Sei sulla pagina 1di 74

Materiali e metodi

1. INTRODUZIONE

1.1

Il metabolismo energetico: mitocondri e metabolismo lipidico

1.1.1 I mitocondri
I mitocondri sono gli organelli subcellulari deputati al metabolismo ossidativo dei substrati intermedi glucidici, lipidici e aminoacidici nei tessuti animali [Darley-Usmar V. et al., 1994]. I mitocondri sono presenti in ogni cellula in numero variabile e la loro densit in genere proporzionale alla capacit ossidativa tissutale. I mitocondri sono sede della beta-ossidazione degli acidi grassi responsabile del catabolismo lipidico tissutale. Il ciclo degli acidi tricarbossilici nella matrice mitocondriale catalizza inoltre a partire dai prodotti del metabolismo intermedio glucidico, lipidico e proteico le reazioni che creano equivalenti riducenti, a loro volta trasportati agli enzimi della catena respiratoria. I complessi enzimatici della catena respiratoria sono localizzati sulla membrana mitocondriale interna e comprendono: complesso I (NADH ubichinone reduttasi), II (succinico ubichinone reduttasi), III (ubichinolo citocromo c reduttasi), IV (citocromo c ossidasi - COX). Gli elettroni sono trasferiti dal NADH e dal FADH2 allubichinone, quindi ridotto ad ubichinolo. Lubichinolo citocromo c reduttasi veicola gli elettroni

Materiali e metodi

dallubichinolo al citocromo c, che diffondendo in senso laterale lungo la superficie della membrana trasferisce gli elettroni a COX che a sua volta li cede allO2, riducendolo ad H20. Le reazioni ossidative sopra descritte si associano secondo la teoria chemio-osmotica di Mitchell alla creazione da parte dei complessi I, III e IV di un gradiente elettrochimico attraverso la membrana mitocondriale interna [Mitchell P. et al., 1972]. Tale gradiente protonico fornisce lenergia potenziale utilizzata dallenzima ATP-sintetasi (complesso V della catena respiratoria) per la produzione di adenosin trifosfato (ATP) con legame ad alta energia tra adenosin difosfato (ADP) e gruppo fosforico [Rawn JD. et al., 1990][Boss O. et al., 2000]. La sintesi di ATP rappresenta il fine e il processo centrale del metabolismo in quanto i legami ad alta energia in esso contenuti costituiscono la fonte di energia chimica per tutte le reazioni cellulari endoergoniche. Il metabolismo ossidativo mitocondriale fornisce la maggior parte dellATP cellulare e i mitocondri hanno pertanto un ruolo fondamentale nellutilizzazione dei substrati intermedi per la produzione di energia chimica tissutale. I mitocondri contengono molecole di DNA circolare della lunghezza di circa 16.000 basi contenente geni codificanti per il dodici percento delle subunit degli enzimi della catena respiratoria [Anderson S. et al., 1981], tra cui sette subunit del complesso I, una del III, tre del IV, due del V. Ogni mitocondrio contiene numerose copie di DNA, per un totale di centinaia di
2

Materiali e metodi

copie per cellula. Tale poliplasmia rappresenta un fattore importante nel determinare limpatto di mutazioni mitocondriali sul metabolismo energetico cellulare e tissutale, che dipender infatti dalla proporzione di molecole mutate in rapporto a quelle non alterate in ogni mitocondrio e in ogni cellula. La trascrizione a mRNA e la sintesi delle proteine codificate dai geni mitocondriali avviene nel mitocondrio e viene coordinata con quella delle proteine mitocondriali codificate da geni nucleari mediante meccanismi regolatori integrati che sono ancora in parte sconosciuti. Sar nostro interesse nel presente lavoro focalizzare lattenzione su citocromo c ossidasi (COX) e citrato sintetasi (CS). COX rappresenta infatti lenzima chiave e, a causa della sua posizione immediatamente precedente la sintesi di ATP, generatore di flusso protonico nella catena respiratoria. COX un complesso enzimatico a configurazione metalloproteica localizzato nella membrana mitocondriale interna [Hanson BJ. et al., 2001][Bruno C. et al., 1999][Daurelio M. et al., 2001]. La citocromo ossidasi umana costituita da 13 subunit, le pi voluminose delle quali, la I, la II e la III, costituiscono il core catalitico dellenzima e sono codificate dal DNA mitocondriale [Goldberg A. et al., 2003]. Le altre subunit polipeptidiche alcune delle quali modulano la catalisi, altre lassemblaggio e la stabilit dellintero oloenzima [Dagsgaard C. et al., 2001], sono codificate da geni nucleari. La citrato sintetasi

Materiali e metodi

essenzialmente localizzata nella matrice mitocondriale e rappresenta un enzima chiave del ciclo di Krebs. La produzione mitocondriale di ATP fornisce la maggior parte dellenergia chimica necessaria alle funzioni tissutali. Il muscolo scheletrico ed il fegato sono i tessuti responsabili di larga parte (oltre il 50%) del consumo di ossigeno corporeo totale a riposo [Rolfe FSD. et al., 1999][Rolfe DF. et al, 1994]. Alterazioni del metabolismo energetico in questi tessuti hanno pertanto un impatto rilevante sulla spesa energetica e sul bilancio energetico corporeo totale. Lattivit contrattile riveste un ruolo primario nel consumo energetico del muscolo scheletrico. La contrazione muscolare sostenuta dallinterazione tra le teste miosiniche ed i filamenti di actina durante la quale le prime idrolizzano lATP [Alberts B. et al, 1990]. Un considerevole consumo energetico va associato inoltre al turnover delle proteine contrattili e strutturali che costituiscono la massima parte della massa tissutale nellambito dei processi di rimodellamento continuo (sintesi e breakdown) che ne garantiscono lefficienza [Nair KS. et al. , 2000] [Nair KS. et al., 1983][Rooyakers O. et al., 1996][Charlton M. et al.,1998]. Anche per la sua massa elevata il muscolo scheletrico ha inoltre un ruolo metabolico fondamentale nel determinare i livelli di utilizzazione dei substrati lipidici e glucidici [Rawn JD. et al., 1990], influenzandone in modo significativo il metabolismo corporeo totale. A conferma di questa relazione, riduzioni marcate della massa muscolare quali si
4

Materiali e metodi

riscontrano ad esempio nellinvecchiamento o nel corso di malattie croniche sistemiche si associano a una ridotta utilizzazione totale di glucosio e ad unaumentata incidenza di diabete mellito tipo II [Barzilai N. et al., 1995][Evans WJ. et al., 1995][Lindstrom B. et al., 1997][Mc Donag MJ. et al., 1984][Rolfe DF. et al., 1994][Nair KS. et al., 2000].

1.2

La regolazione del metabolismo lipidico muscolare


I principali processi metabolici che coinvolgono gli acidi grassi sono la

beta ossidazione mitocondriale e la sintesi da acetil-Coenzima A (lipogenesi) [Winder WW. et al., 1999].

1.2.1 La lipoossidazione
Avviene come ricordato nella matrice mitocondriale. Sebbene gli enzimi mitocondriali coinvolti siano ossidasi, un passaggio limitante della betaossidazione il trasporto degli acidi grassi dallo spazio citoplasmatico al mitocondrio stesso. Tale reazione catalizzata dalla carnitina-palmitoil transferasi-I (CPT-I) che rappresenta quindi un importante bersaglio di studio per la regolazione dei processi ossidativi lipidici.

Materiali e metodi

1.2.2 La lipogenesi
Il processo di sintesi di acidi grassi e successivamente di trigliceridi a partire da acetil-Coenzima A e glicerolo prende il nome di lipogenesi. LacetilCoenzima A carbossilasi (ACC) lenzima che catalizza la prima reazione di questo processo e sede cruciale della sua regolazione [Winder WW. et al.,1999]. ACC catalizza la sintesi di due molecole di acetil-Coenzima A a malonil-Coenzima A. Il malonil-Coenzima A a sua volta in grado di modulare il flusso di acidi grassi verso la lipoossidazione in quanto le sue concentrazioni sono inversamente proporzionali alla attivit di CPT-I. Ridotti livelli di malonil-Coenzima A stimolano pertanto CPT-I favorendo la beta-ossidazione mitocondriale degli acidi grassi mentre un aumento di malonil-Coenzima A favorisce le reazioni successive della lipogenesi che coinvolgono soprattutto la sintetasi degli acidi grassi (FAS).

Materiali e metodi

1.2.3 Fattori di regolazione del metabolismo degli acidi grassi


Negli ultimi anni sono stati identificati importanti regolatori del metabolismo degli acidi grassi in grado di modulare lattivit e il bilancio netto tra lipoossidazione e lipogenesi nel muscolo scheletrico. Tra questi spiccano il peroxisome-proliferative activator receptorgamma (PPARgamma), il PPAR-alpha, il PPAR-gamma coactivator-1alpha (PGC-1alpha) e il regolatore metabolico kinasi AMP-dipendente (AMPK).
a) PPARgamma: il PPARgamma un fattore di trascrizione nucleare

in grado di modulare la trascrizione di numerosi geni coinvolti nel metabolismo lipidico [Hevener AL. et al., 2003][Jove M. et al., 2004][Lapsys NM. et al., 2000][Norris AW. et al., 2003][Olefsky JM. et al., 2000][Way JM. et al., 2001][Rhee J. et al., 2003]. PPARgamma espresso in vari tessuti tra cui il tessuto adiposo dove ha un ruolo adipogenico e lipogenico. Nel muscolo scheletrico in particolare PPARgamma stato dimostrato avere livelli di espressione proporzionali a geni lipoossidativi [Lapsys NM. et al., 2000]. b) PPARalpha: PPARalpha un fattore nucleare di regolazione trascrizionale appartenente alla stessa famiglia di PPARgamma. Il suo ruolo principale appare associato alla stimolazione della beta-

Materiali e metodi

ossidazione degli acidi grassi soprattutto in condizioni di digiuno e dopo esercizio fisico [Leone TC. et al., 1999].
c) PGC-1alpha: PGC-1alpha appare associato a un incremento

coordinato della capacit ossidativa mitocondriale e di ossidazione degli acidi grassi in diversi tessuti [Rhee J. et al., 2003][Patti ME. et al., 2003][Mootha VK. et al., 2003][Puigserver P. et al., 2003][Attie AD. et al., 2003]. Un aumento dellinteresse verso PGC-1alpha si verificato in seguito alla scoperta di una sua ridotta espressione e attivit nel muscolo scheletrico di pazienti con insulino-resistenza e diabete tipo 2 [Patti ME. et al., 2003][Mootha VK. et al., 2003][Puigserver P. et al., 2003][Attie AD. et al., 2003]. In tali condizioni patologiche una ridotta espressione di PGC-1alpha potrebbe rappresentare un potenziale mediatore delle alterazioni del metabolismo lipidico-mitocondriale, che a loro volta sono ipotizzate avere un ruolo patogenetico-causale nella insulino-resistenza [Patti ME. et al., 2003][Mootha VK. et al., 2003][Puigserver P. et al., 2003][Attie AD. et al., 2003]. d) AMPK: AMPK svolge un ruolo centrale nella regolazione del bilancio tra lipogenesi e ossidazione lipidica in vari tessuti comprendenti il fegato [Winder WW. et al., 1999] e il muscolo scheletrico [Yamauchi T. et al., 2002]. Inoltre AMPK svolge un
8

Materiali e metodi

ruolo rilevante anche nella regolazione del metabolismo glucidico e la sua attivazione determina una soppressione della gluconeogenesi epatica [Lochhead PA. et al., 2000][Yamauchi T. et al., 2002]. AMPK un eterotrimero costituito da tre subunit ,,. La subunit contiene il dominio chinasico e contribuisce al legame con lAMP. La coespressione delle tre subunit richiesta per garantire lattivit chinasica. La regolazione dellattivit di AMPK principalmente legata ai livelli di fosforilazione del residuo treoninico della subunit catalitica, a sua volta almeno in parte dipendente dal rapporto delle concentrazioni intracellulari di AMP e ATP. Lattivazione di AMPK per mezzo della fosforilazione determina una cascata di eventi, cos riassumibile: - Attivazione della lipoossidazione per fosforilazione dellenzima ACC, che, venendo cos ad essere inattivato, riduce il suo prodotto metabolico, il malonil CoA, importante inibitore di CPT-I. In tal maniera si aumenta la quota di acidi grassi che penetra allinterno del mitocondrio e che vengono dirottati alla -ossidazione. - Possibile stimolazione della biogenesi mitocondriale muscolare - Inibizione della lipogenesi

Materiali e metodi

1.3

Linsulina

1.3.1 Linsulina e il metabolismo intermedio


Linsulina ha un ruolo fondamentale nella regolazione del metabolismo intermedio . Linsulina il maggiore ormone anabolico in grado di favorire laccumulo e la conservazione dei substrati nonch la loro utilizzazione in senso anabolico inibendone nel contempo il catabolismo. Linsulina responsabile della captazione del glucosio e della sua utilizzazione per la sintesi di glicogeno nei tessuti periferici insulino-sensibili tra cui il muscolo scheletrico ed il fegato [Rhee J. et al., 2003]. Linsulina inoltre inibisce la produzione epatica di glucosio da precursori non glucidici [Rasmussen BB. et al., 1999][Revers RR. et al., 1984]. In assenza di insulina quale si verifica nel diabete tipo 1 lutilizzazione di glucosio muscolare ridotta e la produzione dello stesso nettamente aumentata, risultando in un aumento netto delle concentrazioni plasmatiche (iperglicemia) [Rasmussen BB. et al., 1999][Revers RR. et al., 1984]. Linsulina ha anche importanti effetti sul metabolismo lipidico inibendo la lipolisi nel tessuto adiposo e lossidazione degli acidi grassi tissutali favorendo la lipogenesi e laccumulo di trigliceridi nello stesso, nonch nel fegato [Rajala MW. et al., 2003][Randle PJ. et al., 1963]. Una riduzione dellossidazione degli acidi grassi da parte dellinsulina si pu riscontrare anche

10

Materiali e metodi

nel muscolo scheletrico [Rajala MW. et al., 2003][Randle PJ. et al., 1963]. In carenza di insulina la lipolisi nel tessuto adiposo aumentata con conseguente incremento degli acidi grassi circolanti che a livello epatico vengono captati e ossidati in eccesso determinando unabnorme produzione dei corpi chetonici (acetoacetato, -idrossi butirrato, acetone) [Ruderman NB. et al., 1999]. Infine linsulina stimola lanabolismo proteico riducendo la proteolisi e questo effetto pu acutamente determinare una riduzione dei livelli circolanti di aminoacidi se questi non sono mantenuti da supplementazione esogena, quale tipicamente si verifica durante il pasto. La carenza di insulina causa pertanto perdita di massa proteica, soprattutto evidente a livello muscolare scheletrico [Charlton M. et al., 1998][Nair KS. et al., 1995][Biolo G. et al., 1993][Smith OL. et al., 1989][Ashford AJ. et al., 1986]. Aumenti delle concentrazioni circolanti di insulina si riscontrano, in condizioni fisiologiche, soprattutto in presenza di introito calorico nel periodo post-prandiale [Rhee J. et al., 2003]. In queste condizioni aumenti anche moderati della glicemia stimolano la secrezione pancreatica di insulina. Gli effetti metabolici globalmente riassunti nel paragrafo precedente appaiono pertanto riconducibili e finalizzati allutilizzo a scopo anabolico dei substrati introdotti attraverso la dieta. La capacit dellinsulina di stimolare la utilizzazione (soprattutto a livello muscolare) del glucosio risulta di fondamentale importanza nel determinare lomeostasi del metabolismo
11

Materiali e metodi

glucidico [Rhee J. et al., 2003][Samec S. et al., 2002]. Condizioni in cui questa capacit patologicamente ridotta, tra le quali spicca lobesit, sono globalmente definite come insulino-resistenti e linsulino-resistenza del metabolismo glucidico ha un enorme impatto socio-sanitario essendo alla base del diabete tipo 2, la cui incidenza sta assumendo proporzioni epidemiche nel mondo occidentale e nei paesi in via di sviluppo.

1.3.2 Linsulina e il metabolismo lipidico-mitocondriale


Effetti dellinsulina sullespressione genica e la funzione mitocondriale sono emersi recentemente in modelli non-diabetici umani e animali [Huang X. et al., 1999][Stump CS. et al., 2003][Boirie Y. et al., 2001]. Studi recenti hanno infatti dimostrato rilevanti effetti della somministrazione di insulina sullespressione genica mitocondriale in soggetti sani. Huang et al. riportavano in soggetti umani non-diabetici un aumento dei livelli di RNA relativi ad enzimi della catena respiratoria quali lNADH deidrogenasi e la citocromo c ossidasi (COX) dopo infusione endovenosa di insulina a livelli paragonabili a quelli post-prandiali per due ore [Huang X. et al., 1999]. Gli effetti dellinsulina sullattivit mitocondriale risultano essere almeno in parte tessuto-specifici. Uno studio della sintesi proteica mitocondriale in diversi tessuti (muscolo scheletrico e cardiaco, fegato), ha dimostrato che, in presenza di stimolazione

12

Materiali e metodi

della sintesi proteica nei mitocondri muscolari, si rilevava una concomitante soppressione della stessa in quelli epatici, mentre non si rilevavano alterazioni significative nel muscolo cardiaco [Boirie Y. et al., 2001]. Ulteriori studi hanno dimostrato che linfusione di insulina per 8h aumentava nel muscolo scheletrico (vasto laterale) i livelli di mRNA e la sintesi proteica mitocondriali nonch lattivit enzimatica di COX e della citrato sintetasi [Stump CS. et al., 2003] in volontari sani quando linfusione di aminoacidi esogeni preveniva la riduzione dei livelli di aminoacidi circolanti che si osserverebbe fisiologicamente a causa delleffetto soppressivo insulinico sulla proteolisi muscolare [Nair KS. et al., 1995]. Tali studi suggeriscono quindi un effetto stimolante la funzione mitocondriale muscolare da parte delliperinsulinemia acuta. Occorre peraltro ricordare che linsulina non si dimostrata in grado di stimolare la funzione mitocondriale muscolare a livello di attivit enzimatiche e di produzione di ATP in assenza di infusione di aminoacidi con riduzione dei livelli aminoacidici circolanti [Young ME. et al., 2001]. Questo risultato suggerisce una stretta interazione tra substrati e insulina negli effetti mitocondriali di questultima. Il riscontro di effetti stimolanti dellinsulina sul metabolismo mitocondriale muscolare almeno in condizioni sperimentali appare inoltre almeno in parte non coordinato con effetti gi sopra ricordati di inibizione del metabolismo ossidativo degli acidi grassi che tuttavia avviene interamente nei
13

Materiali e metodi

mitocondri [Rajala MW. et al., 2003][Randle PJ. et al., 1963][Shetty GK. et al., 2004]. Non sono peraltro disponibili studi che abbiano simultaneamente valutato gli effetti di uniperinsulinemia acuta fisiologica sulla funzione ossidativa mitocondriale e sul metabolismo lipidico nel muscolo scheletrico.

1.3.3 Linsulino-resistenza e la funzione mitocondriale


Occorre inoltre ricordare che una riduzione della funzione mitocondriale muscolare e una ridotta capacit ossidativa degli acidi grassi si associano a condizioni di iperinsulinemia cronica moderata in condizioni quali obesit e diabete tipo 2 [Anderwald C. et al., 2002][Barazzoni R. et al., 2004][Barazzoni R. et al., 2005][Harano Y. et al., 1972]. Tali alterazioni si associano a un accumulo tissutale muscolare di trigliceridi e sono state recentemente ipotizzate essere alla base della insulino-resistenza che caratterizza tali patologie [Barazzoni R. et al., 2001][Barazzoni R. et al., 2003][Barazzoni R. et al., 2003][Jove M. et al., 2004][Kristal BS. et al., 1997][Murata M. et al., 2002]. Una ridotta funzione mitocondriale e lipoossidativa potrebbe infatti direttamente contribuire allaccumulo di trigliceridi nonch a una eccessiva deposizione di tessuto adiposo contribuendo direttamente alla genesi dellobesit [Barazzoni R. et al., 2001][Barazzoni R. et al., 2003]Barazzoni R. et al., 2003][Jove M. et al., 2004][Kristal BS. et al., 1997][Murata M. et al.,

14

Materiali e metodi

2002][Diez JJ. et al., 2005]. Da ricordare a livello molecolare che la ridotta funzione mitocondriale si associa a ridotta espressione di regolatori del metabolismo lipidico-mitocondriale quali PGC-1alpha [Patti ME. et al., 2003][Petersen KF. et al., 2004][Pickup JC. et al., 1997][Puigserver P. et al., 2003].

1.4

Gli acidi grassi

1.4.1 Gli acidi grassi e linsulino-resistenza


Un eccesso di acidi grassi circolanti stato associato in modo consistente a una riduzione dellazione insulinica e a insorgenza di insulinoresistenza [Attie AD. et al., 2003]. Tali effetti negativi si riscontrano sia acutamente che in condizioni di cronico eccesso [Attie AD et al., 2003][Barazzoni R. et al., 2001][Barazzoni R. et al., 2003][Barazzoni R. et al., 2004]. Un aumento cronico del grasso corporeo quale riscontrabile nellobesit e pressoch costantemente nel diabete tipo 2 si associa a un eccesso di acidi grassi circolanti legato soprattutto a un aumentato rilascio da parte dellaumentata massa adiposa, che appare essere maggiormente spiccato a livello di tessuto adiposo addominale-viscerale [Attie AD. et al., 2003]. Gli acidi grassi rappresentano pertanto un potenziale mediatore dei difetti metabolici in modelli di obesit. Linfusione endovenosa di acidi grassi

15

Materiali e metodi

(generalmente effettuata utilizzando preparazioni di trigliceridi ed eparina) riduce inoltre la captazione di glucosio tissutale e in particolare quella muscolare sia in condizioni basali che durante infusione concomitante di insulina anche in soggetti sani o in modelli animali fisiologici. La capacit di interferire con la azione insulinica muscolare anche in soggetti normalmente insulino-sensibili suggerisce che gli acidi grassi giochino un ruolo precoce nella patogenesi della riduzione della azione insulinica associata a sovrappeso e obesit. La conoscenza dei meccanismi attraverso i quali gli acidi grassi inducono insulino-resistenza potrebbe pertanto risultare determinante nella comprensione della sua origine e storia naturale. Nonostante i meccanismi attraverso i quali un eccesso lipidico determina insulino-resistenza siano oggetto di intensissimo studio in quanto chiave fondamentale nella comprensione di tale alterazione metabolica, essi non sono tuttavia noti. In particolare i meccanismi potenziali degli effetti degli acidi grassi sullazione insulinica rimangono in larga parte da definire. Linfusione di acidi grassi pu acutamente alterare la cascata del segnale insulinico riducendo selettivamente i livelli di attivazione di alcune proteine chiave tra cui PI3kinasi [Kruszynska YT. et al., 2002]. I dati disponibili indicano inoltre quali potenziali meccanismi in tal senso la competizione tra substrati lipidici e glucidici per lutilizzazione ossidativa (ipotizzata fin dal secolo scorso nel

16

Materiali e metodi

concetto del ciclo di Randle) [Shetty GK. et al., 2004][Shulman GI. et al., 2000][Stump CS. et al., 2003]. Inoltre gli acidi grassi potrebbero contribuire a ridurre lazione insulinica muscolare in modo indiretto attraverso un aumento dello stress ossidativo sistemico [Ueno N. et al., 2004]. Lo stress ossidativo stato infatti dimostrato ridurre a livello del tessuto adiposo lespressione di ormoni che favoriscono lazione insulinica quali ladiponectina [Ueno N. et al., 2004] con concomitante aumento dellespressione di ormoni proinfiammatori e riducenti linsulino-sensibilit quali TNF-alpha e interleukina-6 [Wang J. et al., 1998]. Lo stress ossidativo tissutale potrebbe inoltre inibire direttamente lespressione genica mitocondriale [Way JM. et al., 2001].

1.4.2 Gli acidi grassi e il metabolismo lipidico


Gli effetti di modificazioni della disponibilit di acidi grassi liberi su vari meccanismi regolatori del metabolismo lipidico non sono completamente noti. Tra i principali meccanismi emersi negli ultimi anni risulta peraltro dimostrabile un effetto stimolante degli acidi grassi sullattivazione di PPARgamma, a sua volta associato ad aumento di espressione di alcuni geni lipoossidativi [Barazzoni R. et al., 2003]. In modo speculare al riscontro di effetti stimolanti in alcune condizioni sperimentali dellinsulina (ormone lipogenico e antilipoossidativo) sulla funzione mitocondriale, lassociazione di

17

Materiali e metodi

un eccesso di acidi grassi con insulino-resistenza e ridotta funzione mitocondriale-lipoossidativa muscolare potrebbe apparire in contrasto con queste osservazioni. Non comunque nota linterazione tra acidi grassi e PPARgamma in presenza di eccesso di insulina. Inoltre rimangono da chiarire gli effetti potenziali degli acidi grassi su altri meccanismi regolatori del metabolismo lipidico tra cui i livelli di attivazione di AMPK e quelli di espressione di PPARalpha e PGC-1alpha in assenza o in presenza di iperinsulinemia. Infine non sono chiariti i potenziali effetti acuti di un eccesso di acidi grassi sulla capacit ossidativa mitocondriale muscolare.

1.5 Metodi di studio dellazione insulinica: il clamp iperinsulinemicoeuglicemico


Dal punto di vista sperimentale il clamp iperinsulinemico-euglicemico rappresenta una metodica ampiamente utilizzata per la misurazione dellazione insulinica e lo studio degli effetti acuti dellinsulina sul metabolismo intermedio in vivo in modelli sia umani che animali [Winder WW. et al., 1999][Yamauchi T. et al., 2002]. Il principio della metodica si basa sulleffetto ipoglicemizzante dellinsulina legato essenzialmente alla stimolazione della utilizzazione di glucosio da parte dei tessuti periferici. Il muscolo scheletrico rappresenta il maggiore mediatore di questo effetto per la sua dipendenza

18

Materiali e metodi

dallinsulina per la regolazione dellutilizzazione di substrati e per la sua massa totale nellorganismo. Per laumento della captazione tissutale del glucosio la glicemia tenderebbe a calare ma tale effetto deleterio controllabile nel clamp iperinsulinemico-euglicemico attraverso linfusione di destrosio basata sul monitoraggio frequente dei livelli glicemici [Winder WW. et al.,

1999][Yamauchi T. et al., 2002]. La quantit di glucosio infusa rappresenta un indice riproducibile e considerato gold-standard della sensibilit insulinica corporea totale. Oltre a consentire la misurazione della sensibilit insulinica il clamp iperinsulinemico-euglicemico consente di studiare gli effetti di unelevazione acuta (in genere della durata di due-tre ore) dellinsulinemia su vari parametri metabolici sia plasmatici (monitorabili attraverso prelievi ematici seriati) che tissutali (monitorabili attraverso biopsie o raccolta di tessuti al termine dello studio in modelli animali). Il clamp rappresenta in particolare un eccellente modello di condizione prandiale in cui si verifica un aumento dei livelli di insulinemia con mantenimento dei livelli glicemici. Occorre peraltro ricordare che linfusione di insulina induce anche una riduzione dose-dipendente dei livelli circolanti di acidi grassi liberi (da inibizione della lipolisi) e degli aminoacidi (da inibizione della proteolisi muscolare). Gli effetti di questi substrati possono quindi essere ulteriormente studiati associandone linfusione a quella dellinsulina. In particolare linfusione di acidi grassi pu essere
19

Materiali e metodi

effettuata utilizzando preparazioni commerciali di trigliceridi con eparina (attivatore della lipoproteina lipasi e favorente quindi la liberazione degli acidi grassi stessi). Linfusione o lassenza di acidi grassi permettono, attraverso il confronto tra le due condizioni sperimentali, di valutarne il ruolo nella regolazione acuta dellazione insulinica.

20

Materiali e metodi

2. SCOPI dello STUDIO

Linsulina il principale ormone anabolico post-prandiale che gioca un ruolo centrale nella regolazione del metabolismo glucidico e lipidico. Studi recenti hanno suggerito un ruolo dellinsulina nella regolazione della funzione mitocondriale muscolare che a sua volta appare essere proporzionale alla sensibilit insulinica tissutale. Un aumento della disponibilit di substrati lipidici e in particolare di acidi grassi riduce sia acutamente che cronicamente la sensibilit insulinica. Non noto se gli effetti metabolici acuti di un eccesso di acidi grassi coinvolgano alterazioni della funzione mitocondriale e delle vie regolatrici del metabolismo lipidico-mitocondriale muscolare. Scopi del presente studio sono stati di valutare i potenziali effetti acuti di modulazione da parte degli acidi grassi liberi dellazione insulinica su utilizzazione corporea di glucosio (insulino-sensibilit), metabolismo

mitocondriale-lipidico muscolare e sue vie regolatrici.

21

Materiali e metodi

3. MATERIALI e METODI

3.1

Protocollo sperimentale

3.1.1 Animali
Sono stati studiati diciannove ratti maschi di ceppo Wistar acquistati dalla ditta Harlan-Italy di San Pietro al Natisone (UD). Dopo lacquisto, gli animali sono stati stabulati in gabbie aerate ospitanti da sei a dieci ratti presso lo stabulario dellUniversit degli Studi di Trieste in ambiente controllato alla temperatura costante di 22C e cicli luce-buio di 12 ore. I ratti sono stati alimentati con una dieta standard (Harlan 2018).

3.1.2 Infusione
In tutti gli animali si procedeva al mattino in condizioni di digiuno da due ore alla incannulazione dellarteria e della vena caudale come precedentemente descritto in condizioni di anestesia locale (lidocaina) [ZenKui G. et al., 2003]. Dopo incannulazione gli animali erano mantenuti in una gabbia di plexiglass con apertura circolare dalla quale veniva fatta fuoriuscire la coda che era mantenuta fissata a un supporto associato alla gabbia. Dopo un periodo di ambientamento pari a circa trenta minuti veniva effettuato un prelievo dalla cannula posizionata nellarteria caudale per la misurazione della glicemia
22

Materiali e metodi

basale e lo stoccaggio di plasma per la successiva misurazione dei livelli basali di ormoni e metaboliti. I ratti cos incannulati venivano casualmente assegnati a uno tra i tre seguenti protocolli: a) Clamp (n=6): in questo gruppo veniva infusa nella vena caudale mediante pompa Harvard di precisione (Harvard Apparatus Pump 22) una dose di insulina (Humulin R, Lilly, insulina umana 100 UI/mL) pari a 10 mU/ Kg di peso corporeo min. [Thien T. Tran et al., 2003][Rossetti L. et al., 1990] attesa indurre uniperinsulinemia paragonabile a quella postprandiale [Thien T. Tran et al., 2003][Rossetti L. et al., 1990][Santur M. et. Al., 2002][Rao H. et al., 1993]. Linsulina veniva in precedenza diluita in 5 mL di soluzione salina con circa 70 microlitri di sangue

dellanimale [Barazzoni R. et al., Diabetes 2003]. Durante linfusione di insulina venivano prelevati ogni dieci-quindici minuti campioni ematici per la misurazione della glicemia e sulla base di tali rilevazioni era modulata una infusione di glucosio al 33% mirata a mantenere livelli glicemici stabili intorno ai valori basali. Dopo 150 minuti veniva effettuato un prelievo di 1 mL per nuove misurazioni di ormoni e metaboliti al termine dellinfusione insulinica. Subito dopo veniva somministrata attraverso la vena caudale una overdose di pentobarbitale sodico (40 mg/mL) e dopo il raggiungimento dellanestesia si procedeva rapidamente al prelievo del muscolo

23

Materiali e metodi

gastrocnemio che veniva congelato in azoto liquido e conservato quindi a 80C sino al momento delle analisi. b) NEFA (n=7): animali preparati in modo indentico ricevevano identica infusione di insulina e prelievi per modulazione dellinfusione di glucosio. Gli animali ricevevano inoltre dallinizio dello studio linfusione di trigliceridi (Ivelip 20% Clintek Baxter, emulsione lipidica iniettabile a 600 L/hr) ed eparina (Epsoclar, Biologici Italia Labor. Eparina sodica 2500 UI/5 mL) parallelamente a quelle di insulina e glucosio. Prelievi ematici, anestesia e prelievo del muscolo erano eseguiti con procedure identiche a quelle seguite per il gruppo sopra descritto. c) Controllo (n=6): gli animali assegnati a questo gruppo venivano preparati in modo identico agli altri e ricevevano per una infusione di soluzione salina in luogo di quella di insulina, in assenza di infusione di trigliceridi. Venivano comunque effettuati i prelievi per la misurazione della glicemia in modo identico agli altri gruppi e si procedeva allinfusione di un ulteriore volume di soluzione salina basato su quello di glucosata ricevuto da ogni animale sottoposto a clamp iperinsulinemico. Prelievi ematici, anestesia e prelievo del muscolo erano eseguiti con procedure identiche a quelle seguite per gli altri gruppi.

24

Materiali e metodi

3.2

Attivit enzimatica di citocromo ossidasi e citrato sintetasi


40 mg circa di muscolo gastrocnemio venivano ripuliti da eventuali

impurit

(connettivo,

tendini

tracce

ematiche)

sottoposti

ad

omogeneizzazione per ottenere una misura diretta dellattivit degli enzimi mitocondriali Citocromo c Ossidasi (COX) e Citrato Sintetasi. I frammenti venivano omogenati a freddo (+4C) in una soluzione di Set Buffer (EDTA 2 mM, TRIS BASE 10 mM, pH 7.4). Al preparato ottenuto (aliquote minime di 25 l) sono stati di seguito aggiunti 350 l di KPI Buffer (KH2PO4 in H2O portato a pH 7.4 con KOH 10 M) realizzando in tal modo le aliquote finali impiegate per le analisi. Per la misurazione dellattivit enzimatica di Citocromo c Ossidasi (COX) aliquote di ciascun campione (200 l) venivano incubate a 4C per 20 minuti con una soluzione di Digitonina (10 mg di Digitonina - 25 mg di BSA in 5 mL di KPI 50 mM, pH 7.4) allo scopo di rompere le membrane mitocondriali. La reazione stata successivamente attivata dallaggiunta dei suoi substrati [800 l di soluzione reagente cos costituita: 500 mg di BSA, 10 ml di KPI 50 mM, MgCl2, citocromo c ridotto (25 mg) ed acido ascorbico (17.6 mg in 10 ml di KPI 50 mM) a pH 7.4] e lanalisi della cinetica della reazione veniva quindi eseguita allo spettrofotometro (SPECTRA max Plus 384, Molecular Devices). La quantit di citocromo c che risultava essere ossidata stata misurata alla

25

Materiali e metodi

lunghezza donda () di 240-260 nm per un intervallo di tempo di 3 minuti. La rilevazione in cinetica del segnale risultante veniva automaticamente eseguita ogni 10 secondi. Per la misurazione dellattivit enzimatica della Citrato Sintetasi le aliquote di omogenato (100 l) sono state incubate in soluzione Tris Buffer (TRIS BASE, Sigma T6791, PM 121.2 in H2O con aggiunta di TRITON 0.1%) ed ai reagenti (Dithionitrobenzoate DTNB, AcetylCoA, Li-sale 95% ed Ossalacetato). La quantit di citrato prodotta anche in questo caso stata misurata spettrofotometricamente con una del raggio incidente di 412 nm. Le letture sono state eseguite come nel caso precedente con rilevazioni in cinetica ogni 10 secondi per una durata complessiva di 3 minuti per ogni campione [Barazzoni R. et al., 2000].

3.3

Western Blotting

Utilizzando la metodica del Western Blotting stato possibile misurare i livelli di proteina relativi allenzima kinasi AMP-dipendente (AMPK). Frammenti di muscolo del peso di 60-70 mg sono stati omogeneizzati a freddo (+4C) in Buffer di lisi (Ripa Buffer) con aggiunta di inibitori di proteasi [10 g/mL Leupeptina, 10 g/mL Aprotinina, 1mM Sodio Ortovanodato e 1 mM Fenilmetilsulfonilsolfato (PMSF)]. La composizione del Buffer di lisi stata la

26

Materiali e metodi

seguente: 50 mmol/L Tris HCl, 0.1 mmol/L EDTA, 0.1 mmol/L EGTA, 0.1% Sodio Dodecilsolfato (SDS), 0.1% deossicolato, 1% Igepal. Lomogenato stato poi centrifugato a 13000 rpm per 20 minuti a +4C con lo scopo di rimuovere la frazione insolubile del pellet. Separato il surnatante dal pellet (eliminato) il contenuto proteico presente nellestratto stato quantificato come segue: 60 g di proteine totali sono stati separati su gel di Acrilamide al 12% e successivamente trasferiti su membrana in nitrocellulosa. La metodica si svolta complessivamente in quattro giorni. Il primo giorno stato preparato il gel e volumi predeterminati di campione corrispondenti ad un quantitativo caricato di 60 g sono stati eguagliati tra loro, per raggiungere i 18 L con laggiunta di PBS (Phospate Buffer Saline). Quindi stato aggiunto il Loading Buffer (Buffer di caricamento) contenente -mercaptoetanolo e dopo unincubazione di 5 minuti alla temperatura di 95C i campioni venivano caricati nel gel ed il campo elettrico attivato. Le proteine sono state separate in base al peso molecolare ad amperaggio pari a 7 mA. Nel secondo giorno il gel stato prelevato e preparato per il trasferimento su membrana. Prima del transfer il gel stato incubato per 20 minuti in Transfer Buffer, una soluzione di TBS 1X e Tween 0.1% con aggiunta di metanolo. Anche la membrana di nitrocellulosa stata incubata per

27

Materiali e metodi

15 minuti in Transfer Buffer. Ai fini del trasferimento stato utilizzato il Transfer Apparatus (Hoefer TE 70, Semi-dry Transfer Unit. Amersham Bioscences) e successivamente la membrana stata colorata col Rosso Ponceau per poter visualizzare le bande proteiche e verificare che quantit omogenee di proteina fossero contenute in ogni campione, quindi lavata ed incubata overnight in Blocking Buffer (Washing buffer e latte in polvere al 5%) su agitatore basculante. Nel terzo giorno stata preparata libridizzazione con anticorpo primario murino rivolto contro la Treonina in posizione 172 dellAMPK (anticorpi acquistati da Upstate Biotechnology, Lake Placid, NY). A tale scopo la membrana stata posta in una busta da ibridizzazione insieme al Blocking buffer unitamente allanticorpo primario con una diluizione di 1:750 ed infine incubata overnight a +4C, su agitatore basculante. Nel quarto giorno la membrana stata lavata (due lavaggi da 15 minuti ciascuno a RT su agitatore basculante) con Washing Buffer (TBS 1X e Tween 0.1%) per rimuovere leccesso di anticorpo primario non ibridizzato sulla membrana. Quindi stato preparato lanticorpo secondario: un anticorpo di coniglio coniugato con perossidasi e diretto contro lIgG murina (Jackson Immunoresearch, West Grove, PA) con una diluizione di 1:2000. La membrana stata nuovamente posta in una busta di ibridizzazione insieme allanticorpo secondario ed al Blocking Buffer, sigillata e lasciata ad incubare per unora a
28

Materiali e metodi

temperatura ambiente e su agitatore basculante. Dopo la seconda serie di lavaggi analoga alla precedente, la membrana ha subito il trattamento necessario allo sviluppo della chemioluminescenza, in camera oscura, dopo esposizione per 5-10 minuti ad una lastra fotografica (Kodak Biomax MR, Kodak, Rochester, NY). Limmagine ottenuta stata infine quantificata mediante densitometria. I risultati singolarmente ottenuti sono stati divisi per il valore medio del gruppo di controllo e quindi moltiplicati per 100 per esprimere i dati in percentuale del gruppo di controllo.

3.4

Real Time PCR


La real time-Polymerase Chain Reaction permette di ottenere una

quantificazione altamente sensibile e precisa dei livelli di mRNA del gene di interesse. Con la real time PCR (ABI Sequence Detection System 7900, Applied Biosystems) sono stati misurati i livelli di trascritti di alcuni regolatori essenziali della sintesi e dellossidazione degli acidi grassi e dei trigliceridi. In particolare sono stati misurati i livelli di trascritto dellenzima Carnitina Palmitoil Transferasi I (CPT-I) quale enzima limitante lossidazione degli acidi

29

Materiali e metodi

grassi ed inoltre misurati i livelli di mRNA di PPARgamma, PPARalpha e PGC-1alpha. LRNA totale stato estratto da frammenti di circa 40 mg del muscolo totale crioconservato (Tri Reagent, Molecular Research Center, Cincinnati, OH, USA). 1 g di RNA totale stato poi retrotrascritto a cDNA (RNA Reverse Transcription KIT, Applied Biosystems) ed amplificato con la metodica della PCR, utilizzando primers e sonde specifiche selezionate con il software Primer Express (Applied Biosystem) dalle sequenze geniche ottenute tramite il software GenBank, in maniera tale da ibridizzarsi a specifiche sequenze desossiribonucleotidiche presenti in ogni singolo gene di interesse.
Le sonde per i geni bersaglio erano associate allestremo 5 con 6-carbossifluoresceina (FAM), un marker fluorescente, e allestremo 3 con 6-carbossitetrametil-rodamina (TAMRA), un marker denominato quencher, poich in grado di assorbire la fluorescenza del primo. La vicinanza spaziale tra i due marcatori impedisce pertanto la liberazione di segnale fluorescente sino a quando la sonda non interagisce con lo specifico cDNA. Quando la sonda si legata alla sequenza specifica, lattivit 5 esonucleasica della DNA-polimerasi permette la liberazione del segnale a fluorescenza, misurata dalla real time PCR, che risulta essere proporzionale alla quantit del cDNA iniziale. I primers e le sonde utilizzate sono state le seguenti:

PPAR- (GenBank NM 013196): FP: TGGAGTCCACGCATGTGAAG RP: CGCCAGCTTTAGCCGAATAG Probe: TGCAAGGGCTTCTTTCGGC PPAR- (GenBank NM 03124): FP:ACCAGGGAGTTCCTCAAAAGC

RP:GCAAACTCAAACTTAGGCTCCATAA Probe: TGCGGAAGCCCTTTGGTGA


30

Materiali e metodi

PGC-1 (GenBank NM 031347): FP: GGCCGGAGCAATCTGAGTTA RP: GGCCGTTTAGTCTTCCTTTCCT Probe:CGCACAACTCAGCAAGTCCTCA GTGC

LrRNA ribosomiale 28S era utilizzato come gene di riferimento per la normalizzazione di tutti i risultati per i geni bersaglio, e veniva amplificato separatamente utilizzando i seguenti primes e sonde (GenBank V01270):

28S rRNA (GenBank V01270):FP: TGGGAATGCAGCCCAAAG RP: CCTTACGGTACTTGTTGGCTATCG Probe:TGGTAAACTCCATCTAAGGCTAA ATACCGGC

I campioni di cDNA sono stati amplificati utilizzando la TAQ DNA polimerasi per quaranta cicli di amplificazione in condizioni standard. Ad ogni ciclo stata misurata la quantit di fluorescenza liberata, che come ricordato risulta proporzionale alla quantit iniziale di trascritto. La quantificazione finale di ogni campione stata ottenuta mediante curva standard, amplificata nello stesso esperimento. La quantit di RNA ribosomiale 28S stata misurata in modo analogo separatamente, ed stata utilizzata per normalizzare i risultati per i singoli geni bersaglio evitando in questo modo imprecisioni dovute a potenziali differenze realizzatesi tra i campioni durante il processo di

31

Materiali e metodi

isolamento dellRNA, o per diversit nellefficienza delle reazioni di retrotrascrizione. I risultati per ogni gene bersaglio sono stati divisi per il valore del corrispondente rRNA 28S, ed espressi come percentuale della media del gruppo di controllo.

3.5

TBARS
La misurazione dei TBARS (Thiobarbituric Acid Reactive

Substances) (OXItek TBARS Assay Kit) costituisce un saggio delezione per lo screening ed il monitoraggio della perossidazione lipidica, tra i maggiori indicatori dello stress ossidativo. La metodica in grado di fornire importanti informazioni sullattivit dei radicali liberi in situazioni patologiche. I campioni biologici contengono una serie di sostanze che possono reagire con lacido tiobarbiturico, tra le quali gli idroperossidi lipidici e le aldeidi che aumentano come risultato di uno stress ossidativo. La Malonildialdeide (MDA) forma un addotto in rapporto 1:2 con lacido tiobarbiturico. I TBARS, nel tempo, tendono a tornare a livelli normali in una maniera che dipende dalla presenza di sostanze antiossidanti. In pratica, essi sono espressi e quantificati in termini di equivalenti di malondialdeide (MDA). Nel presente saggio, standards di MDA a concentrazione nota sono

32

Materiali e metodi

utilizzati per la costruzione di una curva di riferimento contro la quale sono stati poi rapportati i campioni oggetto del monitoraggio. Nella preparazione del Buffer Reagente per il TBA (Acido Tiobarbiturico) 0.53 gr di acido tiobarbiturico sono stati disciolti in 50 mL di soluzione Diluente 1 (contenente acido acetico) e quindi addizionati con altrettanti mL della soluzione Diluente 2 (contenente idrossido di sodio). Il TBA stato solubilizzato sino a completo scioglimento nel mix di soluzioni 1 e 2 posto su agitatore magnetico. Per la preparazione dei campioni 100 L di plasma sono stati preparati in provette di vetro con una pari quantit (100 L) di soluzione SDS (sodiododecilsolfato). Successivamente sono stati aggiunti 2.5 mL per ogni campione del buffer Reagente con il TBA ed il tutto stato lasciato ad incubare per 60 min. a +95 C. Le provette di vetro in questa fase sono state coperte da biglie di vetro, anchesse incluse nel kit. E seguita quindi una seconda incubazione effettuata lasciando le provette in ghiaccio per 10 min. al fine di produrne il raffreddamento. Dopo una centrifugazione di 15 min. a 3000 rpm stata eseguita la lettura del sovranatante. La quantificazione stata effettuata spettrofotometricamente ad una lunghezza donda () di 532 nm misurando lassorbanza prodotta dal campione.

33

Materiali e metodi

3.6

Dosaggio plasmatico dei NEFA


Per la determinazione quantitativa in vitro degli acidi grassi liberi nel

plasma stato utilizzato un test enzimatico colorimetrico (NEFA C, Metodo ACS-ACOD-MEHA, Wako Chemicals GmbH, DE).

3.7

Analisi statistica dei dati


Lanalisi statistica dei dati nei tre gruppi di studio stata effettuata

mediante analisi della varianza tra i tre gruppi (ANOVA) utilizzando poi il testi t di Student per dati non appaiati per confrontare dati tra i singoli gruppi separati in caso di differenze significative (P<0.05) risultate al test ANOVA. Sono stati considerati statisticamente significativi valori di probabilit (P) inferiori a 0.05. I dati sono stati presentati come media SE.

34

4. RISULTATI

4.1

Dati corporei, insulino-sensibilit, parametri emato-chimici


Il peso corporeo era sovrapponibile nei tre gruppi sperimentali (Tabella

1), cos come paragonabili erano i pesi dei pannicoli adiposi epididimale e retroperitoneale. Sovrapponibili erano anche le corrispondenti percentuali del peso corporeo attribuibili ai pannicoli adiposi misurati. Infine, per disegno sperimentale, identiche erano le glicemie iniziali e finali durante il clamp iperinsulinemico-euglicemico con o senza infusione di acidi grassi. La quantit di glucosio infusa negli ultimi trenta minuti del clamp calcolata secondo formule standard (infusione di glucosio in mg/g peso corporeo al minuto) rappresenta un indice accurato di insulino-sensibilit della cui misurazione considerato il gold-standard [DeFronzo RA. et al, 1981][Barazzoni R. et al., 2003]. Tale valore era significativamente ridotto nel gruppo di animali trattati con infusione di insulina e acidi grassi rispetto al gruppo trattato con sola insulina, indicando uninsulino-resistenza acuta (Figura 1). I livelli plasmatici di acidi grassi liberi erano paragonabili basalmente nei tre gruppi. Nel gruppo trattato con insulina i livelli di acidi grassi si

35

riducevano (in accordo con il noto effetto inibitorio sulla lipolisi da parte dellinsulina). Nel gruppo trattato con insulina e acidi grassi le concentrazioni di questi ultimi aumentavano come prevedibile (Figura 2).

4.2 Capacit ossidativa ed espressione di regolatori del metabolismo lipidico-mitocondriale


Nel muscolo gastrocnemio le attivit degli enzimi mitocondriali citocromo c ossidasi (COX) e citrato sintetasi (CS) non erano modificate nel gruppo trattato con sola insulina nelle presenti condizioni sperimentali. Tuttavia linfusione di insulina e acidi grassi riduceva lattivit enzimatica di COX (P<0.05) confrontata sia al gruppo di controllo che al gruppo trattato con sola insulina. Un simile trend che non raggiungeva la significativit statistica si osservava per CS (Figura 3). Linfusione di acidi grassi in parallelo a quella di insulina aumentava i livelli di mRNA di PPARgamma confrontati a quelli tra loro paragonabili osservati negli altri due gruppi (Figura 4). Non vi erano al contrario modificazioni nei livelli di mRNA per PPAR-alpha e PGC-1alpha in nessun gruppo sperimentale (Figura 4).

36

Infine il livello di attivazione di AMPK (determinato attraverso la misura della sua fosforilazione) non si modificava in risposta a infusione di insulina indipendentemente dalla presenza di acidi grassi (Figura 4).

4.3

Stress ossidativo I livelli di stress ossidativo venivano determinati utilizzando la

misurazione dei TBARS come descritto (Metodi). Linfusione di acidi grassi aumentava significativamente lo stress ossidativo rispetto ai valori basali nel gruppo trattato con acidi grassi ma non in quelli infusi con insulina o con soluzione salina (Figura 5a). Le differenze tra valori basali e valori al termine del clamp erano significativamente diverse nel gruppo trattato con insulina e acidi grassi rispetto agli altri gruppi sperimentali (Figura 5b). I livelli di TBARS alla fine del clamp correlavano negativamente con la sensibilit insulinica nei due gruppi infusi con insulina con o senza acidi grassi (Figura 6). Una correlazione negativa (r2=0.21; P<0.05) si riscontrava anche tra livelli di TBARS alla fine del clamp e attivit enzimatica muscolare di COX in tutti gli animali.

37

5. DISCUSSIONE

Lo studio stato finalizzato a determinare gli effetti di uniperinsulinemia acuta e fisiologica sulla utilizzazione insulino-indotta del glucosio (indice di insulino-sensibilit), sullo stress ossidativo misurato a livello plasmatico e sulla capacit ossidativa mitocondriale e su alcuni tra i principali regolatori del metabolismo lipidico-mitocondriale nel muscolo scheletrico di ratto. Tali effetti venivano determinati in presenza di una fisiologica riduzione (causata dalla inevitabile soppressione della lipolisi insulino-indotta) o un incremento (provocato da infusione esogena di trigliceridi e eparina) dei livelli degli acidi grassi liberi circolanti. I risultati indicano che: 1) uninfusione di insulina mirata a determinare

iperinsulinemia fisiologica in presenza di normoglicemia non modifica significativamente lo stress ossidativo, la capacit ossidativa mitocondriale nonch lespressione a livello trascrizionale di PPARgamma, PPARalpha, PGC-1alpha e la fosforilazione di AMPK; 2) in presenza di identiche condizioni sperimentali, il parallelo incremento dei livelli circolanti di acidi grassi liberi riduceva la sensibilit insulinica, aumentava lo stress ossidativo e induceva una soppressione della capacit ossidativa mitocondriale

38

nonostante un incremento dellespressione di PPARgamma e in assenza di modificazioni dei livelli di PPARalpha, PGC-1alpha e AMPK attivata.

5.1

Gli effetti dellinsulina


Lo studio ha chiaramente indicato che un aumento acuto dei livelli

insulinemici, indotto con velocit di infusione dellormone attesa indurre incrementi paragonabili a quelli osservati nel periodo post-prandiale e per un periodo di tempo analogo, non modifica in modo sostanziale alcuni indicatori fondamentali del metabolismo lipidico-energetico muscolare. Il dato in accordo con risultati in vivo che non confermano effetti stimolanti dellinsulina di per s sul metabolismo proteico mitocondriale muscolare in vivo nelluomo [Barazzoni et al., 2003]. Al contrario alcuni recenti studi avevano indicato un ruolo stimolatore centrale dellinsulina nella regolazione del metabolismo energetico muscolare in presenza di concomitante infusione aminoacidica mirata a prevenire la riduzione dei livelli di aminoacidi circolanti in presenza di iperinsulinemia [Stump CS. et al., 2003][Boirie Y. et al., 2001]. Globalmente questi dati rafforzano il concetto dellimportanza dellinterazione tra ormoni e substrati-nutrienti nelle risposte adattative metaboliche in vivo. In particolare la presenza di aminoacidi sarebbe cruciale per il suo ruolo permissivo nel mantenere la velocit di sintesi proteica anche

39

a livello mitocondriale [Stump CS. et al., 2003][Boirie Y. et al., 2001] che a sua volta potrebbe permettere un aumento delle molecole mitocondriali e della capacit ossidativa. Nel presente studio si pu presumere una riduzione dei livelli aminoacidici come invariabilmente osservato in analoghe condizioni sperimentali in vivo [Stump CS. et al., 2003][DeFronzo RA. et al., 1981][Barazzoni R. et al., 2003]. Occorre peraltro considerare che il presente studio dimostra per la prima volta una riduzione a livello muscolare dellattivit di enzimi della catena respiratoria legata a incremento acuto degli acidi grassi circolanti. Tale risultato suggerisce che gli effetti delliperinsulinemia sulla funzione mitocondriale muscolare in assenza di concomitante infusione lipidica possano essere almeno in parte indiretti e risultanti dalleffetto soppressivo dellormone sulla lipolisi e la conseguente riduzione degli acidi grassi circolanti [Stump CS. et al., 2003][Boirie Y. et al., 2001]. Sulla base di queste considerazioni gli acidi grassi sono introdotti come importante componente della regolazione del metabolismo energetico muscolare che appare in grado di modulare gli eventuali effetti insulinici soprattutto nel periodo post-prandiale. Poich il livello di acidi grassi liberi generalmente non cala in presenza di iperinsulinemia post-prandiale per il concomitante introito di alimenti che compensa la soppressione della lipolisi, i risultati dello studio suggeriscono indirettamente che un aumento della funzione
40

ossidativa mitocondriale muscolare non abbia un ruolo determinante nelladattamento metabolico acuto allassunzione di alimenti. Nelle presenti condizioni sperimentali linfusione isolata di insulina non modificava lespressione di PPARgamma e di altri regolatori del metabolismo lipidico tra cui AMPK attivata. Soprattutto per quanto riguarda i livelli di PPARalpha, PGC-1alpha e AMPK attivata tali osservazioni suggeriscono un sostanziale equilibrio dello stato metabolico tissutale, in quanto tali regolatori sono stimolati soprattutto da una riduzione della disponibilit di substrati e di energia quale si osserva ad esempio in condizioni di digiuno [Hevener AL. et al., 2003][Jove M. et al., 2004][Lapsys NM. et al., 2000][Norris AW. et al., 2003][Olefsky JM. et al., 2000][Way JM. et al., 2001][Rhee J. et al., 2003][Leone TC. et al., 1999][Patti ME. et al., 2003][Mootha VK. et al., 2003][Puigserver P. et al., 2003][Attie AD. et al., 2003][Winder WW. et al., 1999][Yamauchi T. et al., 2002][Lochead PA. et al., 2000]. In particolare tale ipotesi in accordo con una stimolazione della disponibilit di glucosio prevelentemente a livello muscolare come atteso nelle presenti condizioni sperimentali. Un effetto diretto dellinsulina sullespressione di PPARgamma, PPARalpha, PGC1alpha e sulla fosforilazione di AMPK muscolare non supportato dai risultati dello studio.

41

5.2

Gli effetti degli acidi grassi


I risultati sostengono fortemente il nuovo concetto che un aumento

acuto di concentrazioni di acidi grassi circolanti in presenza di iperinsulinemia-normoglicemia ha un effetto inibitorio sulla funzione mitocondriale muscolare. Il dato suggerisce che una riduzione della capacit ossidativa muscolare possa contribuire alleffetto di inibizione della utilizzazione di glucosio insulino-indotta attribuito agli acidi grassi e chiaramente confermato dal presente studio. La funzione mitocondriale muscolare infatti emersa in anni recenti come un importante regolatore dallazione insulinica con particolare riguardo allutilizzazione del glucosio [Anderwald C. et al., 2002][Barazzoni R. et al., 2004][Barazzoni R. et al., 2005][Harano Y. et al., 1972]. Una riduzione della capacit ossidativa muscolare si riscontra infatti in presenza di obesit e diabete tipo 2 [Anderwald C. et al., 2002][Barazzoni R. et al., 2004][Barazzoni R. et al., 2005][Harano Y. et al., 1972] [Barazzoni R. et al., 2001][Barazzoni R. et al., 2003][Barazzoni R. et al., 2003][Jove M. et al., 2004][Kristal BS. et al., 1997][Murata M. et al., 2002] ed entrambe le condizioni sono caratterizzate da insulino-resistenza con pressoch inevitabile aumento dei livelli di acidi grassi circolanti [Anderwald C. et al., 2002][Barazzoni R. et al., 2004][Barazzoni R. et al., 2005][Harano Y. et al.,

42

1972] [Barazzoni R. et al., 2001][Barazzoni R. et al., 2003][Barazzoni R. et al., 2003][Jove M. et al., 2004][Kristal BS. et al., 1997][Murata M. et al., 2002]. I dati del presente studio indicano pertanto nelleccessiva disponibilit di acidi grassi un potenziale importante mediatore diretto dellinsulino-resistenza in tali condizioni, soprattutto in presenza di loro elevazioni acute in presenza di iperinsulinemia come generalmente osservabile nel periodo post-prandiale. Gli acidi grassi aumentavano acutamente i livelli di stress ossidativo stimato mediante limportante marker di perossidazione lipidica

rappresentato dai livelli di TBARS, indicativi della produzione di malonildialdeide. Lo stress ossidativo implicato in alterazioni a mediolungo termine delle strutture tissutali che possono comprendere i mitocondri con modificazioni del DNA e delle strutture lipidiche e proteiche [Harman D. et al., 1981][Linnane AW. et al., 1989][Trounce I. et al., 1989][Fallace DC. et al., 1992][Mooradian AD. et al., 1994][Aksenova MW. et al., 1998]. Per tali motivi e per lelevata concentrazione di ossidanti nel mitocondrio stesso lo stress ossidativo stato implicato nella patogenesi delle disfunzioni mitocondriali croniche associate allinvecchiamento [Harman D. et al., 1981][Linnane AW. et al., 1989][Trounce I. et al., 1989][Fallace DC. et al., 1992][Mooradian AD. et al., 1994][Aksenova MW. et al., 1998]. Tuttavia i risultati del presente studio suggeriscono effetti acuti a livello mitocondriale
43

muscolare, supportati dalle associazioni negative dei livelli di TBARS circolanti con insulino-sensitivit e attivit di citocromo c ossidasi muscolare. Tali effetti potrebbero essere mediati da effetti negativi diretti sulla trascrizione mitocondriale, come suggerito da precedenti studi nel diabete tipo 1 [Kristal BS. et al., 1997]. A livello molecolare la disfunzione mitocondriale potrebbe inoltre essere direttamente mediata dal legame della malonildialdeide con strutture mitocondriali come precedentemente

suggerito in altri tessuti [Liu J. et al., 2002]. Risulta importante sottolineare come un aumentato stress ossidativo si riscontri in condizioni associate a insulino-resistenza quali lobesit e il diabete mellito tipo 2, cos come nellinvecchiamento [Furukawa S. et al., 2004][Harman D. et al., 1981][Linnane AW. et al., 1989][Trounce I. et al., 1989][Fallace DC. et al., 1992][Mooradian AD. et al., 1994][Aksenova MW. et al., 1998]. Sulla base delle precedenti considerazioni i presenti risultati suggeriscono un ruolo significativo dello stress ossidativo mediato dagli acidi grassi nel loro effetto negativo su funzione mitocondriale muscolare e nellinsulino-resistenza. Lincremento acuto di acidi grassi circolanti durante iperinsulinemia non modificava lespressione di PPARalpha e PGC-1alpha, n lattivazione di AMPK. Pertanto tali regolatori non appaiono giocare un ruolo determinante nella riduzione della capacit ossidativa della catena respiratoria mediata dagli acidi grassi stessi. Gli acidi grassi aumentavano peraltro lespressione
44

trascrizionale di PPARgamma. Tale effetto in accordo con dati precedenti e riflette la regolazione da parte di substrati lipidici di tale mediatore [Hevener AL. et al., 2003][Jove M. et al., 2004][Lapsys NM. et al., 2000][Norris AW. et al., 2003][Olefsky JM. et al., 2000][Way JM. et al., 2001][Rhee J. et al., 2003]. Unattivazione del PPARgamma in vari tessuti attiva risposte metaboliche tessuto-specifiche [Hevener AL. et al., 2003][Jove M. et al., 2004][Lapsys NM. et al., 2000][Norris AW. et al., 2003][Olefsky JM. et al., 2000][Way JM. et al., 2001][Rhee J. et al., 2003]. Nel muscolo scheletrico PPARgamma appare associato allespressione di geni lipoossidativi [Lapsys NM. et al., 2000] e in alcuni studi ad aumentata funzione mitocondriale [Barazzoni R. et al., 2005]. Inoltre la inattivazione di PPARgamma specificamente nel tessuto muscolare si associa a insulino-resistenza in modelli animali [Norris AW. et al., 2003]. Appare pertanto improbabile che lupregolazione dellespressione di

PPARgamma abbia avuto un ruolo causale nella soppressione della attivit di citocromo ossidasi. Un incremento dei livelli di acidi grassi liberi si osserva anche in condizioni di digiuno in cui linsulinemia tipicamente ridotta [Barazzoni R. et al., 2005] e lossidazione di substrati lipidici anche a livello muscolare mantenuta o aumentata [Barazzoni R. et al., 2005]. Pertanto ipotizzabile che un effetto stimolante sulla funzione ossidativa muscolare mediata dalla stimolazione dellespressione di PPARgamma da parte degli acidi grassi si associ fisiologicamente a condizioni di digiuno. Tale interazione
45

appare essere alterata in presenza di iperinsulinemia nelle presenti condizioni sperimentali. Un aumentato livello di stress ossidativo (quale non si osserva in condizioni di digiuno) con alterazione diretta della funzione mitocondriale potrebbe contribuire a questo effetto.

46

6. CONCLUSIONI

In conclusione il presente studio ha dimostrato che un aumento dei livelli di acidi grassi circolanti ha un impatto negativo su insulino-sensibilit, stress ossidativo e attivit enzimatica mitocondriale muscolare in un modello sperimentale di ratto durante iperinsulinemia acuta. I dati suggeriscono un meccanismo potenziale alla base dellinsulino-resistenza associata a obesit e diabete tipo 2 in presenza di eccesso di acidi grassi circolanti, soprattutto nel periodo post-prandiale.

47

Legenda alle Figure


Figura 1: Utilizzazione di glucosio insulino-mediata nei due gruppi di animali trattati con insulina o con insulina e acidi grassi *: P<0.05 vs Con. Figura 2: Concentrazioni plasmatiche di acidi grassi liberi nei tre gruppi sperimentali allinizio e alla fine del clamp. *: P<0.05 vs Basale; i valori dopo clamp nei gruppi Ins e Ins+FFA sono significativamente diversi dai corrispondenti valori nel gruppo Con. Figura 3: Effetti dellinfusione di insulina senza (Ins) o con (Ins+FFA) acidi grassi sullattivit enzimatica di citocromo c ossidasi (COX) e citrato sintetasi (CS) *: P<0.05 vs Con e Ins. Figura 4: Effetti dellinfusione di insulina senza (Ins) o con (Ins+FFA) acidi grassi sui livelli di mRNA di PPARgamma (a), PPARalpha (b), PGC-1alpha (c) e sulla fosforilazione di AMPK (d). *: P<0.05 vs Con e Ins. Figura 5: a) Concentrazioni plasmatiche di TBARS nei tre gruppi sperimentali allinizio e alla fine del clamp. *: P<0.05 vs Basale e vs Con e Ins. b) Modificazioni della concentrazione di TBARS nei tre gruppi sperimentali in risposta alle infusioni. *: P<0.05 vs Con e Ins.

48

Figura 6: Correlazione tra livelli plasmatici di TBARS alla fine del clamp e utilizzazione di glucosio insulino-mediata nei ratti trattati con insulina o con insulina e acidi grassi.

49

Tabella 1: peso corporeo totale, peso dei pannicoli di tessuto adiposo (TA) epididimale e retroperitoneale, loro percentuale del peso corporeo, glicemia iniziale (t=0) e finale (t=150). _____________________________________________________________ Con Ins Ins-FFA Peso Corporeo (g) TA epididimale (g) TA retroperitoneale (g) % peso corporeo Glicemia (t=0, mmol/l) Glicemia (t=150, mmol/l) 3184 2.300.09 3.360.32 2.090.15 5.80.6 5.60.4 3143 2.580.17 3.590.28 2.270.18 5.70.3 5.80.5 3145 2.300.09 3.860.21 2.210.14 5.50.4 5.60.6

_____________________________________________________________

50

Figura 1
Ins Ins+FFA
Utilizzazio n e d i g lu c o s io in su lin o -me d iata
0,2

mg/min.g body weight

0,1

51

Basal

Figura 2

Clamp

Ac id i G r a ss i Lib e ri
4

*
3 mmol/l 2

*
0

Con

Ins

Ins-FFA

52

Con

Figura 3

Ins Ins+FFA

8 00
micromol/min . g protein

6 00

4 00 2 00 0

*
COX CS

53

Con

Figura 4

Ins Ins+FFA

1200 1000
percent of control

PPARgamma

800 600 400 200 0

300 250
percent of control

PGC-1alpha

200 150 100 50 0

54

3 00 2 50
percent of control

PPARalpha

2 00 1 50 1 00 50 0

300 250
percent of control

p-AMPK

200 150 100 50 0

55

Figura 5

a)
70 60 50 mmol/l 40 30 20 10 0

TB A R S

Con b)
50 40 30
mmol

Ins
M odificazioni TB A R S

Ins-FFA

Con Ins Ins+FFA

20 10 0 - 10

56

Figura 6

100 80 60 40 20 0 0, 00

TBARS

R = 0, 4826

0, 05

0, 10

0, 15

0, 20

0, 25

Utilizzazione di glucosio insulino-mediata (mg/g min)

57

7. BIBLIOGRAFIA

Aksenova MV., Aksenov MY., Carney JM. And Butterfield DA. Protein oxidation and enzyme activity decline in old brown Norway rats are reduced by dietary restriction. Mech. Ageing Dev., 100 (2):157-68, Jan. 1998.

Alberts B., Bray D., Lewis J., Raff M., Roberts K. and Watson JD. Biologia Molecolare della cellula. Cap. 11, pagg. 736-38, ed. Zanichelli, 1990. Anderson S., Bankier AT., Barrel BG., Brujin MHL., Coulson AR., Drouin J., Eperon IC., Nierlich DP., Roe BA., Sanger F., Schreier PH., Smith AJ., Staden R., Young IG. Sequence and organization of the human mitochondrial genome. Nature 290: 457-464, 1981.

Anderwald C., Bernroider E., Krssak M., Stingl H., Brehm A., Bischof MG., Nowotny P., Roden M., Waldhausl W. Effects of insulin treatment in type 2 diabetic patients on intracellular lipid content in liver and skeletal muscle. Diabetes 51 (10): 3025-3032, Oct. 2002.

Ashford AJ., Pain VM. Insulin stimulation of growth in diabetic rats. Synthesis and degradation of ribosomes and total tissue protein in skeletal muscle and heart. J. Biol. Chem. 261 (9) : 4066-70, 1986.

58

Attie AD., Kendziorski CM. PGC-1alpha at the crossroads of type 2 diabetes. Nat. Genet. 34 (3): 244-5, Jul. 2003. Barazzoni R. and Nair KS. Changes in uncoupling protein-2 and 3 expression in aging rat skeletal muscle, liver and heart. Am. J. Physiol. Endocrinol. Metab. 280: E413-E419, 2001.

Barazzoni R., Bigelow M., Nair KS. Time-course of insulin effects on protein turnover in human skeletal muscle. Diabetes, 52 (Suppl. 1): A344-A344, 2003.

Barazzoni R., Bosutti A., Stebel M., Cattin M., Roder E., Visintin L., Cattin L., Biolo G., Zanetti M., Guarnieri G. Ghrelin regulates mitochondrial-lipid metabolism gene expression and fat distribution in liver and skeletal muscle. Am. J. Physiol. Endocrinol. Metab. 288 (1): E228-35 Jan. 2005.

Barazzoni R., Kiwanuka E., Zanetti M., Cristini M., Vettore M., Tessari P. Insulin acutely increases fibrinogen production in individuals with type 2 diabetes but not in individuals without diabetes. Diabetes 52: 1851-56, 2003.

Barazzoni R., Short KR, and Nair KS. Effects of aging on mitochondrial DNA copy number and cytochrome c oxidase gene expression in rat skeletal muscle, liver and heart. J Biol Chem 275: 3343-47, 2000.

59

Barazzoni R., Zanetti M., Bosutti A., Biolo G., Vitali-Serdoz L., Stebel M., Guarnieri G. Moderate caloric restriction, but not physiological hyperleptinemia per se, enhances mitochondrial oxidative capacity in rat liver and skeletal muscle - Tissue-specific impact on tissue triglyceride content and AKT activation. Endocrinology 146: 2098-106, 2005.

Barazzoni R., Zanetti M., Stebel M., Biolo G., Cattin L. and Guarnieri G. Hyperleptinemia prevents increased plasma ghrelin concentration during short-term moderate caloric restriction in rats. Gastroenterology 124: 1188-1192, 2003.

Barzilai N., Rossetti L. Relationship between changes in body composition and insulin responsiveness in models of the aging rat. Am. J. Physiol., 269 (3 Pt 1) : E 591-7, 1995. Biolo G., Wolfe RR. Insulin action on protein metabolism. Baillieres Clin. Endocrinol. Metab. : N 7(4) : 989-1005, 1993. Boirie Y., Short KR., Ahlman B., Charlton M., Nair KS. Tissue-specific regulation of mitochondrial and cytoplasmic protein synthesis rates by insulin. Diabetes 50 (12): 2652-8, Dec. 2001.

Boss O., Hagen T. and B. Lowell ; Uncoupling Proteins 2 and 3 Potential Regulators of Mitochondrial Energy Metabolism. Diabetes, vol. 49; 143-154, February 2000.

Bruno C. Martinuzzi A., Tang Y., Andrei AL., Pallotto F., Bonilla E., Shanske S., Fu J., Sue CM., Angelici C., Di Mauro S. and Manfredi G.

60

A stop-codon Mutation in tha human mtDNA Cytochrome c Oxidase I Gene disrupts the functional Structure of Complex IV. Am. J. Hum. Genet., 65: 611-620, 1999. Charlton M. and Nair KS. Protein Metabolism in Insulin-Dependent Diabetes Mellitus ; The Journal of Nutrition, vol. 128 num. 2: 323S327S, 1998.

DAurelio M., Pallotti F., Barrientos A., Gajewski CD., Kwong JQ., Bruno C., Beal MF. and Manfredi G. In vivo Regulation f Oxidative Phosphorilation in Cells Harboring a Stop codon Mutation in Mitochondrial DNA-encoded Cytochrome c Oxidase Subunit I. J. Biol. Chem., vol. 276, issue 50, 46925-46932, December 2001.

Dagsgaard C., Taylor LE., OBrien KM. and Poyton RO. Effects of Anoxia and the Mitochondrion on Expresion of Aerobic Nuclear COXGenes in Yeast. Evidence for a signaling pathway from the mitochondrial genome to the nucleus. Biol. Chem., 276, issue 10 : 75937601, March 9, 2001.

Darley-Usmar V., Ragan I., Smith P., et al. The proteins of the mitochondrial inner membrane and their role in oxidative

phosphorylation. In: Mitochondria: DNA, proteins and disease. Ed. Darley-Usmar V. and Shapira AHV Portland Press, London, pp. 1-25, 1994.

Diez JJ., Iglesias P., Fernandez-Reyes MJ., Aguilera A., Bajo MA., Alvarez-Fidalgo P., Codoceo R., Selgas R. Serum concentrations of

61

leptin,

adiponectin

and

resistin,

and

their

relationship

with

cardiovascular disease in patients with end-stage renal disease. Clin. Endocrinol. 62 (2): 242-9, Feb. 2005.

Evans WJ. What is sarcopenia?. J. Gerontol. A. Biol. Sci. Med. Sci., 50 Spec. No: 5-8, 1995. Furukawa S., Fujita T., Shimabukuro M., Iwaki M., Yamada Y., Nakajima Y., Nakayama O., Makishima M., Matsuda M., Shimomura I. Increased oxidative stress in obesity and its impact on metabolic syndrome. J. Clin. Invest. 114 (12): 1752-61, Dec. 2004.

Goldberg A., Derek E., Wildman DE., Schmidt TR., Httemann M., Goodman M., Weiss ML. and Grossmann LI. Adaptive evolution of citochrome c oxidase subunit VIII in antropoid primates. PNAS, 100 (10) : 5873-5878, 2003. Hanson BJ., Carrozzo R., Piemonte F., Tessa A., Robinson BH. and Capaldi RA. Citocrome c-oxidase deficient patients have distinct subunit assembly profile. J. Biol. Chem., vol. 276, issue 19, 16296-16301. May 11, 2001. Harano Y., DePalma RG., Lavine L., Miller M. Fatty acid oxidation, oxidative phosphorylation and ultrastructure of mitochondria in the diabetic rat liver. Hepatic factors in diabetic ketosis. Diabetes 21 (5): 257-70, May 1972.

62

Harman D. The aging process. Proc. Natl. Acad. Sci. USA, 78 (11): 7124-28, Nov. 1981.

Hevener AL., He W., Barak Y., Le J., Bandyopadhyay G., Olson P., Wilkes J., Evans RM., and Olefsky J. Muscle-specific Pparg deletion causes insulin resistance. Nat. Med. 9 (12): 1491-7, Dec. 2003.

Huang X., Eriksson KF., Vaag A., Lehtovirta M., Hansson M., Laurila E., Kanninen T., Olesen B., Kurucz I., Koranyi L., Groop L. Insulinregulated mitochondrial gene expression is associated with glucose flux in human skeletal muscle. Diabetes 48 (8): 1508-14, Aug. 1999.

Jove M., Salla J., Planavila A., Cabrero A., Michalik L., Wahli W., Laguna JC., and Vazquez-Carrera M. Impaired expression of NADH dehydrogenase subunit 1 and PPARgamma coactivator-1 in skeletal muscle of ZDF rats: restoration by troglitazone. J. Lipid. Res. 45 (1): 113-23, Jan. 2004.

Kristal BS., Koopmans SJ., Jackson CT., Ikeno Y., Park BJ., Yu BP. Oxidant-mediated repression of mitochondrial transcription in diabetic rats. Free Radic. Biol. Med. 22 (5): 813-22, 1997.

Kruszynska YT., Worrall DS., Ofrecio J., Frias JP., Macaraeg G., Olefsky JM. Fatty acid-induced insulin resistance: decreased muscle PI3K activation but unchanged AKT phosphorylation. J. Clin. Endocrinol. Metab. 87 (1): 226-34; Jan. 2002.

63

Lapsys NM., Kriketos AD., Lim-Fraser M., Poynten AM., Lowy A., Furler SM., Chisholm DJ. and Cooney GJ. Expression of genes involved in lipid metabolism correlate with peroxisome proliferator-activated receptor gamma expression in human skeletal muscle. J. Clin. Endocrinol. Metab. 85 (11): 4293-7, Nov. 2000.

Leone TC., Weinheimer CJ., Kelly DP. A critical role for the peroxisome proliferator-activated receptor alpha (PPARalpha) in the cellular fasting response: the PPARalpha-null mouse as a model of fatty acid oxidation disorders. Proc. Natl. Acad. Sci. U S A 96 (13): 7473-8, Jun. 1999.

Lindstrom B., Lexell J., Gerdle B., Downham D. Skeletal muscle fatigue and endurance in young and old men and women. J. Gerontol. A. Biol. Sci. Med. Sci. 52(1): B 59-66, 1997. Linnane AW., Marzuki S., Ozawa T., and Tanaka M. Mitochondrial DNA mutations as an important contributor to ageing and degenerative diseases. Lancet, 1 (8639): 642-645, Mar. 1989.

Liu J., Killilea DW. and Ames BN. Age-associated mitochondrial oxidative decay: improvement of carnitine acetyltransferase substratebinding affinity and activity in brain by feeding old rats acetyl-Lcarnitine and/or R-alpha -lipoic acid. Proc. Natl. Acad. Sci. U S A, 99 (4): 1876-81, Feb. 2002.

Lochhead PA., Salt IP., walker KS., Hardie DG. And Sutherland C. 5aminoimidazole-4-carboxamide riboside mimics the effects of insulin on
64

the expression of the 2 key gluconeogenic genes PEPCK and glucose-6phosphatase. Diabetes 49 (6): 896-903, Jun. 2000. Mc Donag MJ., White MJ., Davies CT. Different effects of ageing on the mechanical properties of human arm and leg muscles. Gerontology, et al., 1984. Mitchell P. Chemiosmotic coupling in energy transduction: a logical development of biochemical knowledge. J. Bioenerg. 3 (1): 5-24, May 1972.

Mooradian AD, Lung CC, Shah G, et al. Age-related changes in tissue content of malondialdehyde-modified proteins. Life Sci., 55 (20): 156166, 1994.

Mootha VK, Lindgren CM, Eriksson KF, et al. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately

downregulated in human diabetes. Nat. Genet. ; 34 (3): 267-73 Jul. 2003.

Murata M., Okimura Y., Iida K., Matsumoto M., Sowa H., Kaji H., Kojima M., Kangawa K. and Chihara K.Ghrelin modulates the downstream molecules of insulin signaling in hepatoma cells. J. Biol. Chem. 277 (7): 5667-74, Feb. 2002.

Nair KS., Age-related changes in muscle. Mayo Clin. Proc., 75, Suppl. : S14-8, 2000.

65

Nair KS., Ford GC., Ekberg K., Fernquist-Forbes E., Wahren J. Protein dynamics in whole body and in splanchnic and leg tissues in type I diabetic patients. J. Clin. Invest., 95 (6) : 2926-37, 1995. Nair KS., Garrow JS., Ford C., Mahler RF., Halliday D. Effect of poor diabetci control and obesity on whole body protein metabolism in man. Diabetologia 25(5) : 400-3, 1983. Norris AW., Chen L., Fisher SJ., Szanto I., Ristow M., Jozsi AC., Hirshman MF., Rosen ED., Goodyear LJ., Gonzalez FJ., Spiegelman BM., and Kahn CR. Muscle-specific PPARgamma-deficient mice develop increased adiposity and insulin resistance but respond to thiazolidinediones. J. Clin. Invest. 112 (4): 608-18, Aug. 2003.

Olefsky JM. Treatment of insulin resistance with peroxisome proliferator-activated receptor gamma agonists. J. Clin. Invest. 106 (4): 467-72, Aug. 2000.

Patti ME., Butte AJ., Crunkhorn S., Cusi K., Berria R., Kashyap S., Miyazaki Y., Kohane I., Costello M., Saccone R., Landaker EJ., Goldfine AB., Mun E., DeFronzo R., Finlayson J., Kahn CR. and Mandarino LJ. Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1. Proc. Natl. Acad. Sci. U S A: 100 (4): 8466-71, Jul. 2003.

Petersen KF., Dufour S., Befroy D., Garcia R., Shulman GI. Impaired mitochondrial activity in the insulin-resistant offspring of patients with type 2 diabetes. N. Engl. J. Med. 350 (7): 664-71, Feb. 2004.

66

Pickup JC., Mattock MB., Chusney GD. and Burt D. NIDDM as a disease of the innate immune system: association of acute-phase reactants and interleukin-6 with metabolic syndrome X. Diabetologia 40 (11): 1286-92, Nov. 1997.

Puigserver P., Spiegelman BM. Peroxisome proliferator-activated receptor-gamma coactivator 1 alfa (PGC-1 alfa): transcriptional coactivator and metabolic regulator. Endocrine Rev. 24 (1): 78-90, Feb. 2003.

Rajala MW., Scherer PE. Minireview: The adipocyte--at the crossroads of energy homeostasis, inflammation, and atherosclerosis.

Endocrinology 144 (9): 3765-73, Sep. 2003.

Randle PJ., Garland PB., Hales CN. and Newsholme EA. The glucose fatty-acid cycle. Its role in insulin sensitivity and the metabolic disturbances of diabetes mellitus. Lancet 13,1: 7859, Apr. 1963.

Rao Harsha R. Insulin Resistance in Spontaneopusly Hypertensive Rats. Difference in Interpretation Based on Insulin Infusion Rate or on Plasma Insulin in glucose Clamp Studies. Diabetes, vol. 42, 1364-71, Sep. 1993.

Rasmussen BB. and Wolfe RR. Regulation of fatty acid oxidation in skeletal muscle. Annu. Rev. Nutr. 19: 463-84, 1999.

67

Rawn JD. Biochimica. Cap. 14, 15, 16. Mc Graw Hill ed. , 1990. Revers RR., Kolterman OG., Scarlett JA., Gray RS., Olefsky JM. Lack of in vivo insulin resistance in controlled insulin-dependent, type I, diabetic patients. J. Clin. Endocrinol. Metab. 58 (2): 353-8, Feb. 1984.

Rhee J., Inoue Y., Yoon JC., Puigserver P., Fan M., Gonzalez FJ., Spiegelman BM. Regulation of hepatic fasting response by

PPARgamma coactivator-1alpha (PGC-1): requirement for hepatocyte nuclear factor 4alpha in gluconeogenesis. Proc. Natl. Acad. Sci. USA 100 (7): 4012-17, Apr. 2003.

Rolfe DF., Hulbert AJ., Brand MD. Characteristics of mitochondrial proton leak and control of oxidative phosphorylation in the major oxygen-consuming tisues of the rat. Biochim. Biophys. Acta, 30 : 1188(3) : 405-16, 1994. Rolfe FSD., Neumann JMB., Buckingam JA., Clark MG. and Brand MD. Contribution of mitochondrial proton leak to respiration rate in working skeletal muscle and liver and to SMR. Am. J. Physiol. Cell. Physiol., vol. 276, issue 3, C692-C699, March 1999. Rooyakers O., Adey DB., Adest PA. and Nair KS. Effects of age on in vivo rates of mitochondrial protein synthesis in human skeletal muscle. Proc. Natl. Acad. Sci. USA, 93: 15364-15369, 1996. Rossetti L. and Giaccari A. Relative Contribution of Glycogen Synthesis and Glycolysis to Insulin-mediated Glucose Uptake. J. Clin. Invest. 85, 1785-1792, 1990.

68

Ruderman NB., Saha AS., Vavvas D. and Witters LA. Malonyl-CoA, fuel sensing, and insulin resistance. Am. J. Physiol 276 (1 Pt 1): E1E18, Jan. 1999. Samec S., Seydoux J., Russell AP., Montani JP. and Dulloo AG. Skeletal muscle heterogeneity in fasting-induced upregulation of genes encoding UCP2, UCP3, PPARgamma and key enzymes of lipid oxidation. Pflugers Arch. 445 (1): 80-86, Oct. 2002.

Santur M., Pitre M., Marette A., Deshaies Y., Lemieux C., Larivire R., Nadeau A. and Bachelard H. Induction of insulin resistance by highsucrose feeding does not raise mean arterial blood pressure but impaires haemodynamic responses to insulin in rats. British Journal of Pharmacology 137, 185-196, 2002.

Shetty GK., Economides PA., Horton ES., Mantzoros CS. and Veves A. Circulating adiponectin and resistin levels in relation to metabolic factors, inflammatory markers, and vascular reactivity in diabetic patients and subjects at risk for diabetes. Diabetes Care 27 (10): 245057, Oct. 2004.

Shulman GI. Cellular mechanisms of insulin resistance. J. Clin. Invest. 106 (2): 171-6, Jul. 2000.

Smith OL., Wong CY., Gelfand RA. Skeletal muscle proteolysis in rats with acute streptozotocin-induced diabetes. Diabetes Sep. ; 38(9): 111722, 1989.

69

Stump CS., Short KR., Bigelow ML., Schimke JM., Nair KS. Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts. Proc Natl Acad Sci U S A 100 (13): 7996-8001, Jun. 2003.

Thien T. Tran, Gupts N., Goh T., Naigamwalla D., Chia C.M., Koohestani N., Mehrotra S., McKeown G., Giacca A. and Bruce R.W. Direct Measure of Insulin Sensitivity with the HyperinsulinemicEuglycemic Clamp and Surrogate measures of Insulin Sensitivity with the Oral Glucose Tolerance Test: Correlation with Aberrant Crypt foci Promotion in Rats. Cancer Epidemiology, Biomarkers and Prevention, vol. 12, 47-56, Jan. 2003.

Trounce I., Byrne E. and Marzuki S. Decline in skeletal muscle mitochondrial respiratory chain function: possible factor in ageing. Lancet, 25 (8639): 637-639, Mar. 1989.

Ueno N., Dube MG., Inui A., Kalra PS., Kalra SP. Leptin modulates orexigenic effects of ghrelin and attenuates adiponectin and insulin levels and selectively the dark-phase feeding as revealed by central leptin gene therapy. Endocrinology 145 (9): 4176-84, Sep. 2004.

Wallace DC. Mitochondrial genetics: a paradigm for aging and degenerative diseases? Science, 256: 628-632, 1992.

70

Wang J., Liu R., Hawkins M., Barzilai N., Rossetti L. A nutrient sensing pathway regulates leptin gene expression in muscle and fat. Nature 393: 684 688, 1998.

Way JM., Harrington W., Brown KK., Gottschalk WK., Sundseth SS., Mansfield TA., Ramachandran RK., Willson TM. and Kliewer SA. Comprehensive messenger ribonucleic acid profiling reveals that peroxisome proliferator-activated receptor gamma activation has coordinate effects on gene expression in multiple insulin-sensitive tissues. Endocrinology 142 (3): 1269-77, Mar. 2001.

Winder WW. and Hardie DG. AMP-activated protein kinase, a metabolic master switch: possible roles in type 2 diabetes. Am. J. Physiol. Endocrinol. Metab. 277 (1 Pt 1): E1-E10, Jul. 1999.

Yamauchi T., Kamon J., Minokoshi Y., Ito Y., Waki H., Uchida S., Yamashita S., Noda M., Kita S., Ueki K., Eto K., Akanuma Y., Froguel P., Foufelle F., Ferre P., Carling D., Kimura S., Nagai R., Kahn BB. and Kadowaki T. Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat. Med. 8 (11): 1288-95, Nov. 2002.

Young ME., Goodwin GW., Ying J., Guthrie P., Wilson CR., Laws FA., and Taegtmeyer H. Regulation of cardiac and skeletal muscle malonylCoA decarboxylase by fatty acids. Am. J. Physiol. Endocrinol. Metab. 280 (3): E471-E479, Mar. 2001.

71

ZengKui G. and Zhou L. Dual Tail Catheters for Infusion and Sampling in Rats as an Efficient Platform for Metabolic Experiments. Lab Animal, vol. 32, No. 2, 45-48, Feb. 2003.

72

8. RINGRAZIAMENTI

Desidero esprimere un sentito ringraziamento al prof. Luigi Cattin per la professionalit e la disponibilit usate nei miei confronti durante la preparazione della tesi. Ringrazio inoltre il prof. Gianfranco Guarnirei per la cortesia con la quale mi ha permesso di frequentare il laboratorio di Ricerca della Clinica Medica. Un profondo ringraziamento va al dott. Rocco Barazzoni per la disponibilit e linteresse con cui mi ha seguito: un sostegno importante nelle fasi di preparazione ed elaborazione del presente studio. Desidero inoltre ringraziare la dott.ssa Michela Zanetti per la gentilezza e lesperienza con la quale mi ha dato consigli e suggerimenti utili. Un riconoscimento particolare va al dott. Marco Stebel ed alle sue collaboratrici (Paola e Cristina) per gli insegnamenti e laiuto fornitomi nella delicata fase di lavoro con gli animali. Non dimentico inoltre la dott.ssa Alessia Pirulli per lamicizia e limportante aiuto che ha saputo darmi ed il supporto e la professionalit del sig. Cadelli nella fase di preparazione chirurgica degli animali. Un ringraziamento affettuoso rivolto al personale tecnico del laboratorio, alle sig.re Anna Maria Semolic, Mariella Sturma ed Anna DeSanctis che con pazienza e dedizione mi hanno guidato nellapprendimento

73

delle principali tecniche di laboratorio. Allo stesso modo ringrazio Barbara e Rossella. Grazie a tutte voi per lamicizia ed il sostegno. Grazie anche ai miei adorati nonni per la pazienza e laffetto con i quali mi hanno sostenuto in questi anni. Un ringraziamento speciale va a Giulietta perch le sue parole sono sempre venute dal cuore. Ricordo e ringrazio inoltre i miei cari amici Elisa, Giorgio, Ale, Jenny, Giovanni ed Emanuele per la sopportazione e laiuto a superare i momenti di tensione. Grazie anche a Claudia e a Silvia per questultimo anno di vita triestina.

74