DNA MESSAGES _1-§0. Name 1. CCT CTT TGC ACT CGG ATC GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC 2. AGA TAC TAG GAC CTT ACT CGA TTG CTG ATT GCG CGA CTA TAA CGG TGC CTC ACT CGG ATT AAC TAG TGC TGA AAT CTT ATT ACG GTA CTT CTC GCC ATC 3. TCC CTT GGG GAA TAT ACA CGC TGG CTT ACT CGA ATT TGA CTC CGT ACG GTA CTC GCC ATC 4, AGA ACA TAA CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA 5. TAA ACT CGG TAC ATT CTA GCT TAG CAC TAA TTA CCC ATC 6. TAC CGT TIC CTT ATT GAT CGC GCC CCA CTC ATT CTT CGG TCT AGG ATC 7. CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 8. ACC GTG ATA ACT CGT GCT CTT ATT ACC CTC ACT AAT CTC CGG TCC TTA TAT TTG CCT ATT TGC GTA TAG TCG ATC 9, TAC CGA TTT CTT ACT AGT GGC TCC TAT TTA CCT ATA ATT ACA GTG TAA ACG TTC CTC TTA TCA ATC 10. CTA TTA CGA ACT TAG AGC ATT GAA TAG AAA CTT ATC Uy eCetoA 2c de) Baa Cen | ‘The Unaret Language of ile | Tego cae runners The sar pret ede sl ae ! Irn agua | Secheey aoeen ww of] ucu se$] uns tf Sram hy 2 ori | ue mee| toe Ser) Und ty WA Us| UCR See §| Unk song samen gente cies WG tev] uae Ser $| Und sort Fometbnawee ne cson Sects pea ssa tty sa ha organs Peel rene cele nneray Sibu gence eran ‘ante gentc ngnrs ‘ei pten schon wean rpc wpe ats cw wt] cau po P| ow eB he tet] cee pe P| cae het Gia tai] tex ne Fl cm Coe ie tat] ce he F| EAS ong fay te 3] cu wT] any ll acu fc te 7] Ace m4] Me nad foe £5 A te 3 | ACA Ine] Aas Uk) Ak Ak fut Mer sec tw 7] atc tm Bl aca me wy viv) ccu awa] cau apd] cou ayG| 28 va ¥} ce Aa A] cat A) oc eve Gi va vl ca na a] can Gu E| Gia oy e| mi) cco aw A) GAG Gue| Goa oye| L at i Tg eres acon wt races. Say ne of cos pel 2 een ie sean ee clos al ema Te tar con Aah es "Ye en ANG onan ns he ne anneal e cera i tors oan a“ Letters net availeble 8B JOUX ZDNA MESSAGES cont'd Name 11 When translating the DNA make sure you start at the 5' end of the mRNA transcript as this is where the ribose attaches the mRNA and begins the translation process DNA sample 3'AGATACTAGGACS' mRNA = 3 CODE POST TRANSCRIPTIONAL MODIFICATION Now you must cut out the introns and leave only exons 12,Onee you get the mRNA transept, cut out codons 10-15 and eadame 43-48 and then decode ro SAGITACTAA AAA TIT GAA CTT ACT TAG TGT TCA ATC GTA CIT TTA AAT CGA GAG TGG GTAATGS! mRNAS\ x CODE 13.Cut out nucleotides 12-14 nucleotides 39-41 and nucleotides 60-62 and then decode SACGCTTGAAAAAGGTAGGACTCGATCTCTCATCCCGTCCAGCCTGCGCTGCATTTGTGTAAAATAGTTACCCAGGS' CODE 14.Cut out nucleotides 11-21 and nucleotides 44-49 and then decode STAAACTGTGCCCTTAATTCCGGACACCTCATTCGTATCCTAGCGGTTCCGCTTCGTTACS CODE 15.In the actual translation of mRNA all messages must start with methionine and all complete ‘messages must end with a stop, just as a sentence ends with a period. In this example there will bbe no spaces between the words so you will have to interpret, Also for this question, you are given the DNA fragment in three segments. First determine the sequence of the fragments and place you answer in the blank. Bm ‘Sequence A S'TTAAAATATITGCCACTCGCTTCAACTTAAAGGACCTAAS' Sequence B 3'GCCCCACTCACAGTGTAAACGTTCCTCGGGAAGCCGTAAS' Sequence C STACCGATTTCTTGATCGCCCCAATTAACCGGGGTTAAAAS' Cut out nucleotides 19-39 nucleotides 67-78 and then decode Final mRNAS' Bt CODE 16.DNA~ S'TCCGTTTATCGTGGACTCTCGCTCTGTGTTGAT’ CODE