Sei sulla pagina 1di 62

Crescita microbica

Fonti di energia e di carbonio

Fonti di Energia:

Fonti di C: CO2, autotrofia, o molecole organiche, eterotrofia


Composizione chimica delle cellule microbiche (%
peso secco)
Nutrimenti necessari per la crescita di un
microrganismo chemorganotrofo eterotrofo
Per la crescita di un microrganismo chemioeterotrofo sono necessari:
a. Acqua (che costituisce il 70-80% in peso umido della materia vivente);
b. Fonte di carbonio, che può essere anche fonte di energia (donatore di elettroni)
(chemio-organotrofi eterotrofi) o solo fonte di carbonio (es.: chemiolitotrofi
eterotrofi; in questo caso l’energia viene ottenuta dall’ossidazione di composti
inorganici). Possibili fonti di C e di E: monomeri di zuccheri, proteine e lipidi, acidi
ed altri derivati organici, idrocarburi, composti xenobiotici, etc.;
c. Fonte di azoto, che può essere organica (proteine, aminoacidi, urea, ammine),
oppure azoto inorganico quali NH4+, NO3- e N2;
d. Fonte di fosforo, che può essere organica o più comunemente inorganica quali
HPO4=, H2PO4-, PO43-;
e. Fonte di zolfo, che può essere organica (aminoacidi solforati), ma anche
inorganica, come SO4= ;
f. Elementi inorganici essenziali: K, Ca, Mg, Fe, Na
g. Microelementi: Mn, Zn, Co, Ni, Cu, Mo
h. Fattori di crescita: vitamine, aminoacidi, base azotate
Classificazione dei microrganismi sulla base della
loro richiesta di ossigeno
a) Aerobi obbligati
b) Anaerobi obbligati
c) Aerobi facoltativi
d) Microaerofili
e) Anaerobi ossigeno tolleranti

Il terreno contiene:
Indicatore redox: resazurrina
Agente riducente: tioglicolato
Formazione di derivati tossici dell'ossigeno
Enzimi che agiscono sui composti tossici dell'ossigeno

Test della catalasi (SOD)


Batteri anaerobici: coltivazione (a)

Giara per anaerobiosi


Batteri anaerobici: coltivazione (b)
Terreni di coltura impiegati per la coltivazione dei microbi
materiali naturali di
origine animale BATTERI
(carne, latte…)

naturali

materiali naturali di MUFFE


origine vegetale LIEVITI
(malto, patate)

Terreni colturali

ricchi o massimi
o complessi BATTERI
sintetici MUFFE
(pronti o minimi o LIEVITI
da preparare) minerali
Esempi di terreni sintetici
Terreno ricco o massimo o completo “Tryptic Soy Agar” (o TSA)

Trypticase 1.5% w/v


Phytone 0.5% w/v
NaCl 0.5% w/v
pH=7
(AGAR 1.5% w/v)

Terreno minimo o minerale o salino “Minimal Mineral Medium” (o MMM)


Na2HPO4 2.77g/l
KH2PO4 1g/l
Ca(NO3)2 * 4H2O 0.03g/l
(NH4)2SO4 1
MgSO4 * 7H2O 0.2
Fe(III)Ammonio 0.01g/l
citrato
Fonte di carbonio X.XX g/l
pH = 7
(AGAR 15 g/l)
Esempi di terreni naturali
Le materie prime naturali principali utilizzate industrialmente come fonti di
C e/o di N sono:
Melassi di canna e di barbabietola: acque madri della
cristallizzazione del saccarosio, ricche di diversi zuccheri (fonte di C);
Siero di latte: liquido ricco di proteine e lattosio (fonte C e N);
“Corn steep liquor”: acque di scarto, ricche in zuccheri semplici e
amminoacidi, risultanti dall’estrazione dell’amido dal mais (fonte di C e
N);
Acque solfitiche: acque ricche di zuccheri, proteine e lipidi generate
dal processo di estrazione della cellulosa dal legno (fonti di C e N);
Oli vegetali, scarti della lavorazione di patate, farina di semi di
soia e di cotone, acque della macellazione.

Il costo di queste materie prime, di norma contenuto, è la somma del


costo intrinseco del materiale, del costo di conservazione e di quello di
trasporto.
Terreni di coltura impiegati per la coltivazione dei
microorganismi
Coltivazione;
produzione di
liquidi biomassa

studi metabolici e
cinetici
Terreni
colturali Isolamento delle
colture pure e
conteggio cellulari
(piastre Petri)
solidi
(+AGAR 1.5% w/v)
(piastre, strisci, infissi)
Mantenimento
dei ceppi
colture pure e miste
Le singole cellule rimangono nella sede di inoculo e la crescita batterica si manifesta
con la comparsa di colonie batteriche nella posizione corrispondente

Coltura MISTA Coltura PURA

Dalla morfologia delle colonie (isolate) è possibile macroscopicamente distinguere se


la coltura è PURA (le colonie sono tutte uguali) o MISTA (sono presenti colonie con
morfologie diverse)
Isolamento di colture pure (a)
2.trasferimento di una
singola colonia in un
terreno sterile in modo da
ottenere una popolazione di
cellule identiche
(coltura pura)

1.Diluizione del campione iniziale per separare


le cellule presenti (isolamento)
Isolamento di colture pure (b)

Verifica della purezza:


a) Morfologia cellule e loro
proprietà (motilità, presenza e
ubicazione delle spore, etc.);
b) Morfologia delle colonie su
terreni ricchi solidi;
c) Analisi dei fenotipi metabolici
di colonie diverse;

Identificazione:
a) Caratterizzazione fenotipica
E/O genotipica (analisi
sequenza 16S rDNA
dell’isolato…).
Caratterizzazione fenotipica
1. CARATTERISTICHE MORFOLOGICHE (forma, dimensione, disposizione delle cellule, presenza di
endospore; aspetto della colonia; colorazione di Gram, mobilità)
2. METABOLISMO ENERGETICO (respirazione aerobia, fermentazione; è anaerobio facoltativo…)

3. CARATTERISTICHE COLTURALI E NUTRITIVE:

fonte di carbonio; esistono in commercio kit per poter testare rapidamente numerose
fonti di carbonio in contemporanea, come ad esempio il sistema di gallerie API
(Analytical Profile Index).

Oltre alla tipologia di fonte di carbonio possono essere studiate: la fonte di azoto, i
fattori di crescita (vitamine), i parametri ambientali (pH, temperatura).

4. CARATTERISTICHE FISIOLOGICHE E BIOCHIMICHE (pattern enzimatico; per es.: catalasi;


amilasi; proteasi; lipasi; ureasi...
5. CARATTERISTICHE CHIMICO-STRUTTURALI (la composizione chimica della parete
cellulare; gli acidi grassi nella membrana cellulare)
Identificazione di batteri coltivabili
CAMPIONE ISOLAMENTO BATTERIO IN ESTRAZIONE DEL AMPLIFICAZIONE DEL
AMBIENTALE SU PIASTRA COLTURA PURA DNA GENE 16S rRNA

ALLINEAMENTO E
COSTRUZIONE CONFRONTO DELLA SEQUENZA
DELL’ALBERO CON QUELLE CONTENUTE IN SEQUENZIAMENTO DEL
FILOGENETICO GenBank GENE 16S rRNA
Caratterizzazione di colture coltivabili e non
SEPARAZIONE DELLE MOLECOLE
ESTRAZIONE DEL AMPLIFICAZIONE DEL AMPLIFICATE
DNA GENE 16S rRNA

Campione da
caratterizzare

Librerie
Miscela di DGGE geniche
Miscela
di ceppi prodotti PCR

SEQUENZIAMENTO
DEI GENI 16S rRNA
ALLINEAMENTO E CONFRONTO DELLE
COSTRUZIONE DELL’ALBERO SEQUENZE CON QUELLE
FILOGENETICO CONTENUTE IN GenBank
Caratterizzazione di colture coltivabili e non
Dal punto di vista prettamente tecnico, la differenza tra analisi di ceppi puri e di comunità è:
1) COLTIVABILI: Separazione (con piastramenti) -> POI -> PCR ed analisi

CAMPIONE ISOLAMENTO BATTERIO IN ESTRAZIONE AMPLIFICAZIONE


AMBIENTALE SU PIASTRA COLTURA DEL DNA DEL GENE 16S rRNA
PURA

2) INCOLTIVABILI: PCR -> POI -> Separazione (con clonaggio o su gel) -> POI -> analisi
ESTRAZIONE AMPLIFICAZIONE DEL SEPARAZIONE DELLE MOLECOLE
DEL DNA GENE 16S rRNA AMPLIFICATE

Campione da
caratterizzare

Librerie
Miscela Miscela di geniche
DGGE
di ceppi prodotti PCR
Caratterizzazione di colture coltivabili e non (DGGE)
1. Si amplificano i 16S dell’intera comunità con primer universali; uno di questi primer ha in
posizione 5’ una estensione di GC; es: cgcgcgcccccggccgcgcgccctgctgtatataaatc

2. A questo punto Coda


tutti i GC primer
frammenti amplificati avranno la coda GC all’inizio

3. Si separano i frammenti in un elettroforesi con un gel particolare; la parte iniziale del gel
(presso i pozzetti) è normale; la parte finale invece è satura di urea e
formammide, due composti fortemente denaturanti, cioè che fanno separare le due
eliche del DNA
4. Scendendo lungo il gel, attirati dal campo elettrico, i frammenti incontrano una
concentrazione sempre maggiore di denaturante ed iniziano a denaturarsi
5. A basse concentrazioni di denaturante si iniziano a separare le coppie AT, debolmente
legate tra loro e solo a concentrazioni maggiori le coppie GC

6. Al termine della corsa i frammenti sono tutti denaturati eccetto la coda GC che è
estremamente resistente; le eliche denaturate si avvolgono su se stesse bloccando
l’avanzata del frammento
Caratterizzazione di colture coltivabili e non (DGGE)
Denaturing Gradient Gel Electrophoresis
Caratterizzazione di colture coltivabili e non: librerie geniche
Un altro metodo prevede il clonaggio dei prodotti PCR presenti in una miscela complessa

Trasformazione : inserire il
Geni 16S rRNA E’ possibile legare ogni singolo vettore in una cellula batterica
amplificati con frammento di DNA amplificato in recipiente (Escherichia coli) in
primer universali
un DNA circolare (plasmide) detto stato competente
vettore

Sequenziamento Piastramento su terreno con antibiotico (Il plasmide


vettore contiene anche un gene che conferisce resistenza ad
un antibiotico): solo le cellule che avranno inserito il
plasmide potranno crescere (trasformanti)
Conservazione delle colture microbiche

Metodica Colture Colture


pure miste
in frigorifero a + 4 °C in:
terreno liquido + +
striscio piastra
striscio
infisso (se colture microaerofile)
in freezer a -80°C
come sospensione cellulare in + (+)
tampone con glicerolo (10% v/v)
come cellule liofilizzate + -

infisso
Determinazione della concentrazione cellulare: conteggio colony
(es. 1g di suolo + 9 ml forming units (CFU) in piastra
di soluzione
fisiologica)

1.Conta per spandimento


2. Conta per inclusione
Determinazione della concentrazione cellulare: conteggio CFU
in piastra
Conta per spandimento
• il campione viene diluito
• un’aliquota nota viene pipettata sulla superficie del substrato agarizzato precedentemente
versato in piastra e solidificato
• l’inoculo viene distribuito sul substrato che viene incubato (in genere per non meno di 24 h)
alla temperatura opportuna
• si contano le colonie: ogni colonia è derivata da una cellula o da un aggregato di cellule
immobilizzato nell’agar
• il numero di colonie viene moltiplicato per il fattore di diluizione
Determinazione della concentrazione cellulare: conteggio CFU in piastra
Conta per inclusione
• il campione viene diluito
• un’aliquota nota viene pipettata in una piastra vuota, alla quale si aggiunge substrato
agarizzato fuso e raffreddato
• substrato e inoculo vengono omogeneizzati e, dopo la solidificazione le piastre vengono
incubate (in genere per non meno di 24 h) alla temperatura opportuna
• si contano le colonie: ogni colonia è derivata da una cellula o da un aggregato di cellule
immobilizzato nell’agar
• il numero di colonie viene moltiplicato per il fattore di diluizione
Determinazione della concentrazione cellulare: conteggio CFU in piastra
(esempi di calcolo)

2 piastre per diluizione,


10-4-10-6: 2 piastre per diluizione,10-3-10-4:
10-4: >200 colonie 10-3: 170 e 190 colonie
10-5: 45 e 41 colonie 10-4: 20 e 22 colonie
10-6: 4 e 6 colonie. Si usano entrambe le diluizioni e
Si usa solo 10-5 e si si calcola la media:
calcola la media: (170+190+200+220)/4= 195
(45+41)/2=43 si moltiplica per il fattore di
si moltiplica per il fattore diluizione: 195x103
di diluizione: 43x105 si esprime il risultato con una sola
si esprime il risultato con cifra significativa: 1,95 x105 ufc/ml
una sola cifra significativa:
4,3x106 ufc/g
Determinazione della concentrazione cellulare:
Misura dell’assorbanza della coltura

Misura peso secco

Incubazione in stufa a Pesare il


105°C per 24h pellet
Determinazione della concentrazione cellulare: misura
della concentrazione delle proteine nel brodo
Metodi colorimetrici basati sulla formazione di
complessi colorati di proteine con alcuni reattivi.

Metodo di Lowry

Proteina + Reattivo di blue


Folin
Amax=750nm

Metodo di Bradford:
blue
Coomassie
Proteina + Brillant blue
G250 Amax=595nm
Determinazione della concentrazione cellulare: misura
della concentrazione delle proteine nel brodo

Retta di taratura
0,45
0,40
0,35
ABS (750nm)

0,30
0,25
0,20
0,15
0,10
0,05
0,00
0,00 0,02 0,04 0,06 0,08 0,10 0,12

BSA (mg/ml)

BSA: Bovine Serum Albumin


Modalità di coltivazione dei microrganismi in
coltura liquida
1. COLTURA DISCONTINUA O BATCH

2. COLTURA CONTINUA

3. COLTURA DISCONTINUA ALIMENTATA O FED-


BATCH
• A VOLUME VARIABILE
• A VOLUME FISSO
• CICLICA O RIPETUTA (SBR)
Coltivazione in batch (coltura discontinua o a lotti) (a)
terreno

brodo

CONCENTRAZIONE

TEMPO
= [ biomassa] (mg/mL o CFU/mL)
= [substrato] (mg/mL, etc)
Coltivazione in batch (coltura discontinua o a lotti) (b)

dX
=µ*X
lnX dt
µ= velocità specifica di crescita (h-1);
X= conc. biomassa (mg/l o CFU/ml)
dX = µ dt lnX = lnX0 + µt
X

a b c d e
tempo

a. fase di latenza o lag.


b. fase di crescita esponenziale o log.
c. fase di decelerazione.
d. fase stazionaria
e. fase di morte cellulare
Coltivazione in batch (coltura discontinua o a lotti) (c)

µ
µmax
µmax [S]
µ=
µmax Ks + [S]
2

Ks [S]
[S] nel tempo durante la coltivazione in batch
[S]f=0 [S]i
µ<µmax : fase di decelerazione µ=µmax : fase di crescita esponenziale

µ = velocità specifica di crescita (h-1)


µmax = velocità specifica massima di crescita (h-1)
ks = k di Monod (g/l; M)
[S] = concentrazione substrato limitante (g/l; M)
Produzione di Metaboliti I e II
Esempi di metaboliti I:
a) Precursori di macromolecole
biologiche: amminoacidi; nucleotidi.
b) Precursori di coenzimi: vitamine.
c) Precursori di lipidi: acidi grassi;
glicerolo.
d) Precursori di polisaccaridi:
monosaccaridi; disaccaridi.
e) Prodotti del catabolismo microbico:
acidi organici; etanolo

Esempi di metaboliti II:


antibiotici;
micotossine,
pigmenti;
Coltivazione in batch: produttività in biomassa
microbica e “metaboliti primari”

PRODUTTIVITA’ MASSIMA

produttività PRODUTTIVITA’ TOTALE

pulizia fase lag fase log Tempo


reattore
Riempimento,
sterilizzazione,
inoculo

PRODUTTIVI TA' =
[PRODOTTO ] / l
TEMPOdiFER MENTAZIONE
Coltivazione in continuo (a)

MEDIUM
BRODO esausto

COLTURA BATCH

F
MEDIUM F
BRODO esausto

V COLTURA CONTINUA
Coltivazione in continuo (b)
Coltivazione in continuo (c)
Parametro chiave: velocità di diluizione D = F/V (h-1)
Si opera una diluizione del brodo di coltura con medium fresco in modo da
raggiungere un equilibrio, o stato stazionario, tale che la concentrazione
cellulare e la composizione del brodo di coltura nel fermentatore
(concentrazione di substrati e di prodotti) rimangono costanti.

La velocità di diluizione D (apporto di substrato e diluizione di biomassa e


metaboliti) controlla la velocità specifica di crescita µ:
Bilancio di biomassa nel reattore
Cellule in Cellule out

dX FX 0 FX dX FX
= − + µX poichè X0 = 0 =− + µX
dt V V dt V
Cellule nuove

F
=0 , quindi µ = =D
Allo stato stazionario dX
dt V
Cinetica della crescita microbica in continuo (d)
il rapporto tra la portata F
dX FX dX
=− + µX = µX − DX (V/t) e il volume residente V
dt V dt è chiamato velocità di
Biomass Biomass diluizione D= F/V [h-1]
growth removal

Se la velocità di rimozione della biomassa (DX) supera quella F F


di formazione (µX), cioè D>µ

allora:
1. La biomassa diminuirà
2. La [S] aumenterà
3. La velocità specifica di crescita del microorganismo
aumenterà

Si raggiunge un nuovo stato di


equilibrio/stato stazionario µ=D
Possiamo quindi regolare la velocità di crescita del microorganismo; e per incrementare la
produttività del processo si può incrementare µ mediante l’incremento di D
Coltivazione in continuo (e)
il rapporto tra la portata F
dX FX dX
=− + µX = µX − DX (V/t) e il volume residente V
dt V dt è chiamato velocità di
Biomass Biomass diluizione D= F/V [h-1]
growth removal

Se la velocità di rimozione della biomassa (DX) supera


F F
quella massima di formazione (µmaxX), cioè D>µmax

allora:
1. La biomassa diminuirà
2. La [S] aumenterà
3. La velocità specifica di crescita del microorganismo
non può aumentare, poiché µ=µmax

µmax< D
Wash out
Coltivazione in continuo (f)

D< µmax: stato


D >µmax: wash-out
stazionario
12 6
[S] (g/l) X (g/l)
8 3
DX (g/l h-1)
4 2

0 0
0 0,2 0,4 0,6 0,8
D (h-1)
Andamento dei parametri della fermentazione continua
in funzione della velocità di diluizione
Coltivazione in continuo (g)
Principali vantaggi delle colture in continuo rispetto alle colture batch
Incremento della produttività e riduzione dei tempi morti dovuti a pulizia del
fermentatore, preparazione e sterilizzazione del substrato e del fermentatore…
Maggiore riproducibilità;
Controllo accurato della velocità specifica di crescita e della concentrazione di
biomassa nel reattore;
Studio delle costanti cinetiche di crescita, energia di mantenimento, rese in prodotto
e delle condizioni ottimali per lo sviluppo di biomassa e la formazione di prodotto.

Principali svantaggi delle colture in continuo rispetto alle colture batch


Maggiore rischio di inquinamento della coltura
Maggiore rischio di degenerazione del ceppo produttore per mutazione spontanea o
instabilità del vettore (selezione di mutanti con maggiore velocità di crescita ma con
minore capacità produttiva);
Non adatte per prodotti non associati alla crescita microbica;
Non adatte a microrganismi filamentosi (sviluppo sulle pareti o in aggregati cellulari che
provocano il wash-out o impediscono il raggiungimento dello stato stazionario;
Costi di recupero del prodotto più elevati (grossi volumi, basse concentrazioni).
Coltivazione in fed-batch (discontinua alimentata)
Prolungamento della fase di crescita esponenziale con aumento della
produttività (in biomassa cellulare e metaboliti primari)
• Al termine della fase esponenziale di crescita si fornisce nuovo substrato
sotto forma di cristalli o soluzioni stock molto concentrate fed-batch a
volume fisso (fattore limitante: non si diluiscono eventuali prodotti tossici)

• Al termine della fase esponenziale di crescita si alimenta


il reattore con medium fresco: si fornisce nuovo substrato
per la crescita e si diluiscono la biomassa e i prodotti
tossici del metabolismo fed-batch a volume variabile
(fattore limitante: capacità del reattore)

• Al termine della fase esponenziale di


crescita si recupera parte del brodo x
esausto e si immette nel reattore un ugual
volume di medium fresco: fed-batch
ciclica o ripetuta s
Coltivazione in fed-batch: sequencing batch reactor
(SBR)

Reattore a regime non stazionario


Parametri chimico-fisici che controllano la crescita
microbica (a)

pH
Sostanze chimiche

Crescita Pressione
microbica osmotica

Temperatura
Radiazioni
(X, γ, β, α, UV)
Parametri chimico-fisici che controllano la crescita
microbica: pH

attività enzimi
stato di dissociazione
metaboliti e nutriliti
stato chimico-fisico
della membrana
Parametri chimico-fisici che controllano la crescita
microbica: temperatura (ii)
Parametri chimico-fisici che controllano la crescita
microbica: pressione osmotica
Attività dell’acqua (aw) Disponibilità dell’acqua
presente in un mezzo per
reazioni chimiche o
Legge di Raoult biochimiche o per
cambiamenti di stato
n2
aw =
n1 + n2
p
aw =
p0
RH
aw =
100
Parametri chimico-fisici che controllano la crescita
microbica: pressione osmotica

aw ≅ 0.995 aw < 0.995

Meccanismo di resistenza
a bassi valori di aw

STRATEGIA GENERALE

accumulo
intracellulare di soluti
Parametri chimico-fisici che controllano la crescita
microbica: pressione osmotica

3 (ambienti 33
marini) (saturazione)
(% w/v)
Soluti compatibili prodotti da
microorganismi alofili, xerofili
e osmofili
Parametri chimico-fisici che controllano la crescita microbica:
sostanze chimiche
Effetto microbiostatico o microbicida; dipende dalla concentrazione, tipologia
di microbi, durata del contatto e dal mezzo in cui avviene
a) membrana cellulare (alterazione del doppio strato lipidico della membrana e/o sua
perforazione):
- detergenti cationici, anionici, non ionici
- fenolo e suoi derivati alchilati, clorurati e nitrati
- solventi organici (cloroformio, toluene, alcoli a catena corta) toluene

b) alterazione conformazione di proteine (alterazione/denaturazione proteine di


membrana): solventi organici, fenoli, acidi e basi minerali, acidi organici
Parametri chimico-fisici che controllano la crescita (c)
c) modificazione gruppi funzionali proteine (alterazione covalente di proteine, inibizione
irreversibile di enzimi)
- sali solubili di metalli pesanti (Ag+, As3+, Hg++): 2R-SH + Hg++ R-S-Hg-S-R
- agenti ossidanti (H2O2, Cl2): 2R-SH ox R-S-S-R

- agenti alchilanti
O O H

H-C-H e CH2-CH2 E-SH + H-C-H E-S-C-OH


(E-OH o E-COOH)
O H

HNO2 , coloranti acridinici DNA


COOH SO2NH2

d) metabolismo basale (parte del


metabolismo bloccato)
NH2 NH2
Ac. paraammino benzoico sulfenilammide
Parametri chimico-fisici che controllano la crescita
microbica: composti chimici
Parametri chimico-fisici che controllano la crescita
microbica: composti chimici

Batteriocine: molecole di natura proteica ad attività antagonistica


contro microrganismi di specie filogeneticamente affine.
Es. Nisina (GRAS) prodotta da Lactococcus lactis e attiva contro
Listeria monocytogenes, Clostridium botulinum.
si impiega in diversi preparati alimentari, specialmente in formaggi
Well diffusion test
e derivati.
Metodi di sterilizzazione

(c,d)

(a, b, c)

(b,e)

(b,e) a) Ambienti di coltura (beuta,


reattore)
b) Utensili
c) Mezzo di coltura
antibatteriche
d) Gas (aria) introdotti negli ambienti
(b,e) e) Superfici di laboratorio
Metodi di sterilizzazione: filtrazione (a)
Metodi di sterilizzazione: filtrazione (b)
Filtri di profondità (materiali Filtri assoluti o ad esclusione molecolare
fibrosi organici o agglomerati (derivati della cellulosa, materiale polimerico
minerali). La sterilizzazione sottile tipicamente idrofobico (PTFE); l’80% del
avviene per ritenzione delle volume del filtro è dovuto a pori, che sono di
cellule attraverso esclusione diametro 0.2-0.8 um). La ritenzione avviene per
molecolare, trattenimento fisico esclusione molecolare. Il filtro richiede un
interno, adsorbimento fisico ed supporto su deve essere appoggiato. Si satura
elettrostatico. Buono per facilmente, ma assorbe e rilascia composti
sterilizzare aria, gas meno di quello di profondità.
Metodi di sterilizzazione: radiazioni UV
Metodi di sterilizzazione: calore

Parametri principali:
• Temperatura
• Durata del
trattamento.
Operatività:
a) con calore secco:
170°C per 5 h, in
stufa
b) con calore umido:
121°C per 20 min.
oppure 110°C per 30
min
Metodi di sterilizzazione: calore umido