Sei sulla pagina 1di 21

GENETICA MENDELIANA

Si consideri un incrocio triibrido AABBrr x aabbRR dove A e B sono dominanti su a e b


rispettivamente mentre R ed r mostrano il fenomeno della codominanza. Nella progenie
ottenuta incrociando due tripli eterozigoti
1- Quante classi fenotipiche sono attese?
2- Qual è la probabilità del genotipo parentale aabbRR?
3- Quale frazione di omozigoti per i tre alleli ci si aspetta?
4- Quali saranno i genotipi dei gameti prodotti dall’individuo AaBbRr?
5- Quale frazione della progenie avrà un genotipo identico a quello degli individui della
F1?

Trattandosi di un incrocio tra due tripli omozigoti (linee pure). Gli individui della F1
avranno tutti un genotipo triplo eterozigote: AaBbRr.
Risposta 1
Per calcolare il numero delle classi fenotipiche nella F2, dal momento che per quanto ci
risulta i tre geni non interagiscono, possiamo considerare indipendentemente i tre geni.
Per quanto riguarda i geni A e B avremo le solite due classi fenotipiche, dominante (A-) e
recessiva (aa). Per quanto riguarda R invece dovremmo considerare che la codominanza
osservata nell’eterozigote produrrà tre classi fenotipiche corrispondenti alle tre classi
genotipiche RR, Rr ed rr.
Combinando le classi fenotipiche dei tre geni tra di loro otteniamo

2x2x3= 12 classe fenotipiche

Risposta 2.
Possiamo ragionare in diversi modi. Per esempio:
Per ottenere uno zigote di genotipo aabbRR occorre che un gamete maschile di genotipo
abR fecondi un gamete femminile con lo stesso genotipo. Basta quindi cacolarsi la
probabilità che un triibrido produca un gamete abR per arrivare alla soluzione.
Nell’ipotesi si assortimento indipendente ciascuna combinazione allelica dei gameti
generati da un triibrido avrà probabilità 1/2x1/2x1/2=1/8.
Affinchè il genotipo dello zigote sia aabbRR si devono incontrare due ameti identici
ciascuno generato con probabilit`1/8. Ne segue che la probabilità dello specifico genotipo
nella F2 è pari a.

Risposta 3

Anche in questo caso l’analisi è facilitata dal fatto che i tre geni segregano
indipendentemente e possiamo quindi considerare un gene per volta.
Limitandoci a considerare il gene A, la probabilità di ottenere un omozigote da un
incrocio tra due ibridi Aa è pari ad 1/2 , ovvero ¼ per l’omozigote AA ed ¼ per
l’omozigote aa.
Lo stesso ragionamento si può fae per gli altri due geni. Usando la regola della
probabilità composta (eventi indipendenti) otteniamo che la probabilità di ottenere un
individuo omozigote per tutti i geno è pari a
1/2x1/2x1/2=1/8

Risposta 4

I gameti prodotti dal triplo eterozigote saranno le otto combinazioni possibili tra gli alleli
dominanti e recessivi dei tre geni A, B e R, ovvero

ABR
ABr
AbR
aBR
Abr
aBr
abR
abr

Risposta 5.

La domanda è equivalente a chiedersi quanti individui della F2 saranno tripli eterozigoti.


Possiamo ragionare come nella risposta 3. Per ciascun gene un incrocio tra due ibridi ha
una probabilità ½ di generare un eterozigote (Aa, aA, aa, AA). Quindi la probabilità di un
triplo eterozigote sarà

1/2x1/2x1/2=1/8

Un meiocita ha tre coppie di cromosomi omologhi. Ciascun membro di una coppia è


identificato geneticamente da da tre geni che presentano una forma all’elica dominante e
una recessiva. (A,a; B,b; C,c). Supponendo che questi geni permettano di distinguere
ciascun cromosoma, quante diverse combinazioni si possono ottenere quando la cellula è
in anafase I? Quali?

I geni sono su diversi cromosomi e quindi nell’anafase I assortiscono in maniera


indipendente.
Supponiamo che il cromosoma marcato dall’allele A vada a ‘sinistra’ nel campo visivo
del nostro microscopio di osservazione. A seconda di come si dispongono gli altri due
cromosomi, potremmo avere le seguenti quattro configurazioni.

ABC---abc
AbC---aBc
Abc---aBC
ABc---abC
Mendel incrociò delle linee pure di piante di pisello con caratteri dominanti a seme liscio,
giallo e con rivestimento marrone (AABBCC) con delle piante con i caratteri recessivi a
seme rugoso, verde e rivestimento bianco (aabbcc).

Quale proporzione di piante in F2 avrà semi con un rivestimento bianco?


Quale proporzione di piante in F2 avrà semi con fenotipo uguale al genitore F1
E quante lo stesso genotipo
Qual’e la probabilità che un pisello preso a caso sia aabbcc
E aaBbcc?

Risposta 1: Gli individui della F1 saranno triibridi AaBbCc. Focalizzandoci sul solo gene
C, la percentuale di semi che avranno un rivestimento bianco, ovvero omozigot recessivi
cc saranno ¼.

Risposta 2: Il fenotipo della F1 è dominante per tutti e tre i caratteri. I tre geni considerati
indipendentemente hanno ciascuno probabilità ¾ di mostrare un fenotipo dominante (2/4
di genotipo eterozigote e ¼ di genotipo omozigote dominante. La probabilità di avere un
fenotipo dominante per tutti e tre i caratteri sara uindi 3/4x3/4x3/4=27/64.

Risposta 3: Il genotipo della F1 è AaBbCc. Ciascun gene avrà probabilità ½ di essere


nella forma eterozigote nello zigote della F2. Quindi nell’ipotesi di segregazione la
probabilità che tutte e tre le coppie di geni siano nella forma eterozigote sarà
1/2x1/2x1/2= 1/8.

Risposta 4: dal momento che ciascun gene ha probabilità ¼ di essere nella forma
omozigote recessiva, la probabilità di aabbcc sarà 1/4x1/4x1/4=1/64

Risposta 5: Seguendo il ragionamento delle precedenti risposte, p(aa)=1/4 p(Bb)=1/2


p(cc)=1/4. Ne segue che p(aaBbcc)=1/4x1/2x1/4=1/16

Considerate il seguente incrocio:

A/a; B/b; C/c; D/d; E/e x a/a; B/b; c/c; D/d; e/e

Quale proporzione della progenie sarà genotipicamente uguale a:


a) il primo genitore
b) il secondo genitore
c) uno dei due genitori
d) nessun genitore

Il testo non ci dice nulla sulle relazioni di associazione tra questi geni. Possiamo
ragionevolmente assumere che i geni segreghino indipendentemente altrimenti l’esercizio
non sarebbe risolvibile. Consideriamo quindi la segregazione di ciascun gene
separatamente e poi usiamo la regola del prodotto delle probabilità per ottenere la
probabilità di ottenere un particolare genotipo.
a) Il primo genitore è eterozigote per ciascuno dei geni. E’ facile convincersi che la
probabilità che da un incrocio Aa x aa si ottenga un eterozigote per a è pari a ½.
Ragionando in maniera analoga per Bb x Bb otteniamo che anche in questo caso la
probabilità è pari ad ½. Ne segue che per ottenere un individuo eterozigote per
tutti e 5 i geni la probabilità sarà (½)5=1/32.
b) E’ facile (possibile) convincersi che il ragionamento fatto per il punto a) può
essere esteso alla seconda domanda arrivando allo stesso risultato.
c) Per rispondere a questa domanda si può utilizzare la regola dell’addizione delle
probabilità addizionando le probabilità che l’individuo della progenie sia
genotipicamente uguale al primo o al secondo genitore. 1/32+1/32=2/32=1/16
d) Anche questo quesito si può affrontare con la strategia utilizzata al punto a) e b).
E’ forse più semplice però osservare che lo stesso risultato si può ottenere
sottraendo a 1 la probabilità, calcolata nel punto c), che la progenie sia
genotipicamente identica ad uno dei due genitori. (1-1/16)= 15/16.

La posizione assiale dei fiori è dominante su quella terminale. Rappresentando l’allele


per la posizione assiale con A e con a l’allele che codifica per la posizione terminale.
Determinare i tipi e le proporzioni dei gameti e delle progenie prodotta da ciascuno dei
seguenti incroci ed il fenotipo.
1- AAxaa, 2-AAxAa, 3-Aaxaa, 4- AaxAa

Risposta 1: AAxaa. I gameti del primo genitore saranno tutti di genotipo A mentre quelli
del secondo di genotipo a. Gli zigoti risultanti saranno tutti di genotipo eterozigote Aa e
fenotipo dominante assiale
Risposta 2: AAxAa. Gameti A per il primo genitore e 50% A e 50% a per il secondo. Ne
segue che gli zigoti saranno per il 50% AA e 50%Aa. Tutti assiali.
Risposta 3: Aaxaa.Gameti A e a per il primo genitore e a per il secondo. Gli zigoti
risultant saranno per il 50%Aa e 50% aa quindi fenotipicamente metà assiai e metà
terminali.

Nell’incrocio Aa Bb DD Ff x AA Bb dd ff tutti i geni segregano indipendentemente e


mostrano dominanza completa.
1- Definire la proporzione di progenie eterozigote per tutti i loci
2- Quanti e quali gameti differenti sono possibili per ciascun genitore
3- Quanti e quali zigoti geneticamente differenti sono possibili in quest’incrocio

Risposta 1
Analizzando un gene per volta. Incrociando due individui AaxAA metà della progenie
sarà Aa e metà AA quindi la probabilità dell’eterozigote è ½. Per quanto riguarda B i due
genitori sono entrambi eterozigoti e la progenie sarà per ¼ omozigote dominante, un
quarto omozigote recessiva e ½ eterozigote. Analogamente tutta la progenie sarà
eterozigote per D (DDxdd) e metàà per F (Ffxff).
Ne segue che la probabilità che un individuo della progenie sia eterozigote per i quattro
geni è
1/2*1/2*1*/2=1/8

Risposta 2
I gameti dei genitori potranno essere di due tipi per quanto riguarda i geni in eterozigosi
e di un tipo per i geni in omozigosi. Quindi il primo genitore avrà 2*2*1*2=8 gameti
differenti mentre il secondo 1*2*1*1=2 gameti geneticamente differenti

Risposta 3
Anche in questo caso consideriamo un gene per volta. La segregazione degli alleli del
gene B e la loro succesiva combinazione casuale può generare omozigoti dominanti,
recessivi o eterozigoti. Il gene A invece non potrà invece essere nella condizione
omozigote recessiva. Il gene D (DDxdd) potrà soltanto essere nella condizione
eterozigote. Mentre F potrà essere nella condizione eterozigote o omozigote recessiva
(Ffxff). Quindi il numero totale di zigoti geneticamente differenti sarà 2*3*1*2=12

Quante differenti combinazioni dei cromosomi paterni e materni possono trovarsi nei
gameti originati da un organismo con numero diploide 8 (2n = 8)

Ragioniamo per semplicità su due coppie di cromosomi. Chiamiamo 1p 2p 1m e 2m i


cromosomi 1 e 2 ricevuti dal padre e dalla madre dell’individuo che stiamo considerando.
Le possibili combinazioni nei gameti sono 1p 2p, 1m2p, 1p 2m, 1m 2m, ovvero 2*2=4.
Generalizzando per n cromosomi avremo che le possibili combinazioni sono 2n. Nel caso
considerato nell’esercizio 24=16

Incrociando due piante si osservano nella prole 230 AA, 510 Aa e 240 aa. Determinare il
genotipo delle piante parentali.

Le piante parentali hanno prodotto progenie di tutti e tre i possibili genotipi. Osserviamo
inoltre che la numerosità delle classi stanno in un rapporto approssimativamente di 1:2:1.
Questo risultato è compatibile con un incrocio tra due eterozigoti.

Nelle cavie il colore nero (B) domina sul bianco (b). Ed il pelo corto (S) sul lungo (s).
Nella F2 di un incrocio tra BBSSxbbss, quale frazione di topi con pelo nero corto ci si
attende? E con pelo bianco corto?

Nell’ipotesi che i due geni segreghino indipendentemente, ovvero non siano associati, ci
aspettiamo una segregazione delle quattro classi fenotipiche nel rapporto 9 nero corto 3
bianco corto 3 nero lungo 1 bianco lungo. Quindi la frazione di topi della F2 con pelo
nero corto sarà pari a 9/16 mentre la progenie con pelo bianco corto (ovvero recessivo,
dominante) sarà pari a 3/16
Quale delle seguenti affermazioni è compatibile con una malattia causata da un allele
dominante?

Se l’”allele malattia” dominante è A, gli individui eterozigoti Aa saranno malati e gli


omozigoti recessivi aa saranno sani. Naturalmente anche gli omozigoti dominanti saranno
malati ma molto rari nella popolazione

1) È impossibile che nasca un figlio malato da due individui sani.


Questa risposta è corretta perchè essendo dominante l’allele che causa la malattia,
l’informazione che i due genitori sono sani implica che nessuno dei loro due alleli è
dominante ed in assenza di una nuova mutazione (estremamente rara) non possono
generare un figlio malato.
2) Due genitori malati possono avere un figlio sano
Due genitori malati saranno con alta probabilità eterozigoti (gli omozigoti per un gene
malattia dominante sono estremamente rari) e quindi potranno generare un figlio
omozigote recessivo (sano) con probabilità ¼.
3) Circa la metà dei figli di genitori malati è sana
Per le ragioni discusse sopra la prima affermazione non è corretta
4) Due genitori malati possono avere figli sani solo se anche il nonno era sano.
Questa affermazione non è corretta. Abbiamo detto che due genitori eterozigoti possono
avere figli sani. Le condizioni di salute del nonno sono irrilevanti.

Quale delle seguenti affermazioni è compatibile con il fatto che la galattosemia è


determinata da un carattere monogenico recessivo?

Nel caso di una malattia causata da un allele recessivo gli individui malati saranno
tutti di genotipo aa
1) Due genitori sani hanno un figlio galattosemico
Questo caso è possibile se tutti e due i genitori sani sono eterozigoti AaxAa. Un
figlio avrà probabilità ¼ di essere omozigote recessivo e quindi malato
2) Un genitore galattosemico ed uno sano hanno un figlio sano
I genotipi dei genitori sono aa e A-. Dal momento che uno dei due genitori ha
l’allele dominante A è possibile che questoa allele venga ereditato da un figlio che
sarà di conseguenza sano.
3) Due genitori sani hanno un figlio sano.
Viste le considerazioni della risposta precedente a maggior ragione due genitori
sani potranno avere uun figlio sano.
4) Due genitori galattosemici hanno un figlio sano.
I genitori galattosemici hanno entrambi genotipo aa. Di conseguenza, tutti i figli
avranno genotipo aa e saranno malati.

Una coppia è formata da individui provenienti di famiglie che hanno una storia di
galattosemia, una malattia causata dalla forma recessiva di un gene autosomico. La donna
A B C D

ha un fratello galattosemico mentre la madre del partner è anche galattosemica. Stimare


G H
la probabilità che la coppia abbia un figli galattosemico.

La coppia potrà avere un figlio galattosemico con


probabilità ¼ soltanto se entrambi gli individui sono
eterozigoti. L’uomo H essendo fenotipicamente normale e
avendo la madre malata (omozigote recessiva) sarà
sicuramente eterozigote. La donna G è sana, ma la
presenza di un fratello malato indica che entrambi i suoi geneitori sono necessariamente
etrozigoti. I figli fenotipicamente sani di genitori eterozigoti hanno una probabilità 2/3 di
essere eterozigoti (nota bene 2/3 e non non 2/4 perché, essendo il figlio sano, possiamo
escludere con certezza la possibilità che G sia omozigote recessiva). Se ne deduce che la
probabilità che la coppia abbia un figlio malato sarà pari 1/4*2/3=2/12
INTERAZIONE GENICA

Nei topi il colore a chiazze del pelo è dovuto a un gene recessivo s e il colore pieno
all'allele dominante S. I topi con pelo colorato possiedono un'allele dominante C mentre
gli albini sono omozigoti recessivi cc. Il colore nero è prodotto da un allele dominante B
ed il colore marrone dall'allele recessivo b. Il genotipo cc è epistatico per entrambi i loci
B e S. Quale rapporto fenotipico è atteso nella progenie di genitori triibridi?

Interpretando il testo i tre geni c b s interagiscono per produrre cinque diversi fenotipi
che sono determinati dalle combinazioni alleliche indicate qua sotto

cc -- -- albino
C- B- ss nero a chiazze
C- bb ss marrone a chiazze
C- B- S- nero
C- bb S- marrone

I triibridi Cc Bb Ss avranno quindi un fenotipo con pelo nero pieno

Inrociando Cc Bb Ss x Cc Bb Ss

¼ di tutta la progenie sarà cc indipendentemente dalle combinazioni alleliche degli altri


due geni.
Dei rimanenti ¾ che hanno almeno un allele dominante del gene c (CC o cc) ¼ saranno a
chiazze ovvero omozigote recessivi per il gene ss mentre ¾ avranno un colore compatto.
Infine ¾ degli animali avranno un pelo nero mentre ¼ saranno marroni.

Mettendo tutto insieme

Albini ¼ 1 1= 1/4
nero a chiazze saranno ¾ ¼ ¾ =9/64
marrone a chiazze ¾ ¼ ¼ =3/64
nero ¾ ¾ ¾ = 27/64
marrone ¾ ¾ ¼ = 9/64

Quando polli Black Langsham, con zampe piumate vengono incrociati con polli Buff
Rock che hanno zampe non piumate. tutta la F1 ha zampe piumate. Su una progenie F2 di
360 individui 24 presentano zampe non piumate e 336 zampe piumate. (a) Quale è il tipo
d'interazione tra i due loci che governa il fenotipo di questo carattere? (b) Quale frazione
della F2 con zampe piumate ci si attende che sia eterozigote in un locus e omozigote
nell'altro

(a)
Una prima ipotesi è che ci troviamo di fronte ad un gene con due forme alleliche con il
fenotipo piumato dominante su quello non piumato. L’ipotesi deve però essere rigettata
perchè nella F2 il rapporto di segregazione dei fenotipi non è 3:1
Il rapporto tra le numerosità delle classe fenotipiche nella F2 è invece molto vicino ad un
rapporto 15:1 tipico di un interazione tar due geni che hanno la stessa funzione (geni
duplicati. Soltanto il genotipo doppio recessivo (aa bb) produce un fenotipo non piumato

(b)
La F2 potrebbe essere omozigote per il locus a (p=1/2) ed eterozigote per il locus b
(p=1/2) per una probabilità totale di 1/4. Alternativamente eterozigote per a ed omozigote
per b (di nuovo p=1/4). Quindi la metà della F2 (8 su 16) sarà eterozigote in un locus ed
omozigote nell’altro. Siccome una delle possibili combinazioni alleliche aa bb non sarà
piumato. 8/15 della progenie piumata satà omozigote in un locus ed eterozigote nell’altro.

Quando una linea di ratti gialli é incrociata con una linea di ratti neri la F1 è tutta grigia.
Incrociando individui della F1 tra di loro si ottenne una F2 formata da 10 ratti gialli, 28
grigi, 2 di color crema e otto neri. a) Come sono ereditati questi colori e quali genotipi
corrispondono ai fenotipi osservati ? b) Dal punto di vista teorico quanti dei 48 ratti della
F2 avrebbero dovuto avere color crema ? c) Quanti avrebbero dovuto essere omozigoti?

a) La segregazione del tipo 9 (28)/3 (10)/3 (8)/ 1 (2) quando si incrociano gli ibridi grigi
di prima generazione ci fa sospettare che ci troviamo di fronte a due geni che influenzano
il colore del mantello del topo.
Se chiamiamo A e B I due geni, la corrispondenza tra genotipi e fenotipi potrebbe essere
la seguente:
A- B- grigio (grigio è infatti l’ibrido di prima generazione ed il colore grigio ha una
frequenza di 9/16 nella generazione F2)
aa bb crema (è la classe meno frequente nella F1 presente in 1/16 della progenie della F2)
A- bb gialli
aa B- neri

b) La segregazione attesa è del tipo 9/3/3/1. Ovvero in una nidiata 48 topolini dovremmo
trovarne 37 grigi 9 neri 9 gialli e 3 crema.

c) Gli omozigoti attesi sono AAbb AABB aabb e aaBB per un totale di 4/16=1/4. Ovvero
su una nidiata di 48 topolini un totale di 12 omozigoti.
MAPPATURA GENICA NEGLI EUCARIOTI

Trovare la mappa genetica dei tre geni di Drosophila c e ct utilizzando i dati del seguente
esperimento. Femmine omozigoti recessive per c vengono incrociate con maschi
recessivi per ct e. Le femmine della F1 vengono incrociate con maschi recessivi. Solo gli
alleli recessivi vengono indicati nelle classi fenotipiche
4153 c 513 c e
3990 e ct 501 ct
419 c ct 5 wild type
408 e 3 c e ct F2

Il problema ci propone l’interpretazione di un “classico” reincrocio a tre punti in cui una


femmina triplo eterozigote viene incrociata con un maschio recessivo.

I geni sono associati (localizzati sullo stesso cromosoma). Se non lo fossero, ci


aspetteremmo per le otto classi fenotipiche una numerosità paragonabile
Per semplicità nell’interpretazione del problema numeriamo e riscriviamo le classi
fenotipiche indicando anche gli alleli wt dei tre geni

1 4153 c e+ ct+ 5 513 c e ct+


2 3990 c+ e ct 6 501 c+ e+ ct
3 419 c e+ ct 7 9 c+ e+ ct+
4 408 c+ e ct+ 8 7 c e ct

Il nostro primo obbiettivo è trovare l’ordine dei geni. Per far questo identifichiamo le
classi parentali (le più numerose) e quelle che derivano da una doppia ricombinazione tra
i cromosomi parentali (meno numerose)

Parentali 1 c e+ ct+
2 c+ e ct

Doppio ricombinati 7 c+ e+ ct+


8 c e ct

Osserviamo che scambiando gli alleli c tra le due classi parentali si ottengono le classi
doppio ricombinanti. Questa è una prova che il gene c sta in mezzo nella mappa genetica

Osserva che, in assenza di ogni altro riferimento, una mappa ct c e è indistinguibile da


un’altra e c ct. Chiamiamo I e II le due regioni che separano c da ct e da e
rispettivamente.
E’ facile convincersi che le classi 3 e 4 sono state generate dai cromosomi parentali
attraverso ricombinazione nella regione I mentre le classi 5 e 6 sono generate da
ricombinazioni nella regione II.
Avendo individuato i meccanismi di cross over che hanno generato le otto classi
fenotipiche, possiamo ora calcolare la frequenza di gameti ricombinanti nelle due regioni
nella meiosi della femmina eterozigote (la meiosi del padre genera soltanto gameti che
contengono gli alleli recessivi di tutti e tre i geni)
La frequenza di ricombinazione nella regione I si ottiene

Analogamente per la regione II

Questi due numeri, espressi in percentuale, rappresentano le distanze tra i geni in unità di
mappa o centiMorgan (cM).

I geni per l'ellissocitosi e per l'antigene Rh degli eritrociti sono associati su uno degli
autosomi e distano approssimativamente 20 unità di mappa. Un uomo con ellissocitosi
(malattia dominante), la cui madre ha eritrociti di forma normale ed un genotipo
omozigote Rh+ ed il cui padre è Rh- ed eterozigote per ellissocitosi, si sposa con una
donna normale Rh-.
A) Quali sono le probabilità che il loro primo figlio sia Rh- ed affetto da ellissocitosi
B) Se esso è invece Rh+, quali sono le probabilità che sia anche affetto da ellissocitosi?

Chiamiamo E l’allele dominante del gene dell’ellissocitosi ed e il corrispondente gene


recessivo (normale). Il testo dell’esercizio ci permette di determinare il genotipo
dell’uomo e della partner (vedi figura). Inoltre, dal momento che ci viene fornita la
distanza di mappa tra i geni E ed Rh siamo in grado di calcolarci la frazione di gameti che
portano la combinazione allelica parentale o ricombinante nella meiosi dell’uomo che è
un eterozigote.
A) perché il figlio sia Rh- ed affetto da ellissocitosi bisogna che erediti dal padre
l’allele dominante E insieme all’allele Rh- ovvero una combinazione parentale
degli alleli. La probabilità che questo avvenga è pari al 40% (la madre è
omozigote per entrambi i geni e trasmetterà ai figli soltanto combinazioni
recessive dei due geni.
B) Se il figlio è Rh+ può avere ricevuto o la combinazione parentale e + o quella
ricombinante E +. Dal momento che soltanto il 20% dei gameti Rh+ (nota bene
non del totale dei gameti) sono anche E, 20% sarà la probabilità che un figlio Rh+
abbia l’ellissocitosi.

La distanza A-B=15cM, B-C=8cM e A-C=23 cM. Calcolare in un incrocio Abc/aBC x


abc/abc la percentuale di progenie Abc/abc.

L'analisi degli aschi prodotti in seguito all'incrocio tra due ceppi di Neurospora che
richiedono adenina per crescere (ad1 +) x (+ ad2) ha dato i seguenti risultati.
Numero di aschi tipo di aschi
110 4 ( + +) : 4 (ad1 ad2)
100 4 (ad1 +) : 4 ( + ad2)
80 2 (ad1 +) : 2 ( + +) : 2(ad1 ad2) : 2 (+ ad2)
a) Determinare se i geni ad1 e ad2 sono associati
b) Determinare la distanza dei due geni dal centromero e, se i due geni sono associati, la
loro distanza

Rappresentiamo il risultato della dissezione degli aschi in maniera più realistica in modo
che sia più facile analizzare la segregazione degli alleli. Le ottadi contengono ciascuna 8
ovali rappresentanti le spore ordinate mentre i simboli + e – rappresentano l’allele
selvatico e mutato dei geni ad1 (sinistra) ed ad2 (destra). Per rispondere alle domande
posteci dall’esercizio classifichiamo innanzitutto gli aschi in cui gli alleli dei geni in
considerazione hanno segregato in prima (MI) o seconda MII divisione meiotica. Inoltre
per facilitare la determinazione della frequenza di ricombinazione identifichiamo gli
aschi che contengono soltanto spore di tipo parentale (DP), quelle che contengono solo
spore ricombinanti (DNP) e quelle che invece contengono sia spore parentali che
ricombinanti (T).

Per rispondere alla prima domanda dobbiamo determinare la frequenza di


ricombinazione.

1
T + DNP
FRad1−ad 2 = 2 = (40 +110) / 290 = 0.517
T = DP + DNP

la frequenza di ricombinazione molto vicina al 50% ci suggerisce che i due geni non
siano associati e quindi probabilmente localizzati su cromosomi diversi.

La distanza di ciascun gene dal suo centromero va invece stimata dalla frequenza di
segregazione in seconda divisione meiotica
1 MII 40
FRAd1 = ⋅ = = 0.138
2 MI + MII 110 +100 + 80

1 MII 0
FRAd 2 = ⋅ = =0
2 MI + MII 110 +100 + 80
Si conclude che il gene Ad1 è strettamente associato al suo centromero. Una mappa
compatibile con i risultati sperimentali è mostrata qui sotto.

Tre mutazioni di neurospora y,w, z distano 6, 8 e 14 cM dal centromero (dallo stesso lato
del centromero). In un incrocio ywz x +++, quale frazione di aschi mostrerà una
segregazione in seconda divisione per w?

Distanza dal centromero=FRw-cen=1/2MII

MII= 2*FR=2*0.08=0.16

Per MII si intende la frequenza delle meiosi che segregano in seconda divisione meiotica

L’abbondanza della base A nel cromosoma di un organismo è pari ad 1/5 del totale delle
basi. Quale sarà l’abbondanza della purina G?

Se A è un quinto del totale anche T, la base complementare sarà un quinto del totale. La
somma delle basi G e C sarà pari a 3/5 del totale. Di conseguenza l’abbondanza di G sarà
3/10 del totale
MAPPATURA GENICA NEI BATTERI

Un batterio con genotipo thr+ leu+ ara+ è infettato da un batteriofago trasducente. Il


lisato ottenuto viene utilizzato per infettare un batterio thr- leu- ara-. I batteri di questa
seconda infezione (riceventi) vengono selezionati su una prima piastra priva di leucina e
su una seconda che non contiene treonina. Le colonie cresciute vengono saggiate per la
cotrasduzioe degli altri geni. Disegnare la mappa genetica e spiegare brevemente il
procedimento.

Marcatore selezionato % di cellule con geni cotrasdotti


leu+ 76 ara+ 3 thr+
thr+ 3 leu+ 0 ara+

I batteriofagi trasducenti hanno la capacità di trasferire frammenti di cromosoma


batterico da una cellula batterica all’altra incorporando il materiale genetico nel capside
del batteriofago stesso. Dal momento che la quantità di DNA che può essere contenuta
in un capside fagico è limitata, soltanto geni che sono vicini nel cromosoma batterico
potranno essere trasportati insieme in una particella trasducente (cotrasdotti). Inoltre più
i geni sono vicini più alta sarà la loro frequenza di cotrasduzione.

La prima riga della tabella ci dice che il gene leu è più vicino ad ara di quanto non lo sia
a thr ma non ci permette di distinguere tra le due ipotesi mostrate in figura.

Il risultato della seconda riga che mostra che batteri trasdotti per il gene thr non possono
essere anche essere tradotti per il gene ara è però incompatibile con la mappa A e
quindi, per esclusione, l’unica mappa compatibile con i risultati è quella mostrata in B.

Usando il batteriofago P22 avete allestito un incrocio a tre marcatori in Salmonella


typhimurium. L’incrocio è tra un batterio ricevente Arg- Leu- His- e il batteriofago P22
che è cresciuto in un ceppo Arg+ Leu+ e His+. Avete selezionato 1000 trasductanti Arg+
e li avete testati su diversi terreni selettivi mediante replca su piastra. Avete ottenuto I
seguenti risultati.
Arg+ Leu- His- 583
Arg+ Leu- His+ 300
Arg+ Leu+ His+ 114
Arg+ Leu+ His- 1

In un incrocio tra un Hfr dal genotipo stps ilv+ mtl+ bgl+ ed un F- dal genotipo stpr ilv-
mtl-bgl-. Si sa che il gene ilv è l’ultimo dei tre ad essere trasferito. Si selezionano
exconiuganti ilv+ e di questi si osservano I genotipi mtl e bgl. Basandosi sui seguenti
risultati determinare ordine e distanza dei geni.

Ilv+ mtl+ bgl+ 220


Ilv+ mtl- bgl- 60
Ilv+ mtl- bgl+ 18
Ilv+ mtl+ bgl- 0

Quattro mutazioni puntiformi, nel gene rII (1, 2, 3, 4) vengono incrociate con cinque
delezioni (A,B,C,D,E). La linea tratteggiata indica la regione di DNA che è assente nelle
delezioni. Dai risultati nella tabella determinare la posizione delle mutazioni puntiformi
rispetto alle delezioni. Il segno + nella tabella indica che l’esperimento di ricombinazione
ha generato batteriofagi wt.
Descrivere brevemente il metodo utilizzato per risolvere il problema.

A B C D E A------
1 - - + - + B--------------------
2 + - + + + C -------------
3 + - - + + D---
4 + + + + - E --------

L’esercizio si risolve considerando che una mutazione puntiforme incrociata con un


delezione non è in grado di produrre mediante ricombinazione il fenotipo selvatico se la
mutazione stessa è localizzata nella regione che è “mancante” nella delezione.
Per esempio la mutazione 1. Secondo i risultati della prima riga della tabella è
localizzata in una regione in cui le delezioni A, B e D si sovrappongono. Seguendo
questo tipo di ragionamento per tutte le mutazioni puntiformi si deduce la mappa
genetica illustrata nella figura.
Un ricercatore, dopo aver isolato 8 mutazioni che causano il fenotipo lisi rapida in un
batteriofago, ha eseguito un esperimento di ricombinazione con le seguenti delezioni

----------A------------- ------------C------
-----------B---------------- -----------D------------
-------------E-------------

1 2 3 4 5 6 7 8
A + - + + + + - +
B + - + - - + + +
C + + - + + + + -
D + + - + + - + -
E - + - - + - + +

Determinare le posizioni dei mutanti puntiformi rispetto alle delezioni

Le stesse mutazioni puntiformi vengono utilizzate per un esperimento di


complementazione che produce i seguenti risultati.

1 2 3 4 5 6 7 8
1 - + + - + + + +
2 - + + - + - +
3 - + + - + -
4 - + - + -
5 - + - +
6 - + -
7 - +
8 -

Quanti geni sono presenti in questa regione

Espressione genica

Dato un gene che contiene sul filamento stampo (quello che viene
trascritto/copiato dall'RNA polimerasi) la sequenza 5' CAT, quale anticodone si appaia in
quella posizione al corrispondente mRNA?
Se il filamento stampo contiene 5’CAT il messaggero avrà la sequenza complementare
5’AUG quindi l’anticodone del tRNA che si appaierà a questo codone sarà 5’ CAU.
Consideriamo il seguente RNA messaggero
5’AUCCGCUAUGCAGCCCCGAGGUCGGUAUGACGUAUUUAGCGGAUUGACAGCAUGAGCAUU

Determinare la lunghezza della catena polipeptidica sintetizzata da questo RNA


messaggero.
Che catena polipeptidica viene sintetizzata se nel gene che codifica per questo
messaggero viene inserita una T dopo il codone iniziatore ATG?

La “difficoltà” di questo esercizio sta nell’identificare il segnale di inizio della


traduzione. Ricordandosi che il segnale di inizio è costituito da un codone AUG
preceduto da una sequenza ricca in purine (Shine-Dalgarno) identifichiamo
GAGGUCGGUAUG come segnale d’inizio. Dopo sei codoni codificanti troviamo un codone
di stop UGA. Quindi la catena polipeptidica sarà lunga sei amminoacidi.
Se inseriamo una T dopo il codone di inizio si sposta il registro di lettura e dopo 9
codoni codificanti troviamo un codone di STOP UGA

Un RNA sintetico è formato solo da C ed G in uguale proporzione. Quali amminoacidi


vengono codificati ed in che proporzione?

MUTAZIONI

Una cultura batterica viene fatta crescere seminando un unico batterio in terreno liquido.
La crescita viene arrestata dopo il compimento della quinta generazione. A) Qual´é il
numero totale di batteri alla fine della crescita? Se avviene una mutazione alla quarta
generazione ed una alla quinta (uno soltanto dei due batteri generati in ciascuna
generazione in cui avviene un evento mutagenico è mutato) calcolare B) Il tasso di
mutazione C) La frequenza di mutazione.

Alla fine della crescita dopo la quinta generazione saranno presenti 32 batteri come
mostrato nello schema qui sotto. I batteri colorati indicano la presenza di una mutazione.
In seguito agli eventi di mutazione alla fine della crescita saranno presenti 3 batteri
mutanti da cui si deduce che la frequenza di mutazione è uguale a 3/32

Il tasso di mutazione è invece definito come il numero di eventi di mutazione (2) diviso
per il numero di generazioni (31, osservare lo schema per convincersi).
Il tasso di mutazione è quindi uguale a 2/31

REGOLAZIONE GENICA

In questo esempio, a,b,c,d sono geni dell'operone del lattosio (repressore, operatore, β -
galattosdasi, permeasi). Tenendo conto delle osservazioni riportate sotto, attribuite alle
lettere l’identità dei geni spiegando perché

a+, b+, c-, d+; esprime β-galattosidasi e permeasi sia in assenza che in presenza di
lattosio
a+, b-, c+, d+; esprime la β-galattosidasi solo in presenza di lattosio, non esprime mai la
permeasi
a-,b+,c+,d+; esprime la permeasi solo in presenza di lattosio, non esprime mai la β-
galattosidasi
a+,b+,c-,d+/ a-,b-,c+,d+; esprime β-galattosidasi e permeasi sia in assenza che in
presenza di lattosio

La prima informazione ci dice che la mutazione c- è una mutazione costitutiva; ovvero c


deve rappresentare o il gene repressore o l’operatore.
La seconda informazione è compatibile con la possibilità che b rappresenti il gene per la
permeasi
La terza informazione ci dice invece che a rappresenta il gene per la β-galattosidasi.
Ci rimane da capire tra c e d quale sia il gene per il repressore e quale sia invece
l’operatore.
Il risultato del quarto esperimento infine ci dice che c- è dominante in cis. Se ne deduce
che c non codifica per un prodotto diffusibile e che non può essere il gene per il
repressore. Quindi c è l’operatore e per esclusione d è il gene per il repressore.

Tre aliquote di un frammento di DNA di 69 Kb vengono digerite con l’enzima di


restrizione EcoR1, con BamH1 e con entrambi gli enzimi. Quando i diversi campioni
vengono analizzati mediante elettroforesi su gel di agarosio si osservano una serie di
frammenti di diverso peso molecolare come mostrato in figura. Determinare una mappa
di restrizione compatibile con questo esperimento.

La prima “corsia” del gel mostra le dimensioni del frammento non digerito.
In seguito a digestione con l’enzima EcoR1 si ottengono tre frammenti di
dimensioni 45, 15 e 9 Kb. In seguito a digestione con BamH1 si ottengono
invece due bande di dimensioni 19 e 60 Kb rispettivamente. Digerendo con
entrambi gli enzimi di restrizione si ottengono invece quattro frammenti.
Questo insieme di risultati indica che EcoR1 tagli il frammento di DNA due
volte mentre BamH1 ha soltanto un sito di riconoscimento all’interno del
frammento. Notiamo dalla quarta corsia che il frammento maggiore di Ecor1
(45 Kb) viene frammentato in due frammenti di 4 e 41 Kb rispettivamente.
Analogamente il frammento di 19 Kb di BamH1 è tagliato in due frammenti
di 15 e 4 Kb rispettivamente. Ragionando in questo modo si deduce che la
15 4541 9
EcoR1 4

BamH1 19 50
mappa di restrizione disegnata nella figura è compatibile con i dati
sperimentali.