Sei sulla pagina 1di 28

Università degli Studi di Firenze

Facoltà di Scienze Matematiche Fisiche e Naturali


Corso di Laurea in Biotecnologie

Dott. Ferri Lorenzo Dott. Sparvoli Valentina


Single Nucleotide Primer Extension
Permette di rilevare polimorfismi puntiformi
(SNPs) in qualsiasi punto di una regione del
DNA amplificabile via PCR.

Attraverso l’estensione di uno o più primer


di un solo nucleotide complementare alla
base polimorfica che si vuole studiare.
Single Nucleotide Primer Extension

5’ T 3’
T
3’ A 5’

O O O
O- P O P O P O CH2 O BASE
O- O- O-
I H H H H

H H
ELETTROFORESI
CAPILLARE

lunghezza
Single Nucleotide Primer Extension

INDIVIDUAZIONE ANALISI DETERMINAZIONE


GENOTIPI
MUTAZIONI SNuPE

IDENTIFICAZIONE
di SPECIE
PROTOCOLLO SPERIMENTALE

1. ANALISI BIONFORMATICA
Ricerca e recupero, per ogni specie, delle sequenze
nucleotidiche del MARCATORE MOLECOLARE (es.
un gene) scelto come bersaglio dell’analisi, disponibili
in banca dati

SPECIE A SPECIE C
AF108056 SPECIE B AF247043
AF108057 AF604821
AY473021
AF269041 AY600626
AF057108
AY074260 AY744103
AY604126
AY460027 AY690319
AY067403
........ ........
AF269017
........
PROTOCOLLO SPERIMENTALE

1. ANALISI BIONFORMATICA
Allineamento delle sequenze
recuperate per ogni specie

AF108056 Specie A AGTCAATCGACCGTTCGGACCGGTGACTATACGACG


AF108057 Specie A AGTCAACCGACCGTTCCGACCGGTGACTATTCGACG
AF269041 Specie A AGTCAATCGACCGTTCGGACCGGTGACTATACGACG
AY074260 Specie A AGTCAATCGGCCGTTCGGACCGCTGACTATACGACG
AY460027 Specie A AGTCAATCGGCCGTTCGGCCCGCTGACTATACGACG

Consensus sequence AGTCAAYCGRCCGTTCGGCCCGSTGACTATWCGACG

Creazione di SEQUENZE CONSENSO


PROTOCOLLO SPERIMENTALE

1. ANALISI BIONFORMATICA
Allineamento delle sequenze
consenso delle specie considerate
SpecieA 95 AGTCAAYCGRCCGTTCGCCCGCTGACTATACGACGTCAGTAGGCACTYAYCCGACTRAAT

SpecieB 95 AGTCAAYCGACCGTTCCACCGCTGAGTATACGACGTCAGTAGGCACTYAYCCGACTRAAT

SpecieC 95 AGTCAAYCGGCCGTTCGACCGTTGAGTATACGGCGTCAGTAGGCACTYAYCCGACTRAAT

SpecieA 155 ACTTYCGGGCAATCTACGRYYTCAAYCGRCAGTTCGGRTCACGACGACGTCYTRCAGTTC

SpecieB 155 ACYTYCGRGCAATCAACGRYCTCAAYCGRCAGTYCGGRTCACGACGACGTCYTRCAGTTC

SpecieC 155 ACTTYCGGGCAATCGACGRYYTCAATCGRCCGTTCGGATCACGACTACGTCYTRCAGTTC

SpecieA 215 TCTACGTRCGGTCACGACGTCGCTGAGTATTCGTCYTRCAGMCCGTTCCACCGCACGACG

SpecieB 215 TCTACGTRCAGTGACGACGTCGCTGAGTATGCGTCYTRCAGACCGGTCCACCGCRCGACG

SpecieC 215 TCTACGTRCAGTCACGACGTCGCTGAGTATACGTCYTRCAGACCGGTCCACCGCACGACG

Individuazione SNPs SPECIE SPECIFICI


PROTOCOLLO SPERIMENTALE

2. DISEGNO PRIMER

CRITERI

Devono ricadere all’interno di una


regione amplificabile via PCR
Scelta SNPs utili per Devono presentare regioni
l’analisi SNuPE conservate a monte o a valle
Singolarmente o combinati insieme devono
consentire di discriminare le specie
PROTOCOLLO SPERIMENTALE

2. DISEGNO PRIMER

SpecieA 95 AGTCAAYCGRCCGTTCGCCCGCTGACTATACGACGTCAGTAGGCACTYAYCCGACTRAAT
SpecieB 95 AGTCAAYCGACCGTTCCACCGCTGAGTATACGACGTCAGTAGGCACTYAYCCGACTRAAT
SpecieC 95 AGTCAAYCGGCCGTTCGACCGTTGAGTATACGGCGTCAGTAGGCACTYAYCCGACTRAAT

SpecieA 155 ACTTYCGGGCAATCTACGRYYTCAAYCGRCAGTTCGGRTCACGACGACGTCYTRCAGTTC

SpecieB 155 ACYTYCGRGCAATCAACGRYCTCAAYCGRCAGTYCGGRTCACGACGACGTCYTRCAGTTC

SpecieC 155 ACTTYCGGGCAATCGACGRYYTCAATCGRCCGTTCGGATCACGACTACGTCYTRCAGTTC

SpecieA 215 TCTACGTRCGGTCACGACGTCGCTGAGTATTCGTCYTRCAGMCCGTTCCACCGCACGACG

SpecieB 215 TCTACGTRCAGTGACGACGTCGCTGAGTATGCGTCYTRCAGACCGGTCCACCGCRCGACG

SpecieC 215 TCTACGTRCAGTCACGACGTCGCTGAGTATACGTCYTRCAGACCGGTCCACCGCACGACG


PROTOCOLLO SPERIMENTALE

2. DISEGNO PRIMER
CARATTERISTICHE

Annealing su tutte le specie


Disegno primer per
l’analisi SNuPE Coda di poli T all’estremità 5’

SpecieA 215 TCTACGTRCGGTCACGACGTCGCTGAGTATTCGTCYTRCAGMCCGTTCCACCGCACGACG

SpecieB 215 TCTACGTRCAGTGACGACGTCGCTGAGTATGCGTCYTRCAGACCGGTCCACCGCRCGACG

SpecieC 215 TCTACGTRCAGTCACGACGTCGCTGAGTATACGTCYTRCAGACCGGTCCACCGCACGACG

5’-(T)5AGTCACGACGTCGCTGAGTAT-3’
PROTOCOLLO SPERIMENTALE

3. PCR
Fw Rev
245

PURIFICAZIONE PCR

1. Marker; 2. campione; 3. controllo negativo


PROTOCOLLO SPERIMENTALE

4. REAZIONE SNuPE
PRODOTTO di PCR PURIFICATO

READY
PRIMER SNuPE
REACTION MIX
9AmpliTaq®DNA Polymerase;
9 FS Reaction Buffer;
9ddNTPs (ddGTP,ddCTP,ddTTP,ddATP)
O O O
O- P O P O P O CH2 O BASE
O- O- O-
H H H H

H H
PROTOCOLLO SPERIMENTALE

4. REAZIONE SNuPE
(SIMPLEX)

9 Denaturazione.
5’ T 3’
Specie A
3’ A 5’

9 Annealing
del primer. 5’ T 3’
Specie A
3’ A 5’
STRATEGIA SPERIMENTALE

4. REAZIONE SNuPE
(SIMPLEX)
O O O
9 Estensione del O- P O P O P O CH2 O BASE
primer. O- O- O-
H H H H

H H

5’ T 3’
Specie A T
3’ A 5’
PROTOCOLLO SPERIMENTALE

5. ELETTROFORESI CAPILLARE
(SIMPLEX)
9 Elettroforesi capillare.
I
T
Specie A 3’ A 5’
lunghezza

I
G
Specie B 3’ C 5’
lunghezza

A I
Specie C 3’ T 5’

lunghezza
PROTOCOLLO SPERIMENTALE

5. ELETTROFORESI CAPILLARE
(SIMPLEX)
9 Elettroforesi capillare

T
Specie A 3’ A 5’
I

A
Specie B 3’ T 5’ lunghezza
PROTOCOLLO SPERIMENTALE

SpecieA 95 AGTCAAYCGRCCGTTCGCCCGCTGACTATACGACGTCAGTAGGCACTYAYCCGACTRAAT
SpecieB 95 AGTCAAYCGACCGTTCCACCGCTGAGTATACGACGTCAGTAGGCACTYAYCCGACTRAAT
SpecieC 95 AGTCAAYCGGCCGTTCGACCGTTGAGTATACGGCGTCAGTAGGCACTYAYCCGACTRAAT

SpecieA 155 ACTTYCGGGCAATCTACGRYYTCAAYCGRCAGTTCGGRTCACGACGACGTCYTRCAGTTC

SpecieB 155 ACYTYCGRGCAATCAACGRYCTCAAYCGRCAGTYCGGRTCACGACGACGTCYTRCAGTTC

SpecieC 155 ACTTYCGGGCAATCGACGRYYTCAATCGRCCGTTCGGATCACGACTACGTCYTRCAGTTC

SpecieA Specie SNP 1 SNP 2


215 TCTACGTACAGTCACGACCTCGCTGAGTATTCGTCYTRCAGMCCGTTCCACCGCACGACG

SpecieB 215 TCTACGTACAGTGACGACTTCGCTGAGTATGCGTCYTRCAGACCGGTCCACCGCRCGACG

SpecieC
Specie A A C
215 TCTACGTACAGTCACGACTTCGCTGAGTATACGTCYTRCAGACCGGTCCACCGCACGACG

Specie B A T

Specie C G T
PROTOCOLLO SPERIMENTALE

SpecieA 95 AGTCAAYCGRCCGTTCGCCCGCTGACTATACGACGTCAGTAGGCACTYAYCCGACTRAAT
SpecieB 95 AGTCAAYCGACCGTTCCACCGCTGAGTATACGACGTCAGTAGGCACTYAYCCGACTRAAT
SpecieC 95 AGTCAAYCGGCCGTTCGACCGTTGAGTATACGGCGTCAGTAGGCACTYAYCCGACTRAAT

SpecieA 155 ACTTYCGGGCAATCTACGRYYTCAAYCGRCAGTTCGGRTCACGACGACGTCYTRCAGTTC

SpecieB 155 ACYTYCGRGCAATCAACGRYCTCAAYCGRCAGTYCGGRTCACGACGACGTCYTRCAGTTC

SpecieC 155 ACTTYCGGGCAATCGACGRYYTCAATCGRCCGTTCGGATCACGACTACGTCYTRCAGTTC

SpecieA Specie SNP 1 SNP 2


215 TCTACGTACAGTCACGACCTCGCTGAGTATTCGTCYTRCAGMCCGTTCCACCGCACGACG

SpecieB 215 TCTACGTACAGTGACGACTTCGCTGAGTATGCGTCYTRCAGACCGGTCCACCGCRCGACG

SpecieC
Specie A A C
215 TCTACGTACAGTCACGACTTCGCTGAGTATACGTCYTRCAGACCGGTCCACCGCACGACG

Specie B A T

Specie C G T
PROTOCOLLO SPERIMENTALE

SpecieA 95 AGTCAAYCGRCCGTTCGCCCGCTGACTATACGACGTCAGTAGGCACTYAYCCGACTRAAT
SpecieB 95 AGTCAAYCGACCGTTCCACCGCTGAGTATACGACGTCAGTAGGCACTYAYCCGACTRAAT
SpecieC 95 AGTCAAYCGGCCGTTCGACCGTTGAGTATACGGCGTCAGTAGGCACTYAYCCGACTRAAT

SpecieA 155 ACTTYCGGGCAATCTACGRYYTCAAYCGRCAGTTCGGRTCACGACGACGTCYTRCAGTTC

SpecieB 155 ACYTYCGRGCAATCAACGRYCTCAAYCGRCAGTYCGGRTCACGACGACGTCYTRCAGTTC

SpecieC 155 ACTTYCGGGCAATCGACGRYYTCAATCGRCCGTTCGGATCACGACTACGTCYTRCAGTTC

SpecieA Specie SNP 1 SNP 2


215 TCTACGTACAGTCACGACCTCGCTGAGTATTCGTCYTRCAGMCCGTTCCACCGCACGACG

SpecieB 215 TCTACGTACAGTGACGACTTCGCTGAGTATGCGTCYTRCAGACCGGTCCACCGCRCGACG

SpecieC
Specie A A C
215 TCTACGTACAGTCACGACTTCGCTGAGTATACGTCYTRCAGACCGGTCCACCGCACGACG

Specie B A T

Specie C G T
PROTOCOLLO SPERIMENTALE

SpecieA 95 AGTCAAYCGRCCGTTCGCCCGCTGACTATACGACGTCAGTAGGCACTYAYCCGACTRAAT
SpecieB 95 AGTCAAYCGACCGTTCCACCGCTGAGTATACGACGTCAGTAGGCACTYAYCCGACTRAAT
SpecieC 95 AGTCAAYCGGCCGTTCGACCGTTGAGTATACGGCGTCAGTAGGCACTYAYCCGACTRAAT

SpecieA 155 ACTTYCGGGCAATCTACGRYYTCAAYCGRCAGTTCGGRTCACGACGACGTCYTRCAGTTC

SpecieB 155 ACYTYCGRGCAATCAACGRYCTCAAYCGRCAGTYCGGRTCACGACGACGTCYTRCAGTTC

SpecieC 155 ACTTYCGGGCAATCGACGRYYTCAATCGRCCGTTCGGATCACGACTACGTCYTRCAGTTC

SpecieA Specie SNP 1 SNP 2


215 TCTACGTACAGTCACGACCTCGCTGAGTATTCGTCYTRCAGMCCGTTCCACCGCACGACG

SpecieB 215 TCTACGTACAGTCACGACTTCGCTGAGTATGCGTCYTRCAGACCGGTCCACCGCRCGACG

SpecieC
Specie A A C
215 TCTACGTACAGTCACGACTTCGCTGAGTATACGTCYTRCAGACCGGTCCACCGCACGACG

Specie B A T

Specie C G T
PROTOCOLLO SPERIMENTALE

SpecieA 95 AGTCAAYCGRCCGTTCGCCCGCTGACTATACGACGTCAGTAGGCACTYAYCCGACTRAAT
SpecieB 95 AGTCAAYCGACCGTTCCACCGCTGAGTATACGACGTCAGTAGGCACTYAYCCGACTRAYT
SpecieC 95 AGTCAAYCGGCCGTTCGACCGTTGAGTATACGGCGTCAGTAGGCACTYAYCCGACTRAAT

5’-(T)14CGTTCGCCCGCTGACTATACG-3’ PRIMER 1
(35 basi)

SpecieA 215 TCTACGTTCAGTCACGACGCCGCTGAGTATACGTCYTRCAGMCCGTTCCACCGCACGACG

SpecieB 215 TCTACGTTCAGTCACGACGTCGCTGAGTATCCGTCYTRCAGACCGGTCCACCGCRCGACG

SpecieC 215 TCTACGTTCAGTCACGACGTCGCTGAGTATTCGTCYTRCAGACCGGTCCACCGCACGACG

5’-(T)5TACGTTCAGTCACGACG-3’ PRIMER 2
(22 basi)
PROTOCOLLO SPERIMENTALE

4. REAZIONE SNuPE
(MULTIPLEX)
PRODOTTO di PCR PURIFICATO

READY PRIMER 1
REACTION MIX PRIMER 2
9AmpliTaq®DNA Polymerase;
9 FS Reaction Buffer;
9ddNTPs (ddGTP,ddCTP,ddUTP,ddATP)
PROTOCOLLO SPERIMENTALE

4. REZIONE SNuPE
(MULTIPLEX)
9 Denaturazione.

5’ A C 3’
Specie A 3’ T 5’
G

9 Annealing del primer.


5’ A C 3’

Specie A
3’ T G 5’
PROTOCOLLO SPERIMENTALE

4. REAZIONE SNuPE
(MULTIPLEX)

9 Estensione del primer.

5’ A C 3’

Specie A A C
3’ T G 5’

lunghezza
PROTOCOLLO SPERIMENTALE

5. ELETTROFORESI CAPILLARE
(MULTIPLEX)
9 Elettroforesi capillare.
5’ A C 3’ I
Specie A A C
3’ T G 5’
lunghezza
5’ A T 3’ I
Specie B A T
3’ T A 5’
lunghezza
5’ G T 3’ I
Specie C G T
3’ C A 5’
lunghezza
PROTOCOLLO SPERIMENTALE

5. ELETTROFORESI CAPILLARE
(MULTIPLEX)

9 Elettroforesi capillare.

5’ A C 3’

Specie A A C
3’ T G 5’ I

5’ G T 3’
Specie C G T lunghezza

3’ C A 5’
PROTOCOLLO SPERIMENTALE

5. ELETTROFORESI CAPILLARE
(MULTIPLEX)

9 Elettroforesi capillare.

5’ A C 3’

Specie A A C
3’ T G 5’ I

5’ A T 3’
Specie B A T lunghezza

3’ T A 5’
Single Nucleotide Primer Extension

VANTAGGI
SENSIBILITA’ RAPIDITA’ di
TECNICA
ESECUZIONE
SNuPE

RILEVAZIONE SNPs in QUALSIASI


PUNTO del MARCATORE SCELTO