
April 1, 2019 ª 2019 Elsevier Ltd.
https://doi.org/10.1016/j.cub.2019.02.022
Authors
Riccardo Di Mambro,
Noemi Svolacchia,
Raffaele Dello Ioio, ..., Wolfgang Busch,
Paolo Costantino, Sabrina Sabatini
Correspondence
riccardo.dimambro@unipi.it (R.D.M.),
sabrina.sabatini@uniroma1.it (S.S.)
In Brief
During organ growth, cell activity needs
to be coordinated. Di Mambro et al.
identify a mechanism that acts in one
tissue and yet coordinates activity
throughout the root. Control of the levels
of the hormone auxin, specifically in the
lateral root cap, is sufficient to coordinate
cell differentiation of all tissues thus
ensuring coherent root growth.
Current Biology

Report

The Lateral Root Cap Acts as an Auxin Sink

that Controls Meristem Size
Riccardo Di Mambro,1,* Noemi Svolacchia,2 Raffaele Dello Ioio,2 Emanuela Pierdonati,2 Elena Salvi,2
Emanuela Pedrazzini,3 Alessandro Vitale,3 Serena Perilli,2 Rosangela Sozzani,4 Philip N. Benfey,5 Wolfgang Busch,6
Paolo Costantino,2 and Sabrina Sabatini2,7,*
1Department of Biology, University of Pisa - via L. Ghini, 13 - 56126 Pisa, Italy
2Dipartimento di Biologia e Biotecnologie, Laboratory of Functional Genomics and Proteomics of Model Systems, Università di Roma,
Sapienza - via dei Sardi, 70 - 00185 Rome, Italy
3Istituto di Biologia e Biotecnologia Agraria, Consiglio Nazionale delle Ricerche - Via Alfonso Corti, 12 - 20133 Milano, Italy
4Department of Plant and Microbial Biology, North Carolina State University, Raleigh, NC, United States
5Department of Biology and Howard Hughes Medical Institute, Duke University, Durham, NC 27708, USA
6Plant Molecular and Cellular Biology Laboratory, Salk Institute for Biological Studies, La Jolla, CA 92037, USA
7Lead Contact

*Correspondence: riccardo.dimambro@unipi.it (R.D.M.), sabrina.sabatini@uniroma1.it (S.S.)

https://doi.org/10.1016/j.cub.2019.02.022

SUMMARY RESULTS

Plant developmental plasticity relies on the activ-
ities of meristems, regions where stem cells contin-
uously produce new cells [1]. The lateral root cap
(LRC) is the outermost tissue of the root meristem
[1], and it is known to play an important role during
root development [2–6]. In particular, it has been
shown that mechanical or genetic ablation of LRC
cells affect meristem size [7, 8]; however, the mo-
lecular mechanisms involved are unknown. Root
meristem size and, consequently, root growth
depend on the position of the transition zone
(TZ), a boundary that separates dividing from
differentiating cells [9, 10]. The interaction of two
phytohormones, cytokinin and auxin, is funda-
mental in controlling the position of the TZ [9,
10]. Cytokinin via the ARABIDOPSIS RESPONSE
REGULATOR 1 (ARR1) control auxin distribution
within the meristem, generating an instructive
auxin minimum that positions the TZ [10]. We
identify a cytokinin-dependent molecular mecha-
nism that acts in the LRC to control the position
of the TZ and meristem size. We show that auxin
levels within the LRC cells depends on PIN-
FORMED 5 (PIN5), a cytokinin-activated intracellular
transporter that pumps auxin from the cytoplasm
into the endoplasmic reticulum, and on irreversible
auxin conjugation mediated by the IAA-amino
synthase GRETCHEN HAGEN 3.17 (GH3.17). By
titrating auxin in the LRC, the PIN5 and the
GH3.17 genes control auxin levels in the entire
root meristem. Overall, our results indicate that
the LRC serves as an auxin sink that, under the con-
trol of cytokinin, regulates meristem size and root
growth.
A Cytokinin-Dependent Pathway in the LRC Controls
Root Meristem Size
Root meristem size depends on cytokinin activity, which posi-
tions an auxin minimum, thereby coordinating differentiation of
cells exiting the meristem [10]. We previously developed a math-
ematical model that identified the LRC as a tissue possibly
involved in controlling the position of the auxin minimum and
thus meristem size [10]. To begin to identify the molecular mech-
anisms involved in mediating LRC dependent control of root
meristem size, we first asked if modulation of cytokinin levels
specifically in the LRC can regulate meristem size. To this
end, using the J2632 GAL4/UAS LRC-specific reporter line
(https://www.plantsci.cam.ac.uk/Haseloff) [11, 12], we ex-
pressed an inducible version of the CYTOKININ OXIDASE/
DEHYDROGENASE 1 (CKX1) gene [12], involved in cytokinin
catabolism, as well as an inducible constitutive active version
of the ARR1 gene (ARR1DDDK), involved in cytokinin signal
transduction response [13]. J2632;UAS::CKX1:GR plants,
upon dexamethasone (Dex) treatment, showed an increase in
the number of meristematic cells compared to untreated con-
trols (Figures 1A and 1B). These changes in meristem size
depend on a decreased cytokinin level in the LRC as revealed
by LRC specific qPCR analysis, where cytokinin inducible genes
such as GH3.17, ARR7, and ARR3 were downregulated upon
J2632;UAS::CKX1:GR induction [10, 14, 15] (Figure S1A). In
contrast, upon Dex treatment, J2632;UAS::ARR1DDDK-GR
plants, in which cytokinin response in the LRC is enhanced, dis-
played a reduced root meristem size (Figures 1A and 1B),
mimicking the effect of exogenous cytokinin applications [12].
Thus, these data suggest that cytokinin acts in the LRC to con-
trol differentiation of the inner root layers and, consequently,
determine root meristem size.
GH3.17 Regulates Meristem Size, Specifically from the
LRC
We have previously shown that to position the auxin minimum—
and therefore control meristem size—cytokinin promotes auxin

Current Biology 29, 1199–1205, April 1, 2019 ª 2019 Elsevier Ltd. 1199

inactivation by positively regulating the GH3.17 gene, which
conjugates amino acids to auxin [10]. GH3.17 is expressed in
the external layers of the LRC and in differentiated epidermal
cells (Figure S1B). GH3.17 activity in these tissues has
an impact on the overall auxin levels of the meristem due to
the peculiar auxin reflux loop, which redistributes auxin
over the entire root apex [10]. To determine if GH3.17 activity
in the LRC is sufficient to control root meristem size, we
overexpressed the GH3.17 gene in the LRC by generating
J2632;UAS::GH3.17-GR plants. Upon Dex treatment, these
plants exhibited a reduced meristem size as compared to
untreated plants (Figures S1C and S1D), suggesting that
GH3.17 activity in the LRC is sufficient to control meristem
size. To test this hypothesis, we performed tissue-specific
complementation of the gh3.17-1 mutant by reintroducing
1200 Current Biology 29, 1199–1205, April 1, 2019
Figure 1. Cytokinin Controls Root Meristem
Size from the LRC Tissue via GH3.17
(A) Confocal microscopy images of root meri-
stems of J2632;UAS::CKX1-GR and J2632;UAS::
ARR1DDDK-GR plants before and upon dexameth-
asone treatment (+Dex). Red channel: Propidium
iodine (PI) cell wall stain; Green channel: GFP (GFP
signal marks GAL4 activity, which coincides with
expression of the UAS constructs). The meristem size
is indicated as the number of meristematic cortex
cells: quiescent center (QC), blue arrowhead; cortical
transition boundary, white arrowhead. Scale bar,
100 mm.
(B) Quantification of meristematic cell number of
J2632;UAS::CKX1-GR and J2632;UAS::ARR1DDDK-
GR plants before and upon Dex treatment. Asterisk
indicates a significance with a p value < 0.001; Stu-
dent’s t test; n = 30. Error bars represent standard
deviation (SD).
(C) Bright field microscopy images of root apical
meristems of DEX induced WT and gh3.17-1 plants
carrying the M0126;UAS::GH3.17-GR and the
J2632;UAS::GH3.17-GR constructs, respectively. In
gh3.17-1;M0126,UAS::GH3.17-GR plants, GH3.17
expression was reintroduced only in the differenti-
ated epidermal cells. In gh3.17-1;J2632;UAS::
GH3.17-GR plants, GH3.17 expression was re-
introduced only in the mature LRC tissue. Blue
arrowheads indicate the QC and white arrowheads
indicate the cortical transition boundary (scale bar,
100 mm).
(D) Quantification of meristematic cortical cell
number of M0126;UAS::GH3.17-GR and gh3.17-
1;M0126;UAS::GH3.17-GR plants (n = 20).
(E) Quantification of meristematic cortical cell
number of J2632;UAS::GH3.17-GR and gh3.17-
1;J2632;UAS::GH3.17-GR plants (n = 22). Error
bars represent SD; asterisk indicates a significance
with a p value < 0.001; ns = not significant (Student’s
t test).
See also Figure S1.
GH3.17 either into differentiated epidermal
cells or into mature LRC tissue. We gener-
ated lines in which GH3.17 expression
was driven specifically in the differentiated
epidermal cells (M0126) or in the external
LRC tissue (J2632), gh3.17-1;M0126;UAS::GH3.17-GR, and
gh3.17-1;J2632;UAS::GH3.17-GR lines, respectively (Figure 1C;
Figure S1B). Induction of GH3.17 in the epidermis did not affect
root meristem size (Figures 1C and 1D), while induction in the
external layers of the LRC tissue rescued the enlarged root
meristem phenotype of the gh3.17-1 mutant (Figures 1C–1E).
Thus, GH3.17-mediated auxin inactivation in the LRC is neces-
sary and sufficient to control meristem size, suggesting that the
regulation of auxin quantity in the LRC defines auxin levels of the
entire root meristem.
Cytokinin Controls PIN5 Expression in the LRC via ARR1
To identify additional components involved in cytokinin-
dependent control of root meristem size from the LRC, we
examined the transcriptional profiles of LRC cells employing

fluorescence-activated cell sorting (FACS) coupled with time-
course expression profiling [16–19] at 3 time points: J2632;
UAS::ARR1DDDK-GR untreated (T0), 1 h (T1), and 4 h (T2)
Dex-treated plants. A total of 2,230 differentially expressed
genes were identified, which were clustered into 8 groups
based on their expression dynamics (Figure S2A). Clustered
genes were then analyzed for significantly enriched gene
ontology (GO) categories, transcription factor families, and bio-
logical processes (Figure 2A). Because we previously showed
that an auxin minimum positions the TZ [10], we focused on
genes related to auxin signaling, transport, and homeostasis.
Interestingly, auxin signaling genes, such as the Aux/IAA repres-
sors SHY2, AUXIN RESISTANT 3 (AXR3) [20], AUXIN RESISTANT
2 (AXR2) [21], and AUXIN RESISTANT 5 (AXR5) [22], were upregu-
lated following induction of ARR1DDDK. GO categories enriched
in indolacetic acid biosynthesis and tryptophan biosynthesis
genes, including TRYPTOPHAN AMINOTRANSFERASE OF
ARABIDOPSIS 1 (TAA1) [23], TRYPTOPHAN BIOSYNTHESIS 1
(TRP1) [24], and TRYPTOPHAN SYNTHASE ALPHA CHAIN
(TRP3) [25], were downregulated upon ARR1DDDK induction.
These data suggest that the LRC is a tissue where cytokinin
suppresses, at different levels, auxin activities (Figure 2A;
Figure S2A).
Notably, in the significantly enriched GO category ‘‘auxin ho-
meostasis’’, we found that PIN-FORMED 5 (PIN5), which
encodes for an intracellular transporter of auxin [26] was upregu-
Figure 2. ARR1 Positively Controls PIN5
Expression to Regulate Root Growth and
Meristem Size from the LRC
(A) Gene Ontology categories enrichment of ARR1
regulated genes in the LRC. Differentially regulated
genes were categorized into 8 clusters (columns).
GO categories significantly enriched among the
genes in each cluster (p < 10
3 according to a
hypergeometric test) are indicated. Color intensity
indicates increasing significance of enrichment.
(B) Bright field microscopy images of root apical
meristems of WT, pin5-3, PIN5OX and CK-treated
(+CK, 5 mM tZ 20 h) WT and pin5-3 lines. Blue ar-
rowheads indicate the QC and white arrowheads
indicate the cortical transition boundary. Scale
bars, 100 mm.
(C and D) Quantification of meristematic cell num-
ber (C) and root length (D) of WT, pin5-3, PIN5OX
and CK-treated (+CK) WT and pin5-3 roots.
Asterisk indicates a significance with a p value <
0.001 (Student’s t test) with the exception of
WT +CK in (D), where the p value < 0.05; n = 30.
Error bars represent SD.
See also Figure S2 and Table S1.
lated following ARR1DDDK induction (Fig-
ure 2A; Figure S2A). Given that it has been
shown that overexpression of PIN5 results
in decreased levels of free auxin and an
accumulation of IAA-Glu conjugates [26],
which are also downstream products of
GH3.17 activity [10], we hypothesized that
the PIN5 and the GH3.17 genes, under
the control of cytokinin, act in the LRC to
modulate auxin levels throughout the meristem thus determining
its size.
PIN5 and GH3.17 Act in the Same Pathway to Control
Root Meristem Size
We first investigated if cytokinin via ARR1, as in the case of
GH3.17 [10], directly controls PIN5 expression. ChIP-qPCR anal-
ysis of pARR1::ARR1-GFP plants revealed that ARR1 directly
binds the PIN5 promoter (Figure S2B). Moreover, 1 h induction
of ARR1DDDK was sufficient to increase PIN5 mRNA levels in
the LRC (Figure S2A). To determine if cytokinin induces PIN5
expression solely via ARR1, we monitored PIN5 mRNA levels
in the arr1-3 loss-of-function mutant. While PIN5 mRNA levels
are increased in wild-type (WT) upon cytokinin treatment, tran-
script levels are lower in both cytokinin-treated and -untreated
arr1-3 roots as compared to WT (Figure S2C). Taken together,
these data suggest that in the LRC, ARR1 directly and positively
regulates PIN5 expression.
To determine if PIN5 is involved in controlling root meristem
size, we analyzed roots of pin5-3 mutants and lines overex-
pressing PIN5 (PIN5OX) [26]. The pin5-3 mutant has an
enlarged meristem size and enhanced root growth, whereas
PIN5OX plants show reduced meristem size and root growth
as compared to WT (Figures 2B–2D). Furthermore, unlike WT
root meristems, cytokinin treatment of pin5-3 plants does not
affect meristem size (Figures 2B–2D). Thus, PIN5 is involved
Current Biology 29, 1199–1205, April 1, 2019 1201
Figure 3. PIN5 Activity Is Necessary for the GH3.17-Mediated Regulation of Meristem Size
(A) Bright field microscopy images of root apical meristems of WT, pin5-3, gh3.17-1, pin5-3;gh3.17-1, UBQ10::GH3.17 and pin5-3;UBQ10::GH3.17 plants. Blue
arrowheads indicate the QC and white arrowheads indicate the cortical transition boundary (scale bar, 100 mm).
(B and C) Quantification of root meristematic cell number (B) and root length (C) of WT, pin5-3, gh3.17-1, pin5-3;gh3.17-1, UBQ10::GH3.17 and
pin5-3;UBQ10::GH3.17 plants. Asterisk indicates a significance with a p value < 0.005; Student’s t test; n = 35. Error bars represent SD.
See also Figure S3.

in controlling root meristem size and root growth in response to
cytokinin.
To determine if GH3.17 and PIN5 act in the same pathway, we
generated a pin5-3;gh3.17-1 double mutant. The root meristem
size of the double mutant did not differ significantly from either
single mutant (Figures 3A–3C), indicating that PIN5 and
GH3.17 operate in the same pathway. Moreover, similar to
the gh3.17-1;shy2-31 double mutant [10], the shy2-31;pin5-3
double mutant had a larger meristem than either parent (Figures
S3A and S3B), indicating that PIN5 and SHY2 act in parallel
pathways.
To understand how the PIN5 and the GH3.17 proteins (activities)
interact, we produced pin5-3 plants overexpressing GH3.17 (pin5-
3;UBQ10::GH3.17 plants) and gh3.17-1 plants overexpressing
PIN5 (PIN5OX;gh3.17-1 plants). In contrast to constitutively ex-
pressed GH3.17 and PIN5 plants (UBQ10::GH3.17 and PIN5OX
plants), in which the root meristem was reduced in size, no reduc-
tion in meristem size was observed in pin5-3;UBQ10::GH3.17
plants (Figures 3A–3C), and only a slight reduction in meristem
size was observed in PIN5OX;gh3.17-1 plants (Figures S3C
and S3D). This indicates that PIN5 activity is dependent on
GH3.17 activity, and vice versa. Thus, PIN5 and the GH3.17 pro-
teins are both necessary to control auxin levels and thus meristem
size.
PIN5 is localized at the endoplasmic reticulum (ER) and me-
diates auxin flow from the cytoplasm to the ER lumen [26].
Either the ER or the cytosol have been hypothesized as com-
partments of activity of GH3 auxin conjugases, but supporting
evidence for one or the other location is still lacking [27–29].
To determine if GH3.17 is localized in the ER lumen or in the
cytosol, we investigated its intracellular localization by subcel-
lular fractionation on isopycnic sucrose density gradient in the
presence of Mg2+ or EDTA to ensure the identity of the ER.
GH3.17-GFP was exclusively detected in the fractions where
the cytosolic marker NES-YC3.6 was also detected (Fig-
ure S4). No GH3.17-GFP polypeptides were localized in frac-
tions containing the ER. Thus, our results indicate that in
Arabidopsis thaliana roots, GH3.17-GFP is mainly localized
in the cytosol.
Taken together, our observations are consistent with the hy-
pothesis that, to regulate meristem size, the PIN5 and the
GH3.17 genes control auxin level in the LRC cells by pumping
auxin into the ER lumen via PIN5 and by conjugating and degrad-
ing it in the cytosol via GH3.17.
Given that GH3.17 and PIN5 specifically act in the LRC, we
would expect to see auxin accumulation in the LRC in the
absence of both PIN5 and GH3.17 activities. The analysis of
DR5-RFP expression in the pin5-3 and gh3.17-1 mutants indeed
revealed heightened auxin response in the LRC of both mutant
(Figure 4A). Furthermore, upon cytokinin treatment, DR5-RFP
expression decreases in WT plant, but not in pin5-3 and
gh3.17-1 mutant plants, where auxin ectopic activity in the
LRC is not affected (Figures 4A and 4B). Thus, the PIN5 and
the GH3.17 genes control, in response to cytokinin, auxin levels
in the LRC, which in turn regulates meristem size.
DISCUSSION
The LRC is a tissue surrounding the root meristem in which
specific developmental signals have been proposed to direct
root growth [2–6, 30–32]. We have identified an LRC-specific
mechanism acting through the PIN5 and the GH3.17 genes,
which determines root meristem size under the control of
cytokinin. In particular, we show that in the LRC, cytokinin,
via ARR1, controls auxin levels by directly controlling transcrip-
tion of both the PIN5 auxin transporter (this work) and the
GH3.17 enzyme [10] (Figure 4B). Cytokinin acting on PIN5,
which pumps auxin from the cytoplasm into the ER lumen,
and on GH3.17 that inactivates auxin by conjugation to amino
acids regulates auxin levels in the LRC, thereby controlling
auxin levels in the entire root meristem. In this way, cytokinin
coordinates cell differentiation of all meristematic tissues likely

1202 Current Biology 29, 1199–1205, April 1, 2019

 Figure 4. Cytokinin through the PIN5 and the
GH3.17 Genes Controls Auxin Levels in the
LRC to Regulate Meristem Size
(A) Confocal microscope images with bright field
and RFP channel of DR5-RFP expression in the root
tip of WT, pin5-3 and gh3.17-1 mutant plants un-
treated and treated with cytokinin (+CK, 5 mM tZ 4 h).
Scale bar, 100 mm.
(B) Fluorescence quantification of DR5-RFP in WT,
pin5-3 and gh3.17-1 mutant plants untreated and
treated with cytokinin (+CK, 5 mM tZ 4 h). Asterisk
indicates a significance with a p value < 0.001;
Student’s t test; WT ± CK, n = 30; pin5-3 ± CK,
n = 38; gh3.17-1 ± CK, n = 34. ns = not significant
(Student’s t test). Error bars represent SD.
(C) Proposed model: cytokinin promotes auxin
degradation specifically in the LRC cells (highlighted
in green on the root layout) thereby driving root
meristem cell differentiation. Cytokinin, through the
ARR1 transcription factor, positively regulates the
expression of GH3.17 and PIN5. PIN5 activity con-
trols auxin flux into the ER. GH3.17 catalyzes auxin
conjugation with glutamate (IAA-Glu), thus inducing
its degradation. The combined activities of these
genes in the LRC control auxin levels throughout
the inner tissues of the meristem thus determining
its size.
See also Figure S4.

controlling, from this tissue, the position of the auxin minimum control meristem size to adapt root growth in response to the
[10]. The combined activity of these two genes allows a fast environment.
change in auxin levels, ensuring a prompt response of the
root meristem. Therefore, we propose that the LRC serves as STAR+METHODS
an auxin sink, which controls meristem size and ensures
coherent organ growth. In accordance, recent evidence indi- Detailed methods are provided in the online version of this paper
cates that auxin levels in the LRC cells are crucial to control and include the following:
lateral root formation and the overall root architecture [6].
Several recent observations point to PIN5 and GH3.17 as d KEY RESOURCES TABLE
having a role in perceiving external stimuli. The endosomal d CONTACT FOR REAGENT AND RESOURCE SHARING
Na+,K+/H+ antiporters NHX5 and NHX6, involved in pH regula- d EXPERIMENTAL MODEL AND SUBJECT DETAILS
tion, operate via PIN5 to control auxin homeostasis and d METHOD DETAILS
root growth [33]. Moreover, several abiotic stresses such as B Plant Material and Growth Conditions
osmotic, salt, hypoxia, and selenium cause a variation in B Root Length, Meristem Size and Cell Size Analysis
GH3.17 and PIN5 expression [34, 35]. It is tempting to speculate B Generation and Characterization of Transgenic Plants
that a combination of different external (i.e., abiotic stresses) B Fluorescence activated cell sorting (FACS) and Micro-
and internal (i.e., cytokinin) stimuli may be translated in the array data acquisition
LRC by the PIN5 and theGH3.17 genes into different levels of B RNA Isolation and qRT-PCR
auxin. In this scenario, external and internal signals would be B ChIP-qRT-PCR
coordinated to fine-tune intercellular and intracellular auxin B DR5-RFP Fluorescence Quantification
fluxes that, impacting on the position of the auxin minimum, B Antibodies

Current Biology 29, 1199–1205, April 1, 2019 1203

 B Subcellular Fractionation on Isopycnic Sucrose Gradi-
ents
B Hormonal Treatments
d QUANTIFICATION AND STATISTICAL ANALYSIS
SUPPLEMENTAL INFORMATION
Supplemental Information can be found with this article online at https://doi.
org/10.1016/j.cub.2019.02.022.
ACKNOWLEDGMENTS
We thank Renze Heidstra, Thomas Schmülling, and Takashi Aoyama
for sharing material and GrassRoots Biotechnology for providing the
pDONORP4P1-pUBQ10 vector, pub. no. WO/2012/006426. We thank Ji
rı́
Friml for providing the PIN5OX line. This work was supported by The European
Research Council grant 260368 (to S.S.) and MIUR (S.S. and R.D.M.).
AUTHOR CONTRIBUTIONS
R.D.M., N.S., R.D.I., E. Pierdonati, E.S., E. Pedrazzini, and S.P. conducted the
experiments. R.D.M., R.S., and W.B. assisted in the microarray experiments.
P.N.B., A.V., and P.C. discussed and interpreted results. R.D.M. and S.S.
conceived the research, designed the experiments and wrote the paper. All
authors commented on the manuscript.
DECLARATION OF INTERESTS
The authors declare no competing interests.
Received: July 20, 2018
Revised: December 27, 2018
Accepted: February 6, 2019
Published: March 14, 2019
REFERENCES
1. Dolan, L., Janmaat, K., Willemsen, V., Linstead, P., Poethig, S., Roberts,
K., and Scheres, B. (1993). Cellular organisation of the Arabidopsis thali-
ana root. Development 119, 71–84.
2. Swarup, R., Kramer, E.M., Perry, P., Knox, K., Leyser, H.M., Haseloff, J.,
Beemster, G.T., Bhalerao, R., and Bennett, M.J. (2005). Root gravitropism
requires lateral root cap and epidermal cells for transport and response to
a mobile auxin signal. Nat. Cell Biol. 7, 1057–1065.
3. Bennett, T., van den Toorn, A., Sanchez-Perez, G.F., Campilho, A.,
Willemsen, V., Snel, B., and Scheres, B. (2010). SOMBRERO, BEARSKIN1,
and BEARSKIN2 regulate root cap maturation in Arabidopsis. Plant Cell
22, 640–654.
4. Xuan, W., Audenaert, D., Parizot, B., Möller, B.K., Njo, M.F., De Rybel, B.,
De Rop, G., Van Isterdael, G., Ma €hönen, A.P., Vanneste, S., and
Beeckman, T. (2015). Root Cap-Derived Auxin Pre-patterns the
Longitudinal Axis of the Arabidopsis Root. Curr. Biol. 25, 1381–1388.
5. Kanno, S., Arrighi, J.F., Chiarenza, S., Bayle, V., Berthome, R., Pe
ret, B.,
Javot, H., Delannoy, E., Marin, E., Nakanishi, T.M., et al. (2016). A novel
role for the root cap in phosphate uptake and homeostasis. eLife 5,
e14577.
6. Xuan, W., Band, L.R., Kumpf, R.P., Van Damme, D., Parizot, B., De Rop,
G., Opdenacker, D., Möller, B.K., Skorzinski, N., Njo, M.F., et al. (2016).
Cyclic programmed cell death stimulates hormone signaling and root
development in Arabidopsis. Science 351, 384–387.
7. Blancaflor, E.B., Fasano, J.M., and Gilroy, S. (1999). Laser ablation of root
cap cells: implications for models of graviperception. Adv. Space Res. 24,
731–738.
8. Tsugeki, R., and Fedoroff, N.V. (1999). Genetic ablation of root cap cells in
Arabidopsis. Proc. Natl. Acad. Sci. USA 96, 12941–12946.
1204 Current Biology 29, 1199–1205, April 1, 2019
9. Dello Ioio, R., Nakamura, K., Moubayidin, L., Perilli, S., Taniguchi, M.,
Morita, M.T., Aoyama, T., Costantino, P., and Sabatini, S. (2008). A genetic
framework for the control of cell division and differentiation in the root mer-
istem. Science 322, 1380–1384.
10. Di Mambro, R., De Ruvo, M., Pacifici, E., Salvi, E., Sozzani, R., Benfey,
P.N., Busch, W., Novak, O., Ljung, K., Di Paola, L., et al. (2017). Auxin
minimum triggers the developmental switch from cell division to cell
differentiation in the Arabidopsis root. Proc. Natl. Acad. Sci. USA 114,
E7641–E7649.
11. Aoyama, T., and Chua, N.H. (1997). A glucocorticoid-mediated transcrip-
tional induction system in transgenic plants. Plant J. 11, 605–612.
12. Dello Ioio, R., Linhares, F.S., Scacchi, E., Casamitjana-Martinez, E.,
Heidstra, R., Costantino, P., and Sabatini, S. (2007). Cytokinins determine
Arabidopsis root-meristem size by controlling cell differentiation. Curr.
Biol. 17, 678–682.
13. Sakai, H., Honma, T., Aoyama, T., Sato, S., Kato, T., Tabata, S., and Oka,
A. (2001). ARR1, a transcription factor for genes immediately responsive to
cytokinins. Science 294, 1519–1521.
14. Jones, B., Gunnerås, S.A., Petersson, S.V., Tarkowski, P., Graham, N.,
May, S., Dolezal, K., Sandberg, G., and Ljung, K. (2010). Cytokinin regula-
tion of auxin synthesis in Arabidopsis involves a homeostatic feedback
loop regulated via auxin and cytokinin signal transduction. Plant Cell 22,
2956–2969.
15. Salome, P.A., To, J.P., Kieber, J.J., and McClung, C.R. (2006). Arabidopsis
response regulators ARR3 and ARR4 play cytokinin-independent roles in
the control of circadian period. Plant Cell 18, 55–69.
16. Birnbaum, K., Jung, J.W., Wang, J.Y., Lambert, G.M., Hirst, J.A.,
Galbraith, D.W., and Benfey, P.N. (2005). Cell type-specific expression
profiling in plants via cell sorting of protoplasts from fluorescent reporter
lines. Nat. Methods 2, 615–619.
17. Birnbaum, K., Shasha, D.E., Wang, J.Y., Jung, J.W., Lambert, G.M.,
Galbraith, D.W., and Benfey, P.N. (2003). A gene expression map of the
Arabidopsis root. Science 302, 1956–1960.
18. Brady, S.M., Orlando, D.A., Lee, J.Y., Wang, J.Y., Koch, J., Dinneny, J.R.,
Mace, D., Ohler, U., and Benfey, P.N. (2007). A high-resolution root spatio-
temporal map reveals dominant expression patterns. Science 318,
801–806.
19. Sozzani, R., Cui, H., Moreno-Risueno, M.A., Busch, W., Van Norman, J.M.,
Vernoux, T., Brady, S.M., Dewitte, W., Murray, J.A., and Benfey, P.N.
(2010). Spatiotemporal regulation of cell-cycle genes by SHORTROOT
links patterning and growth. Nature 466, 128–132.
20. Rouse, D., Mackay, P., Stirnberg, P., Estelle, M., and Leyser, O. (1998).
Changes in auxin response from mutations in an AUX/IAA gene. Science
279, 1371–1373.
21. Wilson, A.K., Pickett, F.B., Turner, J.C., and Estelle, M. (1990). A dominant
mutation in Arabidopsis confers resistance to auxin, ethylene and abscisic
acid. Mol. Gen. Genet. 222, 377–383.
22. Yang, X., Lee, S., So, J.H., Dharmasiri, S., Dharmasiri, N., Ge, L., Jensen,
C., Hangarter, R., Hobbie, L., and Estelle, M. (2004). The IAA1 protein is
encoded by AXR5 and is a substrate of SCF(TIR1). Plant J. 40, 772–782.
23. Stepanova, A.N., Robertson-Hoyt, J., Yun, J., Benavente, L.M., Xie, D.Y.,
Dolezal, K., Schlereth, A., Jürgens, G., and Alonso, J.M. (2008). TAA1-
mediated auxin biosynthesis is essential for hormone crosstalk and plant
development. Cell 133, 177–191.
24. Müller, A., Hillebrand, H., and Weiler, E.W. (1998). Indole-3-acetic acid is
synthesized from L-tryptophan in roots of Arabidopsis thaliana. Planta
206, 362–369.
25. Rutherford, R., Gallois, P., and Masson, P.H. (1998). Mutations in
Arabidopsis thaliana genes involved in the tryptophan biosynthesis
pathway affect root waving on tilted agar surfaces. Plant J. 16, 145–154.
26. Mravec, J., Skupa, P., Bailly, A., Hoyerová, K., Krecek, P., Bielach, A.,
Petrásek, J., Zhang, J., Gaykova, V., Stierhof, Y.D., et al. (2009).
Subcellular homeostasis of phytohormone auxin is mediated by the ER-
localized PIN5 transporter. Nature 459, 1136–1140.
27. Ru
zicka, K., and Hejátko, J. (2017). Auxin transport and conjugation
caught together. J. Exp. Bot. 68, 4409–4412.
28. Barbez, E., and Kleine-Vehn, J. (2013). Divide Et Impera–cellular auxin
compartmentalization. Curr. Opin. Plant Biol. 16, 78–84.
29. Skalický, V., Kube

s, M., Napier, R., and Novák, O. (2018). Auxins and
Cytokinins-The Role of Subcellular Organization on Homeostasis. Int. J.
Mol. Sci. 19, E3115.
30. Landrein, B., Kiss, A., Sassi, M., Chauvet, A., Das, P., Cortizo, M., Laufs,
P., Takeda, S., Aida, M., Traas, J., et al. (2015). Mechanical stress contrib-
utes to the expression of the STM homeobox gene in Arabidopsis shoot
meristems. eLife 4, e07811.
31. Liu, W., Li, R.J., Han, T.T., Cai, W., Fu, Z.W., and Lu, Y.T. (2015). Salt stress
reduces root meristem size by nitric oxide-mediated modulation of auxin
accumulation and signaling in Arabidopsis. Plant Physiol. 168, 343–356.
32. Betsuyaku, S., Sawa, S., and Yamada, M. (2011). The Function of the CLE
Peptides in Plant Development and Plant-Microbe Interactions.
Arabidopsis Book 9, e0149.
33. Fan, L., Zhao, L., Hu, W., Li, W., Novák, O., Strnad, M., Simon, S., Friml, J.,
Shen, J., Jiang, L., and Qiu, Q.S. (2018). Na+, K+ /H+ antiporters regulate
the pH of endoplasmic reticulum and auxin-mediated development.
Plant Cell Environ. 41, 850–864.
34. Kilian, J., Whitehead, D., Horak, J., Wanke, D., Weinl, S., Batistic, O.,
D’Angelo, C., Bornberg-Bauer, E., Kudla, J., and Harter, K. (2007). The
AtGenExpress global stress expression data set: protocols, evaluation
and model data analysis of UV-B light, drought and cold stress responses.
Plant J. 50, 347–363.
€utigam, K., and Campbell, M.M. (2010). Time of day shapes
35. Wilkins, O., Bra
Arabidopsis drought transcriptomes. Plant J. 63, 715–727.
36. Klein, E.M., Mascheroni, L., Pompa, A., Ragni, L., Weimar, T., Lilley, K.S.,
Dupree, P., and Vitale, A. (2006). Plant endoplasmin supports the protein
secretory pathway and has a role in proliferating tissues. Plant J. 48,
657–673.
37. Jansen, L., Roberts, I., De Rycke, R., and Beeckman, T. (2012). Phloem-
associated auxin response maxima determine radial positioning of lateral
roots in maize. Philos. Trans. R. Soc. Lond. B Biol. Sci. 367, 1525–1533.
38. Di Mambro, R., and Sabatini, S. (2018). Developmental Analysis of
Arabidopsis Root Meristem. Methods Mol. Biol. 1761, 33–45.
39. Di Ruocco, G., Di Mambro, R., and Dello Ioio, R. (2018). Building the differ-
ences: a case for the ground tissue patterning in plants. Proc. Biol. Sci.
285, 20181746.
40. Di Mambro, R., Sabatini, S., and Dello Ioio, R. (2018). Patterning the Axes:
A Lesson from the Root (Basel: Plants), p. 8.
41. Sabatini, S., Heidstra, R., Wildwater, M., and Scheres, B. (2003).
SCARECROW is involved in positioning the stem cell niche in the
Arabidopsis root meristem. Genes Dev. 17, 354–358.
42. Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J.
16, 735–743.
43. Levesque, M.P., Vernoux, T., Busch, W., Cui, H., Wang, J.Y., Blilou, I.,
Hassan, H., Nakajima, K., Matsumoto, N., Lohmann, J.U., et al. (2006).
Whole-genome analysis of the SHORT-ROOT developmental pathway in
Arabidopsis. PLoS Biol. 4, e143.
44. Orlando, D.A., Brady, S.M., Koch, J.D., Dinneny, J.R., and Benfey, P.N.
(2009). Manipulating large-scale Arabidopsis microarray expression
data: identifying dominant expression patterns and biological process
enrichment. Methods Mol. Biol. 553, 57–77.
45. Di Ruocco, G., Bertolotti, G., Pacifici, E., Polverari, L., Tsiantis, M.,
Sabatini, S., Costantino, P., and Dello Ioio, R. (2018). Differential spatial
distribution of miR165/6 determines variability in plant root anatomy.
Development 145, dev153858.
46. Pacifici, E., Di Mambro, R., Dello Ioio, R., Costantino, P., and Sabatini, S.
(2018). Acidic cell elongation drives cell differentiation in the Arabidopsis
root. EMBO J. 37, https://doi.org/10.15252/embj.201899134.
47. Perilli, S., Perez-Perez, J.M., Di Mambro, R., Peris, C.L., Dı́az-Triviño, S.,
Del Bianco, M., Pierdonati, E., Moubayidin, L., Cruz-Ramı́rez, A.,
Costantino, P., et al. (2013). RETINOBLASTOMA-RELATED protein stim-
ulates cell differentiation in the Arabidopsis root meristem by interacting
with cytokinin signaling. Plant Cell 25, 4469–4478.
48. Brunetti, P., Zanella, L., De Paolis, A., Di Litta, D., Cecchetti, V., Falasca,
G., Barbieri, M., Altamura, M.M., Costantino, P., and Cardarelli, M.
(2015). Cadmium-inducible expression of the ABC-type transporter
AtABCC3 increases phytochelatin-mediated cadmium tolerance in
Arabidopsis. J. Exp. Bot. 66, 3815–3829.
49. Ceriotti, A., Pedrazzini, E., De Silvestris, M., and Vitale, A. (1995). Import
into the endoplasmic reticulum. Methods Cell Biol. 50, 295–308.
Current Biology 29, 1199–1205, April 1, 2019 1205
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Rabbit polyclonal anti-GFP Thermo-Fisher Cat# A6455;
RRID:AB_221570
Rabbit polyclonal anti-endoplasmin/GRP94 [36] RRID:AB_10791076
Goat anti-Rabbit IgG (H+L) Secondary Antibody, HRP Conjugate Thermo-Fisher Cat# A16096;
RRID:AB_2534770
Bacterial and Virus Strains
Escherichia coli DH5a N/A N/A
Agrobacterium tumefaciens GV3101 N/A N/A
Chemicals, Peptides, and Recombinant Proteins
Murashige & Skoog Medium Duchefa Cat# M0221
Plant-agar Duchefa Cat# P1001
Sucrose Duchefa Cat# S0809
Kanamycin Sigma-Aldrich Cat# K1377
Rifampicin Duchefa Cat# R0146
Tetracycline Duchefa Cat# T0150
Gentamicin Duchefa Cat# G0124
Streptomycin Duchefa Cat# S0148
Spectinomycin Duchefa Cat# S0188
Phosphinothricin Sigma-Aldrich Cat# 77182-82-2
Phusion High-Fidelity DNA Polymerase New England Biolabs Cat# M0530S
trans-Zeatin Sigma-Aldrich Cat# Z0876
Dexamethasone Sigma-Aldrich Cat# D4902
Hpy188III NEB Cat# R0622S
Complete protease inhibitor cocktail Roche Cat# 11697498001
Critical Commercial Assays
SensiFAST SYBR Bioline Cat# BIO-92005
NucleoSpin RNA Plus Macherey-Nagel Cat# 740984
qPCRBIO SyGreen Mix PCR Biosystems Cat# PB20.11-05
Gel/PCR DNA Fragments Extraction Kit Geneaid Cat# DF100
NucleoSpin Plasmid Macherey-Nagel Cat# 740588
Gateway BP Clonase II Thermo-Fisher Cat# 11789
Gateway LR Clonase II Thermo-Fisher Cat# 11791
Superscript VILO cDNA Synthesis Kit Thermo-Fisher Cat# 11754
Rneasy Micro Kit QIAGEN Cat# 74004
Deposited Data
Microarray experiments Gene Expression Omnibus GEO: GSE117424
Experimental Models: Organisms/Strains
Arabidopsis: Col-0 Nottingham Arabidopsis N/A
Stock Centre
Arabidopsis: Landsberg erecta Nottingham Arabidopsis N/A
Stock Centre
Arabidopsis: gh3.17-1 [10] N/A
Arabidopsis: pin5-3 Nottingham Arabidopsis SALK_021738
Stock Centre
Arabidopsis: shy2-31 [9] N/A
Arabidopsis: UBQ10:GH3.17 [10] N/A
(Continued on next page)
e1 Current Biology 29, 1199–1205.e1–e4, April 1, 2019
Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Arabidopsis: PIN5OX [26] N/A
Arabidopsis: UAS:GH3.17-GR This paper N/A
Arabidopsis: UAS:ARR1-GR This paper N/A
Arabidopsis: UAS:CKX1-GR This paper N/A
Arabidopsis: J2632 Nottingham Arabidopsis N/A
Stock Centre
Arabidopsis: M0126 Nottingham Arabidopsis N/A
Stock Centre
Oligonucleotides
See Methods section and Table S1 N/A N/A
Recombinant DNA
pB7m43GW [10] N/A
P4P1-UAS This paper N/A
P221-GH3.17 [10] N/A
P2P3-GR This paper N/A
pGreenII0229 - UAS::AtCKX1-GR This paper N/A
pBI121 - UAS::ARR1DDDK-GR This paper N/A
Software and Algorithms
Excel Microsoft N/A
ImageJ https://imagej.nih.gov/ij/ N/A
ChipEnrich http://www.arexdb.org/software.html N/A
VirtualPlant 1.0 http://virtualplant.bio.nyu.edu/cgi-bin/vpweb/ N/A
TMeV http://www.tm4.org/ N/A
Other
Zeiss LSM 780 Zeiss N/A
Fitotron SGC 120 Growth chamber Weiss Technik, UK N/A
Zeiss Axio Imager A2 Zeiss N/A
7500 Fast Real-Time PCR system Applied Biosystems N/A
Zen software Zeiss N/A

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Sabrina
Sabatini (sabrina.sabatini@uniroma1.it).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Arabidopsis thaliana background lines Columbia-0 (Col-0) and Landsberg erecta (L. er.) were used for experimentation, with mutants
and transgenic lines in these backgrounds as detailed in the Key Resources Table.

METHOD DETAILS

Plant Material and Growth Conditions

The Arabidopsis thaliana ecotypes Columbia-0 (Col-0) and Landsberg erecta (Ler) were used as controls as the gh3.17-1 mutant
[10] and pin5-3 are in a Col-0 background and the shy2-31 mutant [9] is in a Ler background. pin5-3 mutant was obtained from
the NASC collection (SALK_021738). Homozygous mutants from the Salk T-DNA were identified by PCR as described (http://
signal.salk.edu/tdnaprimers.2.html). shy2-31 mutant was genotyped by CAPS and the amplicon (Oligo-F 50 -TGCAATTCTTGAA
GAAATGGATGAG-30 , Oligo-R 50 -AGCAAGAAACTCTCTCTTTTG-30 ) was digested with Hpy188III
Enhancer trap lines, M0126 and J2632 were obtained by the NASC.
pGH3.17::GH3.17-GFP, pUBQ10::GH3.17, PIN5OX and DR5-RFP transgenic plants have been described previously [10, 26, 37].
For growth conditions, Arabidopsis seeds were surface sterilized, and seedlings were grown on one-half strength Murashige and
Skoog (MS) medium containing 0.8% agar at 22 C in long-day conditions (16-h-light/8-h-dark cycle) as previously described [38].

Current Biology 29, 1199–1205.e1–e4, April 1, 2019 e2

Arabidopsis locus IDs from this article
ACTIN2 (AT3G18780), ARR1 (AT3G16857), PIN5 (AT5G16530), GH3.17 (AT1G28130), IAA3/SHY2 (AT1G04240), UBQ10
(AT4G05320).

Root Length, Meristem Size and Cell Size Analysis

For root length measurements, plates were photographed and the resulting images were analyzed using the analysis software
ImageJ 1.47v available online (https://imagej.nih.gov/ij/). Root meristem size of 5 days post germination plants was measured based
on the number of cortex cells in a file extending from the quiescent center to the first elongated cortex cell excluded, as described
previously [38–40]. Images were obtained using a confocal laser scanning microscope (Zeiss LSM 780). Differential Interference
Contrast (DIC) with Nomarski technology microscopy (Zeiss Axio Imager A2) was used to count meristem cell number. Plants
were mounted in a chloral hydrate solution (8:3:1 mixture of chloral hydrate:water:glycerol) [38]. For confocal laser scanning analysis,
the cell wall was stained with 10 mM propidium iodide. For each experiment a minimum of 20 roots for two biological replicates were
analyzed. Student’s t test was used to determine the statistical significance.

Generation and Characterization of Transgenic Plants

Standard molecular biology techniques and the Gateway system (Invitrogen) were used for the cloning procedures.
The AtCKX1 cDNA was provided by Thomas Schmülling (Free University of Berlin). The AtCKX1 cDNA was cloned downstream of
the UAS sequence [41]. The resulting UAS::AtCKX1 was transferred into the pGreenII0229 vector. The 0.9-kb GR fragment was
amplified from the pWOX5::SHR-GR construct (provided by Renze Heidstra, Utrecht University, the Netherlands) using the primers
50 -GCGGATCCTGGTGGTGAAGCTCGAAAAACAAAG-30 and 50 -GTGAGCTCGGGCCCTATTTTTGATGAAACAG-30 . The GR domain
was cloned into pGreenII0229 downstream in frame of the AtCKX1 cDNA that had been digested in order to eliminate the stop codon.
Competent E.coli cells were transformed and plated on LB-agar containing specific antibiotic. Transgenic lines were generated in the
J2632 background by floral dipping [42]. Three independent J2632;UAS::AtCKX1-GR and J2632;UAS::ARR1DDDK-GR homozy-
gous transgenic lines were selected on Hygromycin 40 mg/mL and analyzed. All transformants gave rise to similar phenotypes on
10 mM dexamethasone.
pBI121 35S::ARR1DDDK-GR vector was provided by Takashi Aoyama (Kyoto University, Japan). To obtain the UAS::ARR1DDDK-
GR construct, the 35S promoter in the pBI121 35S::ARR1DDDK-GR vector was replaced by the UAS sequence [41] obtained from
the pGreenII0229 UAS::AtCKX1-GR vector through digestion with specific restriction enzymes. Competent E.coli cells were
transformed and plated on LB-agar containing specific antibiotic. Transgenic lines were generated in the J2632 background by floral
dipping [42]. All transformants gave rise to similar phenotypes on 10 mM dexamethasone.
For the UAS::GH3.17-GR transgenic plant, the genomic sequence of GH3.17 (2450 bp) was amplified from genomic DNA of
Arabidopsis Columbia ecotype using specific primers (gGH3.17 FW 50 -ATGATACCAAGTTACGACCCAAAT-30 , gGH3.17 REV
50 -AGAATCTAAACCAAGTGGTTCCC-30 ) and cloned in a pDONOR221 (pDONOR221-gGH3.17). A LR reaction was then conducted
by using the pDONORP4P1-UAS, pDONOR221-gGH3.17 and a pDONORP2P3-GR vector. The LR products were sub-cloned in the
Gateway pBm43GW destination vector. Plasmids were transformed into Col-0 plants by floral dipping [42]. Homozygous lines were
crossed with J2632 and M0126 plants. All transformants gave rise to similar phenotypes on 10 mM dexamethasone.

Fluorescence activated cell sorting (FACS) and Microarray data acquisition

A time course experiment with the ARR1DDDK line at 0, 1 and 4h after ARR1DDDK induction by dexamethasone treatment was
performed. Roots were dissected at approximately 0.5 cm from the root tip. The protoplasts obtained from dissected J2632;
UAS::ARR1DDDK-GR, line was used for fluorescence-activated cell sorting [17]. From the GFP-positive sorted cell populations
the RNA was subsequently extracted using a Rneasy Micro Kit QIAGEN. Total mRNA was amplified using two-cycle Affymetrix
protocol. RNA isolation and probes for hybridization were prepared as described [18] [19]. Each microarray experiment was
replicated twice. The correlations between these biological replicates were higher than R2 = 0.92. A global normalization step was
applied to the ARR1DDDK-induction time courses using ANOVA [43]. Differentially expressed genes were identified based on
fold-change in expression and a significant ANOVA Q-value threshold (1.137-fold change and Q value < 0.000751). Figure of merit
(FOM) was used to identify eight clusters in ARR1 time course. K-means clustering, using a Pearson correlation as the distance
metric, was used to group the expressed genes downstream of ARR1. Gene ontology enrichment categories were found using
ChipEnrich software [44] (http://www.arexdb.org/software.html). Heatmaps were obtained using TMeV freeware (http://www.tm4.
org/) (Figure 2A and Figure S2A). Genes induced by dexamethasone alone were not included in the list of ARR1DDDK differentially
regulated genes. The gene identities were obtained using VirtualPlant 1.0 (http://virtualplant.bio.nyu.edu/cgi-bin/vpweb/).

RNA Isolation and qRT-PCR

Total RNA was isolated from root tissues of 5-day-old seedlings using NucleoSpin RNA Plus (Macherey-Nagel) and the first strand
cDNA was synthesized using the Superscript III First Strand Synthesis System (Invitrogen). Transcript levels were monitored by
qRT-PCR using gene-specific oligonucleotide primers (PIN5 RT2F CTCTCTTGTCGTTGGTGTGC (Figure S2C), PIN5 RT2R
AGAGTGTGAGCCACACGATG (Figure S2C), QPIN5 F CTGTGAAATGGTGGCACATC (Figure S2C), QPIN5 R CCCAAGGATGCAA
GAATAGC (Figure S2C), GH3.17 qPCR-FW CGCTGAAAAGTCGTGGGAAG (Figure S1A), GH3.17 qPCR-REV AGGAAACATCGG
CAGGATCA (Figure S1A), ARR7 qPCR-FW TGTTCTTGCCGTCGATGATA (Figure S1A), ARR7 qPCR-REV TGGCATTGAGTAA

e3 Current Biology 29, 1199–1205.e1–e4, April 1, 2019

TCCGTCA (Figure S1A), ARR3 qPCR-FW AGAAGGTGCGGAGGATTTTT (Figure S1A), ARR3 qPCR-REV AGATTCCATCGAGGA
TGTGG (Figure S1A). For J2632;UAS::AtCKX1-GR expression analysis experiments, qRT-PCR was performed on material extracted
from lateral root cap cells by FACS (see Fluorescence activated cell sorting (FACS) and Microarray data acquisition section). qRT-
PCR reactions were performed with Sensi Fast SYBR (Bioline) using a 7500 Fast Real-Time PCR system (Applied Biosystems),
according to the manufacturer’s instructions. Data were analyzed using the DDCt (cycle threshold) method and normalized
with the expression of the reference gene ACTIN2 (ACTIN qPCR-FW GACCAGCTCTTCCATCGAGAA, ACTIN qPCR-REV
CAAACGAGGGCTGGAACAAG) [45–48]. For each analysis, three technical replicates of qRT-PCR were performed on two indepen-
dent RNA batches. Results were comparable in all experiments. Student’s t test was used for data significance (https://graphpad.
com/quickcalcs/ttest2.cfm).

ChIP-qRT-PCR
Chromatin generated by ChIP experiments performed on roots of either 5-day-old seedlings [10], expressing ARR1 genomic
sequence under the control of its own promoter fused to GFP (pARR1::ARR1-GFP plants) [9], or Col-0 plants were used. The enrich-
ment of the PIN5 target promoter-regions DNA was analyzed using RT-qPCR (Figure S2B). A qPCR efficiency of 2-fold amplifications
per cycle was assumed, and sequences from UBIQUITIN 10 were used to normalize the results between samples.
Tiling along the PIN5 (AT5G16530) was done using sets of adjacent specific amplified regions (Figure S2B and Table S1) along 3.1
Kb region of the PIN5 promoter.

DR5-RFP Fluorescence Quantification

The fluorescence intensity of DR5-RFP expression in WT, pin5-3 and gh3.17-1 mutant plants untreated and treated with cytokinin
5 mM for 4 h (Figure 4A) was quantified as reported in [10]. Mean Grey Value of red channel of confocal laser scanning microscope
images was measured with the software ImageJ. Mean values and SD are plotted in Figure 4B.

Antibodies
The following antibodies were used in this study: rabbit polyclonal anti-GFP (1:5000 dilution, Invitrogen); rabbit polyclonal anti-endo-
plasmin/GRP94 (1:2,500 dilution) [36]; goat anti-rabbit IgG-peroxidase conjugate (1:20,000, Pierce Biotechnology, Rockford, IL,
USA).

Subcellular Fractionation on Isopycnic Sucrose Gradients

Seedlings from A.thaliana Col-0, pGH3.17::GH3.17-GFP or NES-YC3.6 were cultured in 1/2 Murashige and Skoog (MS) liquid basal
salt medium, supplemented with 3% sucrose, in axenic condition for 18 days, 6h day/8h night conditions. Roots were excised and
divided in two samples. Each sample was individually homogenized in an ice-cold mortar with a 5: 1 (v/w) ratio of homogenization
buffer [100 mM Tris-Cl pH 7.8, 10 mM KCl, 12% sucrose (w/w) and Complete protease inhibitor cocktail [Roche s.p.a.] containing
either 1 mM EDTA or 10 mM MgCl2. After homogenization, samples were clarified by centrifugation at 720 g, 5 min, 4 C to eliminate
starch and debris. GH3.17-GFP clarified MgCl2 homogenate were directly loaded on SDS-PAGE followed by protein blot with anti-
GFP antibodies, to analyzed polypeptides. Subcellular fractionation on isopycnic sucrose gradients in the presence of EDTA or
magnesium was performed as described by Ceriotti et al. [49]. Six hundred microliters of each clarified sample were loaded on
the top of 12 mL of a 16%–60% sucrose gradient and centrifuged at 100,000 g for 2 h at 4 C in a Beckman SW40.Ti rotor (Beckman,
Fullerton, CA, USA). After centrifugation, 21 fractions of 600 mL were collected. Forty microliters of each fraction were denatured and
analyzed by 15% SDS-PAGE, followed by protein blotting. Pellet of the gradient were directly resuspended in 600 mL SDS-PAGE
denaturation buffer. Immunodetection of GH3.17-GFP and NES-YC3.6 polypeptides or the ER luminal marker endoplasmin was
performed using anti-GFP or anti-endoplasmin antiserum, respectively (Figure S4).

Hormonal Treatments
5-day-old seedlings were transferred to solid one-half MS medium (mock condition) or with a suitable concentration of hormone. For
cytokinin treatment, we used trans-zeatin (tZ, Duchefa) at a final concentration of 5 mM. For dexamethasone (Dex, Sigma) treatment, a
final concentration of 10 mM was used.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical analysis was performed using GraphPad (www.graphpad.com). For all the experiments, we performed the analysis with a
large enough number of samples and experimental replicates to ensure statistical significance, as reported in corresponding figure
legends and paragraphs of STAR Methods Method Details section. Details of statistical tests used and of error bars are provided
in figure legends. A global normalization step using ANOVA was used for microarray experiments [43]. For all figures samples
representative pictures of the experiments were chosen. Statistical significance is indicated by * where the p value is reported in
the corresponding figure legend and paragraph of STAR Methods Method Details section.

Current Biology 29, 1199–1205.e1–e4, April 1, 2019 e4

Current Biology, Volume 29

Supplemental Information

The Lateral Root Cap Acts as an Auxin Sink

that Controls Meristem Size
Riccardo Di Mambro, Noemi Svolacchia, Raffaele Dello Ioio, Emanuela Pierdonati, Elena
Salvi, Emanuela Pedrazzini, Alessandro Vitale, Serena Perilli, Rosangela Sozzani, Philip N.
Benfey, Wolfgang Busch, Paolo Costantino, and Sabrina Sabatini
Supplemental Data

Figure S1. GH3.17 activity in the LRC is sufficient to control root meristem size, Related to
Figure 1. (A) Relative expression of GH3.17, ARR7 and ARR3 in J2632;UAS::CKX1-GR plants
after 1 hour of dexamethasone treatment as measured by qPCR analysis on LRC cells. Expression
levels are normalized to ACTIN and 0 corresponds to mRNA levels in untreated roots. Error bars
represent SD. Asterisk indicates a significance with a P-value<0.005 (Student’s t test, n=3). (B)
Confocal microscope images of root tips of GH3.17-GFP detected in the LRC and differentiated
epidermal cells, the UAS/GAL4 driver M0126 detected only in the differentiated epidermal cells and
the UAS/GAL4 driver J2632 line detected only in the LRC. In each panel, the left half picture shows
the merge between propidium iodine (PI) and GFP channels, while the right half picture shows only
the GFP channel. Scale bar, 100 μm. (C) Bright field microscopy images of root apical meristems
of J2632;UAS::GH3.17-GR root apical meristems before and upon dexamethasone treatment
(+Dex). Blue arrowheads indicate the QC and white arrowheads indicate the cortical transition
boundary (scale bars, 100 µm). (D) Quantification of meristematic cell number of
J2632;UAS::GH3.17-GR plants. Asterisk indicates significance (P-value<0.001; Student’s t test);
n=20. Error bars represent SD.
Figure S2. Cytokinin directly regulates PIN5 expression via ARR1, Related to Figure 2. (A)
(Top) Eight K-means clusters identified using FOM within the differentially expressed genes that
were measured in microarray experiments of ARR1 induction in the LRC
(J2632;UAS::ARR1ΔDDK-GR). Red lines show the centroids of expression for genes within the
cluster, the horizontal axis indicates the time points: 0, 1 and 4 hours of induction, respectively.
(Bottom) Heat map representations of clustered genes. Yellow indicates up-regulation, blue
indicates down-regulation as indicated in the piecewise colored bar. (B) Primer positions along the
PIN5 promoter used for ChIP-qPCR. ChIP-qPCR analysis performed on 5-days old ARR1-GFP root
apical meristems. X-axis: Position relative to PIN5 transcription start site (TSS). Y-axis: fold
enrichment of anti-GFP immunoprecipitated material relative to input. Data shown are
representative of three independent experiments. Error bars indicate standard error (SE). *p < 0.005
(Student’s t test). (C) Relative expression of PIN5 in WT and arr1-3 plants before and after 3 hours
of cytokinin treatment as measured by qPCR. Error bars represent SD. Asterisk indicates a
significance with a P-value<0.001 (Student’s t test, n=3).
Figure S3. PIN5 and SHY2 operate in parallel pathways to control root meristem size, Related
to Figure 3. (A) Bright field microscopy images of root apical meristems of WT, pin5-3, shy2-31 and
pin5-3;shy2-31 double mutant plants. Blue arrowheads indicate the QC and white arrowheads
indicate the cortical transition boundary. Scale bar: 100 μm. (B) Quantification of meristematic cell
number of WT, pin5-3, shy2-31 and pin5-3;shy2-31 roots. Asterisk indicates a significance with a P-
value< 0.005. Student’s t test. n=30. Error bars represent SD. (C) Bright field microscopy images of
root apical meristems of WT, PIN5OX, gh3.17-1 and PIN5OX;gh3.17-1 double mutant plants. Blue
arrowheads indicate the QC and white arrowheads indicate the cortical transition boundary. Scale
bar: 100 μm. (B) Quantification of meristematic cell number of WT, PIN5OX, gh3.17-1 and
PIN5OX;gh3.17-1 roots. Asterisk indicates a significance with a P-value<0.001. Student’s t test.
n=20. Error bars represent SD.
Figure S4. GH3.17-GFP cofractionates with the cytosol, Related to Figure 4. Roots from
GH3.17-GFP or NES-YC3.6 were homogenized in sucrose buffer containing MgCl2 or EDTA, in
the absence of detergent. GH3.17-GFP clarified MgCl2 homogenate were directly loaded on SDS-
PAGE followed by protein blot with anti-GFP antibodies, to analysed polypeptides and check
antiserum specificity (A). The homogenates were fractionated by centrifugation on isopycnic
sucrose gradient (16%-60% w/w) in the presence of MgCl2 (B-D) or EDTA (E-G). The chelation of
Mg2+ with EDTA detaches the ribosomes from the membrane, determining a density shift of the
ER-derived microsomes to lighter fractions of the gradient. Collected fractions were analyzed by
SDS-PAGE followed by immunoblotting with anti-GFP antiserum (C, D, F, G) or with antiserum
against the ER marker endoplasmin (B, E). In the presence of MgCl2, the ER marker endoplasmin
was mainly detected in three fractions with a peak around density of 1.17 mg/mL (B); the small
proportion at top of the gradient is common for soluble ER residents and indicates either partial
release from the ER lumen upon homogenation or partial traffic form the ER to the vacuole.
Chelation of Mg2+ by EDTA caused shift of endoplasmin to lighter fractions, consistent with the
expected shift of ER density (E). GH3.17-GFP was exclusively detected in the lightest fractions at
the top of the gradient, both in the present of MgCl2 or EDTA (C, F), where the cytosolic marker
NES-YC3.6 was also detected (D, G). No GH3.17-GFP polypeptides were localized in fractions
containing the ER. The identity of polypeptides is indicated at right. Numbers at top indicate the
density (g/ml) of sucrose. Numbers at left indicate the position of molecular mass markers, in kD.
PIN5_Oligo1F AAACCGGGTGGTTCATGTTA
PIN5_Oligo1R CAAAGGCAAAGCTAGAAACGA
PIN5_Oligo2F TGGTGTACCCTTCAAGTTCTAAA
PIN5_Oligo2R TAGCCGCATCAACAACACTC
PIN5_Oligo3F CGAAGCAATGAAGGAACAGA
PIN5_Oligo3R TCCAAGTGCAGGTGGAATAA
PIN5_Oligo4F TGAAAGATTAGTGTGTGGATATGGA
PIN5_Oligo4R GCAGCCAATAGAAAGGGAAA
PIN5_Oligo5F TGAAAGATTGAAAGGAAAACGAA
PIN5_Oligo5R TCCCAAACCACAAAAACAAA
PIN5_Oligo6F GCTAGCTATTTCTGACATAATTCAAG
PIN5_Oligo6R TTCTCTCATTCATTCATTCATCG
PIN5_Oligo7F CATCAGTCAAATCCCCCTTT
PIN5_Oligo7R TGGAAACACCTATCTTTACCAAA
PIN5_Oligo8F TGTAATAGAAAAGACTTTGTGAATGGA
PIN5_Oligo8R ATTGCTAGGTGCAATATCATCA
PIN5_Oligo9F AATGGCTTCCTCAATCCTCA
PIN5_Oligo9R TGGCCATGTCTTTCTTCTTTG
PIN5_Oligo10F GTCGTAGGGCACAAATACCC
PIN5_Oligo10R CCACTTTCATAAAATGGGAGCA
PIN5_Oligo11F ATTTGGTTAGTCTCATGTGTTGTG
PIN5_Oligo11R GCTTTAGCACCATAACTAGAAGATCG
PIN5_Oligo12F CAGGAAACAATTGGAATAGAATCA
PIN5_Oligo12R AAATCAACCTCATATTTTTAGCCATT
PIN5_Oligo13F TGAACATGTTGGTTTCTCTATCG
PIN5_Oligo13R GAAATGTTGCAGTAGTAGCAAACG
NEGPIN5_Oligo1F TCGCATGGGCTTTTATTTCT
NEGPIN5_Oligo1R TCCCTGATCACACATACTAATTAACAC
NEGPIN5_Oligo2F CCGGGCATATTAGAGGGTTC
NEGPIN5_Oligo2R TGCATGGACATAAATAAACGTACC
UBQ10-F GGCCTTGTATAATCCCTGATGAATAAG
UBQ10-R AAAGAGATAACAGGAACGGAAACATA

Table S1. ChIP-qPCR primers, Related to STAR Methods.