Sei sulla pagina 1di 36

LA PCR

•La PCR è una metodica sensibile, veloce e versatile che consente di ottenere
grosse quantità di materiale genetico a partire da piccole quantità
•La PCR insieme alla possibilità di sintetizzare comodamente qualsiasi tipo di
oligo permette di analizzare specifiche sequenze che altrimenti costituirebbero
bersagli molto rari in un genoma complesso
•Una zona specifica di DNA viene bersagliata con due oligo (3’ rivolti l’uno verso
l’altro) che amplificano, tramite la reazione polimerasica, la zona stessa
copiandola in un enorme numero di volte e rendendola visibile e manipolabile per
l’analisi.
•L’amplificazione automatizzata della procedura, la possibilità di utilizzare alte
temperature di esercizio e la possibilità di definire esattamente la sequenza da
amplificare conferisce alla PCR grande sensibilità, specificità e versatilità
•L’amplificazione della sequenza bersaglio è in teoria uguale a 2n, cioè se vengono
effettuati 32 cicli di PCR la sequenza bersaglio si sarà amplificata
232volte(1073741824!!!)
"Beginning with a
single molecule of
the genetic
material DNA,
the PCR can
generate 100
billion similar
molecules in an
afternoon. The
reaction is easy
to execute. It
requires no more
than a test tube,
a few simple
reagents, and a
source of heat.”

K.Mullis
Taq-polimerasi: a 100° è parzialmente denaturata, ma reversibilmente
Thermus aquaticus
Conventional PCR

Ethidium-
Gel
detection
Cosa serve per allestire una
reazione di PCR?
• DNA stampo con la regione da amplificare
• Due primers complementari al filamento senso
ed antisenso del DNA da amplificare
• Taq Polymerasi
• Deossinucleosidi trifosfato.
• Soluzione tampone per garantire un ottimo di
attività e stabilità della DNA polimerasi
• Ioni Mg2+
Primer forward
3’-AAACTAGCCATGAAATTCGATTAAGCCCAAGTTTAAGCCCCAGGCTTAAGGCTA-
5’
5’CGGTACTTTAA3’
Primer reverse

3’CCAGGCTTAAG5’
5’- T TTGATCGGTACTTTAAGCTAATTCGGGTTCAAATTCGGGGTCCGAATTCCGAT-
3’
Step iniziale: 94-96oC per 1-9min se la DNA polimerasi richiede un hot-Start

Step di denaturazione:di solito 30’’ a 95 per denaturare gli stampi causando


la rottura dei ponti ad idrogeno tra le basi complementari

Step di annealing :la reazione viene abbassata tra 50 e 60 oC per


permettere l’annealing dei primers. Solitamente la Tm di annealing è 2-5oC
sotto la Tm dei primers. La Taq si lega all’ibrido primer-templato ed inizia la
sintesi del DNA

Step di estensione: viene condotta a 72oC che è la temperatura ottimale di


esercizio della Taq polimerasi

Step di Elongazione: la reazione viene condotta per circa 5-10min a 72oC


per completare prodotti di amplificazione parziali e favorire l’appaiamento di
prodotti complementari, ma a singola elica
3
FIBROSI CISTICA

Norm ATC ATC TTT GGT


CF ATC AT T GGT

oC


Amplificazione del gene ed ibridazione con sonde
specifiche per allele mutato e normale o
sequenziamento
Diagnosi di malattie infettive
Da:

Sangue/siero
Saliva
Sudore
Feci
Urine
Espettorato
Tamponi oro-faringei
Biopsie

Test commerciali più comuni


Chlamydia
Mycobacterium tuberculosis
HIV (carica virale con PCR quantitativa)

POSSIBILE PER QUALSIASI MICROORGANISMO O VIRUS


DI CUI SI CONOSCA LA SEQUENZA DEL GENOMA
TEST PCR per HPV
TEST DI
INFEZIONE
Test di tipizzazione
Linfomi follicolari
• Frequentemente si
tratta di una
traslocazione
cromosomica t14;18
• Si associa ad una
mutazione genetica che
causa overespressione
di Bcl-2
• La traslocazione
avvicina il sito delle
catene pesanti delle
immunoglobuline al gene
bcl-2, che viene
attivamente trascritto,
determinando un blocco
dei processi apoptotici.
DNA minisatellite ipervariabile o VNTR
(Variable Number of Tandem Repeat)

• Sono sequenze altamente polimorfiche ed organizzate in oltre 1000


gruppi (lunghi da 0.1 a 20 kb) di corte unità ripetute in tandem, che
variano considerevolmente per dimensioni ma posseggono una
sequenza comune centrale (core),GGGCAGGAXG

• Molti di questi gruppi si trovano vicino ai telomeri

• La maggior parte di queste sequenze non sono trascritte eccetto


alcuni elementi all’interno di sequenze intrageniche non codificanti

• Il significato non è ancora chiaro, ma indipendentemente dalla loro


reale funzione nel genoma umano, esiste un utilizzo pratico di questi
gruppi, ma in genere delle sequenze ripetute, nel DNA fingerprinting
(impronta digitale del DNA)
VNTR
IL DNA fingerprinting è attualmente la tecnica più
potente per identificare un campione biologico.

Viene utilizzata dal 1984 in medicina forense


(medicina legale) per risolvere casi legali: attribuzione
di paternità, casi di omicidi, casi di stupri, ecc.

La Genetica forense, ossia l’applicazione della


Genetica nella risoluzione dei casi legali, si avvale della
variabilità del genoma umano per identificare un
individuo, o meglio per attribuire un campione
biologico ad un unico individuo.
PCR quantitativa “Real‐Time”
Polymerase Chain Reaction: plateau
Resa effettiva: effetto plateau

Il processo di duplicazione non procede “all’infinito”,


esso è limitato da:
Quantità dei primers
Attività della Taq polimerasi
Reannealing dei filamenti

Raggiunto il plateau non si osserva più un incremento nei


prodotti
Anche se la quantità iniziale di template è la
medesima, il plateau è raggiunto in tempi diversi ed in
cicli diversi

25

20

15

10

0
0 10 20 30 40
Cycle
Soluzioni
• Utilizzare i dati ottenuti durante la fase esponenziale
Il prodotto di PCR è proporzionale al templato
iniziale

• Questo è reso possibile mediante il rilevamento, di una


fluorescenza, che è proporzionale al prodotto di PCR

• La fluorescenza, durante ogni ciclo di amplificazione,


può essere rilevata utilizzando uno strumento
quantitativo ma anche dei marcatori fluorescenti il cui
accumulo segue la stessa cinetica della reazione di PCR
Perché Real-Time?

Misura l'amplificazione in tempo reale


durante la fase esponenziale della
PCR, quando cioè l'efficienza di
amplificazione è influenzata
minimamente dalle variabili di
reazione, permettendo di ottenere
risultati molto più accurati rispetto
alla PCR tradizionale "end point"
RT-PCR quantitativa
•Rilevamento della fluorescenza associata all’amplificazione

•Il prodotto di PCR non viene analizzato su gel di agarosio

•Analisi del prodotto di fluorescenza tramite computer


Plot lineare

Incremento di
fluorescenza

Cicli di PCR
Analisi tramite software
Chimiche fluorescenti
per PCR Real-Time

•La fluorescenza si genera durante la PCR per


effetto di diverse possibili reazioni chimiche

•Le chimiche principali sono basate sia sul


legame di coloranti fluorescenti che si
intercalano nella doppia elica di DNA, come il
SYBR Green, sia sull'ibridazione di sonde
specifiche.
SYBR Green: principio
Utilizza una molecola fluorescente non specifica che si
lega al solco minore del DNA
All’inizio del processo di amplificazione, la
miscela di reazione contiene DNA denaturato,
primers e la molecola fluorescente
Dopo l’annealing dei primers, si legano
poche molecole fluorescenti alla doppia
elica.
Durante l’elongazione si verifica un aumento
di fluorescenza che corrisponde all’ aumento
del numero di copie dell’amplicone