http://informahealthcare.

com/ahb
ISSN: 0301-4460 (print), 1464-5033 (electronic)

Ann Hum Biol, Early Online: 1–10

! 2014 Informa UK Ltd. DOI: 10.3109/03014460.2014.954614

RESEARCH PAPER

Methodological strategies to assess the degree of bone preservation for

ancient DNA studies
Gabriele Scorrano1, Federica Valentini2, Cristina Martı́nez-Labarga1, Mario Federico Rolfo3,
Antonella Fiammenghi4*, Domenico Lo Vetro5, Fabio Martini5, Antonella Casoli6, Giovanni Ferraris7,
Giuseppe Palleschi2, Antonio Palleschi2, and Olga Rickards1
1
Centro di Antropologia molecolare per lo studio del DNA antico, Dipartimento di Biologia, 2Dipartimento di Scienze e Tecnologie Chimiche,
Università degli Studi di Roma Tor Vergata, via della Ricerca Scientifica, Roma, Italy, 3Dipartimento di Beni Culturali, Musica e Spettacolo, Facoltà di
Lettere e Filosofia, Università di Roma ‘Tor Vergata’, Roma, Italy, 4Soprintendenza per i Beni Archeologici di Salerno, Avellino e Benevento, Salerno,
Ann Hum Biol Downloaded from informahealthcare.com by Tulane University on 09/29/14

Italy, 5Museo e Istituto Fiorentino di Preistoria, Università di Firenze, Firenze, Italy, 6Dipartimento di Chimica, Università degli Studi di Parma, Parco
Area delle Scienze, Parma, Italy, and 7Istituto per lo Studio dei Materiali Nanostrutturati-CNR, c/o Dipartimento di Chimica, ‘Sapienza’ Università di
Roma, Roma, Italy

Abstract Keywords
Background: Archaeological bones contain only small amounts of DNA due to post-mortem Amino-acid racemization, crystallinity, Early
DNA degradation and the changes endogenous DNA is subjected to during diagenesis. An Neolithic, roman imperial age, upper
important step before undertaking such time-consuming and costly analyses as ancient DNA paleolithic
investigation is to predict the presence of DNA in ancient samples. To date, the leading
For personal use only.

screening method has been amino acid racemization; however, other analytical techniques can History
also be used to assess the degree of bone preservation.
Aim: The aim of the present study was to relate the presence of DNA with bone preservation Received 1 April 2014
in order to select samples potentially suitable for ancient DNA analysis. Revised 4 July 2014
Subjects and methods: Bones collected from several archaeological sites, different locations Accepted 14 July 2014
(cave, rockshelter or sub divo) and diachronic periods were selected for analytical and Published online 18 September 2014
spectroscopic analysis in order to correlate bone tissue preservation with the presence of DNA.
Different techniques were combined to assess the degree of preservation of organic and
inorganic components.
Results: As determined by different analytical methods, preservation of the inorganic
component was best associated with the presence of DNA.
Conclusion: Evaluation of the bone preservation state may be an efficient step to predict the
presence of DNA in ancient samples prior to aDNA analysis.

Introduction Since the aDNA is in bone, diagenetic processes that alter

Archaeological bone remains provide a valuable source of
information about the past, but only a few samples contain
analysable ancient DNA (aDNA). As the bones come into
contact with sediments, water and micro-organisms, their
organic and inorganic composition is altered by partial or
complete dissolution, precipitation and re-crystallization
(Reiche et al., 2003). Hence, the state of bone preservation
is highly variable and chiefly influenced by direct environ-
mental conditions.
*Antonella Fiammenghi, who promoted the Velia Project, unfortunately
died before the submission of this article.
Correspondence: Gabriele Scorrano, Centro di Antropologia molecolare
per lo studio del DNA antico, Dipartimento di Biologia, Università degli
Studi di Roma Tor Vergata, via della Ricerca Scientifica n. 1, 00173
Roma, Italy. Tel: +39 06 72594350. Fax: +39 06 2023500. Email:
gabrielescor@gmail.com
the bone structure also alter the chemical microstructure that
protects aDNA (Sosa et al., 2013). Normally, aDNA and
collagen are physically protected against external attack by an
inorganic component (Nielsen-Marsh et al., 2000a). Indeed,
DNA has a strong affinity for the mineral phase by virtue of
the attraction between the negative charges of the phosphate
groups of the DNA and the positive charges of Ca2+ of the
hydroxyapatite (Okazaki et al., 2001). This binding confers
the DNA more resistance to degradation (Paget et al., 1992).
Poinar et al. (1996) reported that DNA survival could be
predicted by measuring the extent of aspartic acid racemiza-
tion. Since the kinetics of aspartic amino acid racemization
are believed to be similar to the rate of DNA depurination,
they could represent a valuable measure of the likelihood of
DNA survival (Bada et al., 1994). Later analyses on 91 bone
and teeth samples demonstrated, however, that aspartic acid
racemization is not a useful screening technique for aDNA
preservation in archaeological remains (Collins et al., 2009).
 2 G. Scorrano et al.
Therefore, the relation between aDNA and bone preservation
is incompletely understood.
Diagenetic parameters are evaluated to quantify post-
mortem alterations. This can be done with the combined
use of a variety of analytical techniques, including
Fourier transform infrared spectroscopy (FT-IR), Brunauer,
Emmett and Teller (BET) specific surface area and porosity
measurements, collagen yield analysis and amino acid
racemization.
The aim of the present study was to assess the state of
bone preservation and to relate it with the survival of DNA.
To do this and gain a general understanding of the degree
of bone tissue preservation, bones collected from several
archaeological sites were selected for the analysis of samples
from different locations (cave, rockshelter or sub divo) and
diachronic periods. The sites were two Italian pre-historic
cave sites/rockshelters, Mora Cavorso in Latium (Early
Neolithic 7319 cal BP) and Romito in Calabria (Late Upper
Ann Hum Biol Downloaded from informahealthcare.com by Tulane University on 09/29/14
Paleolithic 18 000 to 13 000 cal BP) and one Roman Imperial
Age coastal site, the necropolis of Velia in the Salerno area
(2150 to 1750 BP) (Figure 1).
The Mora Cavorso cave is located near Jenne (Rome; 41
87 N and 13 170 E) in the Simbruini Mountains Natural Park
0
at 715 m altitude (Figure 1). The cave exhibits a pre-cave and
lower and upper chambers where numerous human bones,
fauna and archaeological materials have been found (Rolfo
et al., 2012). Radiocarbon dates were obtained on one sample
For personal use only.
recovered in the lower chamber and one in the upper chamber.
The dates (7319 ± 79 cal BP and 7153 ± 119 cal BP, respect-
ively) ascribe the level of human remains and the archaeo-
logical materials to the Early Neolithic (Rolfo et al., 2010).
The Romito Cave (Cosenza, 39 540 N, 15 550 E) is
located in southern Italy, 275 m altitude, 25 km inland from
the Tyrrhenian coast of Calabria in the Lao Valley (Figure 1)
(Colonese et al., 2007). Nine burials were found during
excavations carried out in 1965–1967 and 2000–2007 (Fabbri
et al., 1989; Graziosi 1971; Martini 2002; Martini et al.,
2004). Two were double burials (Romito 1 and 2, Romito 5
and 6) and were found in the rockshelter, directly in front of
the cave entrance, dating back between 13 290 and 12 860 cal
Figure 1. Geographical location of the archaeological sites: (A) Mora
Cavorso Cave, Rome; (B) Romito, Cosenza; (C) Velia, Salerno.
Ann Hum Biol, Early Online: 1–10
BP (Alessio et al., 1966). The five single burials (Romito 3, 4,
7, 8 and 9) were in the cave: Romito 3 and 4 were dated to the
early 14th millennia cal BP and Romito 7 and 8 to the
late 14th millennia cal BP. Romito 9, the oldest burial, is
related to an evolved Epigravettian layer between 18 890
and 18 100 cal BP.
Velia (Salerno, 40 130 N, 15 170 E) (Figure 1) was
an important Imperial Roman port in southern Italy
(Fiammenghi, 2003).
Materials and methods
Samples
Table 1 reports the characteristics of the archaeological
samples. Fragments of long bones were collected with a drill
and properly prepared for subsequent analyses. A modern
control from an individual who died 30 years ago (provided
by the Department of Legal Medicine, Rome University Tor
Vergata) was analysed for comparison.
Collagen quantification, preservation of the inorganic
component and DNA analysis were performed in all the
samples. Two samples from each site were selected for amino
acid racemization analysis. In order to gain more complete
information about bone diagenesis in the pre-historic samples
(eight from Romito, two from Mora Cavorso and two modern
controls), porosimetric analysis (Barrett et al., 1951; Brunauer
et al., 1938; Lowell et al., 2004) was also performed.
Precautions and criteria of authentication for the
study of ancient DNA
Archaeological bone samples contain only small amounts of
DNA that are often damaged. This makes precautions
necessary to minimize the risk of amplifying and typing
modern contaminating DNA molecules. To maximize the
probability of extracting and sequencing authentic DNA from
the ancient bone samples, we complied with the following
criteria (Cooper & Poinar 2000; De Angelis et al., 2013;
Pääbo et al., 2004): the work areas were kept physically
isolated and dedicated only to the study of ancient DNA; the
archaeologists and the laboratory operators were genetically
analysed to detect any source of contamination on the bone
material (Table A2 in the Appendix). Negative control
amplification and extraction was performed; at least two
independent extractions of each sample were performed and
at least two independent amplifications for each investigated
region were carried out on each extract. Because aDNA is
fragmented, small fragments of 100–150 bp were amplified
(list of primers given in Table A1 in the Appendix) so that the
amplification efficiency could be inversely correlated with the
length of amplification. Cloning of amplicons and sequencing
of multiple clones were carried out to detect heterogeneity in
the amplification products due to contamination, DNA
damage or jumping PCR (Hofreiter et al., 2001; Pääbo
et al., 1990). The faunal remains associated with the
archaeological human bone samples were analysed (list of
primers given in Table A1 in the Appendix). The presence of
a faunal DNA template in associated faunal remains is an
essential supporting element and its analysis can also be used
to control for contamination by exogenous human DNA.
 DOI: 10.3109/03014460.2014.954614 Chemical parameters for ancient DNA analysis 3
Table 1. Collagen ratio; inorganic component and DNA analysis results.

DNA molecules/mL DNA molecules/mL DNA 1: present

Lab code % Collagen SF C/P CaCO3 (67 bp) (129 bp) l 0: absent
Velia (Central Italy) Imperial Roman Age
T. 51 13.00 3.23 0.30 53% 56 370 44 450 0.0038 1
T. 70 45.03 3.33 0.55 53% 18 420 12 420 0.0063 1
T. 71 74.74 3.25 0.68 53% 24 870 16 359 0.0067 1
T. 78 28.85 3.90 0.28 53% 0 0 0
T. 85 36.96 3.72 0.36 53% 9 526 6 670 0.0057 1
T. 99 47.28 3.23 0.30 53% 13 645 9 600 0.0057 1
T. 100 63.00 3.18 0.29 53% 25 475 20 560 0.0034 1
T. 102 39.26 3.46 0.34 53% 18 560 9 650 0.010 1
T. 118 43.27 3.38 0.30 53% 96 0 0
T. 119 41.11 3.90 0.23 53% 0 0 0
T. 136 82.50 3.16 0.27 53% 19 400 14 549 0.0046 1
T. 137 80.50 2.87 0.43 53% 23 000 18 560 0.0034 1
T. 140 10.42 3.82 0.26 53% 86 0 0
T. 177 10.75 3.65 0.41 53% 0 0 0
T. 182 59.04 3.30 0.81 43% 13 760 9 580 0.0058 1
T. 203 79.50 3.21 0.21 53% 23 450 18 430 0.0039 1
T. 337 60.00 3.15 0.30 43% 15 870 12 450 0.0039 1
Ann Hum Biol Downloaded from informahealthcare.com by Tulane University on 09/29/14

T. 351 37.66 3.33 0.45 53% 22 450 17 240 0.0043 1

T. 361 39.61 3.66 0.45 53% 131 0 0
T. 362 30.45 3.11 0.39 43% 21 030 16 340 0.0041 1
T. 364 45.00 4.10 0.15 53% 118 0 0
T. 389 20.83 3.85 0.28 53% 0 0 0
T. 392 66.50 3.12 0.38 53% 22 400 17 450 0.0040 1
T. 393 30.85 3.22 0.41 53% 19 450 14 870 0.0043 1
T. 400 66.25 3.32 0.45 53% 20 500 13 340 0.0069 1
T. 401 60.54 2.86 0.72 43% 42 390 32 430 0.0043 1
T. 402 26.44 3.33 0.40 53% 32 840 24 730 0.0046 1
T. 403 69.51 2.99 0.61 43% 21 003 15 324 0.0051 1
For personal use only.

T. 428 67.26 3.31 0.36 53% 32 402 24 650 0.0044 1

T. 429 32.93 3.62 0.42 53% 0 0 0
T. 443 69.51 3.16 0.39 53% 24 090 18 450 0.0043 1
T. 444 56.45 3.28 0.57 53% 18 432 13 750 0.0047 1
T. 449 41.11 3.70 0.37 43% 0 0 0
T. 450 36.29 3.64 0.43 53% 29 183 22 320 0.0043 1
Mora Cavorso (Central Italy) Early Neolithic
10*VI A 35.33 3.21 0.82 43% 5 000 3 670 0.0050 1
SS 5 44.67 3.02 0.49 43% 4 800 3 420 0.0055 1
100 V 34.31 3.08 0.64 43% 8 349 6 140 0.0049 1
67 63.60 2.93 0.77 43% 3 798 2 766 0.0051 1
117 29.44 3.19 0.23 43% 9 893 7 370 0.0047 1
SR 61/4 4.06 4.15 0.10 43% 0 0 0
10 V D 4.77 4.10 0.13 43% 0 0 0
10 V v 55.84 3.08 0.48 43% 1 200 800 0.0065 1
92 B 51.57 2.98 0.52 43% 1 132 787 0.0059 1
92 A 31.98 2.95 0.46 43% 965 660 0.0061 1
Romito (Southern Italy) Upper Paleolithic
1 N/A 4.00 0.41 53% 0 0 0
2 19.35 3.50 0.52 53% 0 0 0
3 41.94 3.27 0.37 53% 1 080 750 0.0059 1
4 16.94 3.52 0.35 53% 1 500 1 050 0.0057 1
5 66.94 3.29 0.76 43% 1 400 980 0.0057 1
6 18.55 3.45 0.40 53% 2 500 1 800 0.0053 1
7 43.55 3.43 0.39 53% 2 700 1 980 0.0050 1
8 100.00 2.95 0.32 53% 1 200 830 0.0059 1
9 36.29 3.30 0.32 53% 942 680 0.0052 1
30 years ago
Modern 100.00 2.77 0.62 53%
Modern deproteinated N/A 3.040 0.33 53%

Real-Time qPCRs (with a probe-based method) were
performed to quantify mtDNA molecules; separate PCRs
targeting different regions of the D-loop were carried out in
order to sequence the products and to further authenticate the
results. Forty-three samples which showed the presence of
amplifiable DNA were sequenced for HVS-I and HVS-II
regions. The DNA quantification results were used to estimate
the probability of a nucleotide being damaged (l) using the
formula proposed by Deagle et al. (2006). This parameter was
then used as a further variable to account for when describing
 4 G. Scorrano et al.
the degree of preservation of the samples. The details of the
chemistry related to the sequencing process of the aDNA
analysis are reported in the Appendix.
Analysis of organic component (% protein)
Collagen extraction followed the modified Longin protocol
(Brown et al., 1988). The values obtained from the ancient
samples were compared with the modern bovine data, where
the collagen yield was assumed to be equal to 100%.
Analysis of inorganic component
Bone powder was mixed with 50 mg of KBr and pressed
into 7-mm diameter pellets with a mini-press. Pellet concen-
tration of bone ranged from 0.4–1.4%. The tablets were
analysed by FT-IR spectroscopy using the instrument param-
eters reported in Surovell and Sitner (2001). For the inorganic
component analyses, absorbance peaks of 565 (v4 PO3 4 ),
Ann Hum Biol Downloaded from informahealthcare.com by Tulane University on 09/29/14
1
605 (v4 PO3 3
4 ), 1035 (v3 PO4 ) and 1415 cm (v3 CO2 3 )
were selected for FT-IR spectroscopy; the valley between
peaks at 565 and 605 cm1, 595 cm1, was also studied to
calculate the splitting factor (SF) (Featherstone et al., 1984;
Lee-Thorp & van der Merwe, 1991; Nielsen-Marsh &
Hedges, 2000). The SF corresponds to a generalized
‘‘degree of hydroxyapatite crystallinity’’. The FT-IR spectra
showed the presence of calcite (CaCO3), a non-apatite
mineral structure, with a peak at 710 cm1, while the peak
For personal use only.
at 1096 cm1 was characteristic of francolite (F-apatite)
(Shemesh 1990). To better understand the degree of bone
preservation, we also calculated the C/P ratio (which is 0.5
in modern bone). The C/P ratio indicates diagenetic loss or
acquisition of carbonate from bone to environment and
conversely.
Preparation of modern deproteinated bone
Modern human bone and modern deproteinated bone were
analysed to assess the extent of diagenetic alteration in the
archaeological bone samples. The modern deproteinated bone
was prepared according to Nielsen-Marsh and Hedges (1999).
Amino acid racemization
In living organisms, all amino acids are present in the
L-enantiomeric form; as soon as the individual dies, the
L-amino acids start to convert to the D-form through
racemization. To test for biochemical preservation as indirect
evidence for DNA survival, we estimated the degree of amino
acid racemization in each sample.
About 5 mg of each sample were dissolved in 2 mL of 6 N
HCl, transferred into a screw-capped tube under a nitrogen
atmosphere and hydrolysed for 5 hours in an oil bath at
100  C. During hydrolysis, the proteins were transformed into
amino acids. The hydrolysed samples were spiked with 50 mg
of D-L norleucine (10 mL of a 5 g/L solution) and 5 mg of D-L
norvaline (10 mL of a 0.5 g/L solution) per 1 mg of weighted
sample and completely evaporated. The residue was dissolved
in 3 mL of 2 N HCl in 2-propanol (Acros Organics, Morris
Plains, NJ) and kept in a screw-capped tube for 1 hour at
90  C. After the solvent was evaporated, the residue was
dissolved in 2 mL of dichloromethane (Baker, HPLC grade,
Ann Hum Biol, Early Online: 1–10
Deventer, the Netherlands) and treated with 0.2 mL of
trifluoroacetic anhydride (Aldrich, Steinheim, Germany) for
1 hour at 60  C. After cooling, the tube was opened and
the solvent evaporated. Derivatization led to the formation
of N-trifluoroacetyl-O-2-propyl esters. The residue was
recovered in 0.2 mL of dichloromethane and used for gas
chromatography-mass spectrometry (GC/MS) injection.
A standard mixture of amino acids (Sigma, St Louis, MO)
in 6 N HCl at a concentration of 100 mg/mL each was
prepared and derivatized with the same procedure as
described above. This was further used as a reference for
gas chromatographic retention times and mass spectra of the
amino-acid derivatives.
Amino acid analysis was carried out on a HP-6890 Series
gas chromatograph coupled to an HP-5973 mass selective
detector (Hewlett-Packard, Palo Alto, CA). Chromatographic
separations were accomplished using a Chirasil-L-Val (25 m
 0.25 mm i.d  0.12 mm d.f.) fused-silica column
(Chrompack Italia, Milan, Italy) according to the following
temperature programme: initial 50  C held for 1 minute, then
increased to 145  C at 4  C/minute, held at 145  C for 1
minute, then increased to 170  C at 10  C/minute and held
at 170  C for 1 minute. The injector was kept at 280  C, while
the helium gas flow was 0.66 mL/min.
The injection (1 mL) was split (split ratio of 20:1). The MS
conditions were as follows: interface temperature ¼ 190  C;
ion source temperature ¼ 240  C; and electron impact ¼70 eV.
The mass spectrometer was operated in selected ion moni-
toring (SIM) mode to tentatively measure the corresponding
D/L ratios. The following target ions were selected: mass/
charge (m/z) 140 for alanine (Ala); m/z 168 for norvaline and
norleucine; m/z 184 for aspartic acid (Asp); and m/z 198 for
glutamic acid (Glu).
Porosity study by nitrogen physisorption
Textural characterization [BET specific surface area as
described by Brunauer et al. (1938), BJH pore size distribu-
tion as described by Barrett et al. (1951) and total pore
volume as described by Lowell and colleagues (2004)] was
obtained from the N2 adsorption-desorption isotherms volu-
metrically determined at 77 kelvins (K) by using an ASAP
2010 analyser (Micromeritics, Norcross, GA).
Before measurement, the sample tube, containing 1 g of
bone powder, was sealed in the degas part of the ASAP 2010
analyser and preheated under vacuum by means of a rotary
vacuum pump (ultimate vacuum 5*103 torr) at 423 K for 2
hours. The sample tube was then transferred to the analysis
part of the apparatus and immersed in a N2 liquid bath. After
calibration with helium (Rivoira, 5.5 IP) of the ‘dead space’ of
the sample tube (i.e. the space inside the sample tube not
occupied by the powder), nitrogen (Rivoira, 5.5 IP) was
introduced into the sample tube and the measurement started.
Statistical analyses
Past software v. 2.08 b (Hammer 2001) was used to analyse
the effect of different ages and different parameters (Kruskal–
Wallis test) and the correlation between organic and inorganic
component preservation. The DNA results were defined as a
dichotomic variable: 0 when endogenous DNA was absent
 DOI: 10.3109/03014460.2014.954614
and 1 when present. The Mann-Whitney test was applied to
study correlations between the presence or absence of
DNA and the state of human bone preservation: organic
and inorganic phases. Logistic regression was also employed
to determine which variables were better associated with
the presence of amplifiable DNA molecules (IBM SPSS
Statistics 19).
Results and discussion
DNA and inorganic component analysis
MtDNA copy number estimates were determined by Real
Time qPCR for each amplicon size (Appendix). qPCR results,
of short fragments (67 bp), showed the presence of DNA with
more than 900 molecules/mL in 39 of 53 samples (denoted as
dichotomic variable 1 in Table 1). Four samples showed 100
molecules/mL and the other 10 samples 0 molecules/mL
(denoted as dichotomic variable 0 in Table 1). The quality of
Ann Hum Biol Downloaded from informahealthcare.com by Tulane University on 09/29/14
the aDNA was highlighted by differences in the amplification
efficiency for the two length fragments, with greater
efficiency for the smaller than the larger fragment
(Table 1). The DNA damage parameter (l), proposed by
Deagle et al. (2006), was also calculated (Table 1). The DNA
damage estimate (l) varied between 0.0034 and 0.010 in the
Velia samples, between 0.0047 and 0.0065 in the Mora
Cavorso samples and between 0.0050–0.0059 in the Romito
samples. The mean fragment size in each sample was
For personal use only.
estimated using the formula: 1/l. The mean amplicon
fragment size was 214 bp for Velia, 185 bp for Mora
Cavorso and 181 bp for Romito. These results indicated that
the aDNA was in good condition, with a probable average
fragment size greater than 150 bp, as proposed by Deagle
et al. (2006). Moreover, when the damage parameter (l) of the
three different sites was compared, the Kruskal-Wallis test
indicated no significant difference among them (H ¼ 4.92;
p ¼ 0.085), suggesting that the environmental conditions
rather than the different ages probably played a key role in
DNA diagenesis. Since the preservation of aDNA is chiefly
influenced by climatic conditions and hot climates in
particular damage aDNA (Bollongino et al., 2008), the
caves’ micro-environments most likely provided the proper
conditions for preserving the aDNA. Complete HVS-I and
HVS-II mtDNA sequences were obtained for 20 samples
(46.51% of the processed sequences); nine consensus
sequences from the Velia site, which were totally confirmed
by cloning, are reported in Table A2 (in the Appendix). No
matches were found between the ancient sequences and those
of either the archaeologists or the laboratory staff (Table A2
in the Appendix).
Table 1 reports the results of FT-IR spectroscopy, collagen
yield analysis and the presence or absence of aDNA in the
ancient samples as compared to the modern bone samples.
For the inorganic component, all samples showed the
presence of francolite (F-apatite), which is the first form of
re-crystallization of hydroxyapatite. Table 1 reports the whole
range of SF (2.86–4.15). The C/P ratio ranged between 0.1–
0.82 (Table 1). The C/P ratio was generally 0.5 and
decreased to 0.1 as degradation increased. Low C/P values
will indicate diagenetic loss of carbonate, possibly during
rearrangement or dissolution of the inorganic phase (Nielsen-
Chemical parameters for ancient DNA analysis 5
Marsh & Hedges 2000); however, the ratio can also rise if a
sample absorbs calcite from the surrounding environment
(Smith et al., 2007). In our analysis, the samples that
presented a peak at 710 cm1, with an amount of CaCO3
43%, had C/P values 40.7. The relationship between SF and
the C/P ratio (r ¼ 0.56; p50.001) implied that variations in
the C/P ratio are a fundamental part of increasing crystallin-
ity. When the SF of the three different sites (Figure 2(a)) was
compared, the Kruskal-Wallis test indicated no significant
difference among them (H ¼ 4.33; p ¼ 0.11). This was
probably due to the climatic conditions. Because Velia is a
sub divo site, the bones were subjected to climate variations
that accelerated inorganic diagenesis. The samples from Mora
Cavorso and some from Romito were recovered from caves
with high humidity but constant temperature, which prevented
thermal shock that could have increased bone diagenesis.
Because SF increases during the diagenesis of bones,
values of 4 could suggest a post-burial growth in crystal size
or selective dissolution of more soluble but less ordered
crystals. In fact, the samples with no amplifiable DNA
showed SF values 43.6 and only two samples, Romito 2 and
T.118 (Velia), had SF values 53.5. When the SF values
between samples showing the presence/absence of aDNA
were compared, the Mann–Whitney test (U ¼ 14;
p ¼ 1.83*107) indicated a significant difference between
amplifiable and non-amplifiable aDNA. This is probably
related to the fact that DNA molecules bind to hydroxyapatite,
protecting the DNA from environmental attack (Sosa et al.,
2013).
DNA and organic component analysis
For the organic component, the amount of collagen was
gravimetrically measured (Table 1). The modern controls had
a range of collagen yield between 0 (for the modern
deproteinated control) and 100% (for the modern control).
The collagen yield values indicated a loss of collagen in
almost all samples, with protein content values 520%,
highlighting strong diagenesis of collagen. However, some
samples (Table 1) with a collagen yield close to 20% showed
good SF values, which could suggest only partial dissolution
of the organic component in spite of the inorganic component.
A statistically significant correlation was found between
collagen yield and SF (r ¼ 0.50; p50.001). This implies that,
as collagenous material is lost from the bone, its re-organiza-
tion within the microstructure affects bone crystallinity
(Hedges & Millard 1995; Nielsen-Marsh & Hedges 2000).
Although the mean collagen percentage was better in the
samples from Velia (Figure 2(b)), the Kruskal–Wallis test
showed no significant differences among the three different
sites (H ¼ 3.22; p ¼ 0.20). This is probably due to the different
environmental conditions of the three sites. Although Velia is
later than the other two, the Mora Cavorso and Romito caves
have almost constant internal temperatures, which might also
have favoured slow degradation not only of the inorganic but
also of the organic component.
The Mann-Whitney test of the collagen ratio values
between samples showing the presence/absence of aDNA
indicated a significant difference between amplifiable and
non-amplifiable aDNA (U ¼ 97; p ¼ 4.00*104). The samples
 6 G. Scorrano et al. Ann Hum Biol, Early Online: 1–10

Figure 2. (a) Mean and standard deviation of

SF results; (b) Mean and standard deviation
of collagen ratio of samples from three burial
sites.
Ann Hum Biol Downloaded from informahealthcare.com by Tulane University on 09/29/14
For personal use only.

with amplifiable DNA showed a range of collagen percentage Table 2. Racemization values: D/L Asp; Ala; Glu enantiomeric ratio of
430%. Only five samples (T.118, T.119, T.361, T.364 and total and of collagen.
T.449) from Velia had collagen values 430% and failed to
yield DNA. Conversely, five samples (T.51, T.402 from Velia, Racemization
117 from Mora Cavorso, Romito 4 and Romito 6) showed Lab code D/L - Ala D/L - Asp D/L - Glu
collagen ratio values 530%, but they yielded aDNA, perhaps T.85
because DNA molecules are trapped by mineralizing collagen Total 0.0048 ± 0.0002 0.0440 ± 0.0020 0.0080 ± 0.0000
fibrils during bone resorption and formation (Sosa et al., Collagen 0.0018 ± 0.0001 0.0225 ± 0.0019 0.0029 ± 0.0006
T.203
2013) and being so packed probably makes them more
Total 0.0032 ± 0.0001 0.0540 ± 0.0020 0.0051 ± 0.0001
resistant to hydrolysis or microbial attack. Collagen 0.0009 ± 0.0002 0.0148 ± 0.0026 0.0011 ± 0.0002
To complete the analysis of the organic component, two SS 5
samples from each site underwent amino acid racemization Total 0.0068 ± 0.0002 0.0520 ± 0.0030 0.0130 ± 0.001
Collagen 0.0036 ± 0.0009 0.0158 ± 0.0011 0.0029 ± 0.0006
analysis. We calculated the rate of racemization in both total 92 B
protein of bone and collagen extract (Table 2) (Verzijl et al., Total 0.0065 ± 0.0004 0.0490 ± 0.0020 0.0110 ± 0.0009
2000). In order to determine the degree of contamination Collagen 0.0014 ± 0.0004 0.0150 ± 0.0009 0.0026 ± 0.0008
from exogenous proteins, three amino acids were studied. 4
Total 0.0075 ± 0.0002 0.0600 ± 0.020 0.0099 ± 0.0001
Their speed of racemization was: D/L Asp 4 D/L Glu 4 D/L Collagen 0.0023 ± 0.0007 0.0220 ± 0.0036 0.0031 ± 0.0009
Ala (Ohtani et al., 2004). 5
Table 2 shows the results of amino acid racemization Total 0.0077 ± 0.0003 0.0900 ± 0.0004 0.0130 ± 0.0008
(AAR) analysis of total protein and collagen extract. For the Collagen 0.0017 ± 0.0003 0.0260 ± 0.0077 0.0022 ± 0.0004
total protein AAR analysis, the speed of the three amino acids
was adequate, demonstrating that bone decontamination was
successful. The D/L Asp values were 50.1 (Poinar et al., preserved bone collagenous protein (Sosa et al., 2013).
1996) for all samples and on both analyses (total protein and Contrary to our hypothesis and the literature data (Sosa
collagen extract) (Table 2). et al., 2013), we observed no correlation between the collagen
Only SS 5 from Mora Cavorso had a higher D/L ratio for Ala ratio and AAR (p40.05), probably due to the scarcity of the
than for Glu on collagen extract analysis; this could be taken as samples.
evidence for contamination by more recent amino acids. The Considering both the organic (ratio of collagen) and
AAR analysis in both studies was in agreement with well- inorganic (SF) phases, logistic regression was also calculated
 DOI: 10.3109/03014460.2014.954614
Table 3. Textural analysis.
BET specific area Pore volume
Lab code (m2/g) (mL/g)
Modern 1 0.0048
SS 5 54 0.12
92 B 38 0.098
2 42 0.16
3 49 0.17
4 66 0.15
5 55 0.11
6 27 0.076
9 65 0.17
Modern deproteinated 145 0.37
to determine which parameters were associated with the
presence of DNA. The model based on the SF and the
collagen percentage was statistically significant (p ¼ 0.004).
Our data seem to suggest that, of the two variables, the SF is
Ann Hum Biol Downloaded from informahealthcare.com by Tulane University on 09/29/14
inversely associated with the presence of DNA (r ¼ 0.79)
with respect to collagen yields (r ¼ 0.52).
Porosity
Pre-historic samples were chosen for porosity analysis in
order to better describe the state of preservation in these
bones. Bone porosity, as measured by nitrogen adsorption, is a
useful indicator of the state of bone preservation.
Modern bone is reported to contain 12% porosity, mainly
For personal use only.
contained in micropores (Nielsen-Marsh et al., 2000b). The
modern sample exhibited a volume per gram of pores as low
as 0.0048 mLg1 and a BET surface area of 1 m2/g (Table 3).
For the archaeological bones, textural analysis based on
nitrogen adsorption revealed alterations in the micropores,
defined as a pore diameter ranging between 0.01–0.1 mm
according to Turner-Walker et al. (2002).
Table 3 reports the textural parameters (BET total surface
area and pore volume) of the bone samples from Mora
Cavorso and Romito as compared with the modern and the
modern deproteinated controls. As compared with the modern
untreated sample, the bone without proteins showed a sharp
increase in both surface and pore volume, 145 m2/g and
0.37 mL/g, respectively. In the deproteinated bone, the
porosity increased because the whole bone matrix, especially
the organic component, was completely destroyed by the
hydrazine hydrate treatment responsible for the conversion of
micropores in macropores. In contrast, the archaeological
samples showed intermediate porosity values between those
obtained for the modern and the modern deproteinated
controls (Table 3). This could indicate a suitable degree of
preservation of bone tissue in both sites, which appears to be
unrelated to the age of the sample.
Porosity data should reflect the degree of diagenetic
alteration, irrespective of protein content (% collagen) and SF,
because porosity should depend on both the organic and
inorganic preservation of bone tissue (Nielsen-Marsh &
Hedges 1999). Unexpectedly, we observed only a negative
correlation between porosity and the percentage of collagen:
BET/ratio of collagen (r ¼ 0.67; p ¼ 0.035) and pore
volume/ratio of collagen (r ¼ 0.73; p ¼ 0.016). No correl-
ation was found between porosity and SF (p40.05), probably
due to the scarcity of samples.
Chemical parameters for ancient DNA analysis 7
Figure 3. Pore size distribution of the ancient samples and the modern
controls, expressed as the variation of cumulative pore volume (V) as a
function of pore diameter (D).
The extent of diagenetic alteration can influence the shift
of pore size distribution to larger pores (Hedges & Millard,
1995; Nielsen-Marsh, 1997). Because large pores in archaeo-
logical bone are much more susceptible to the action of water
and micro-organisms, accelerating mineral dissolution and
collagen degradation, we assessed the pore size distribution
(BJH method) of the samples (Figure 3). The effect of
deproteination on modern bone is striking when compared
with the literature (Smith et al., 2007). As regards the porosity
range determined by nitrogen adsorption, all the pre-historic
samples showed intermediate values between the modern and
the modern deproteinated controls, suggesting a proper state
of preservation. The 92 B (Mora Cavorso) and 6 (Romito)
bone samples showed the same pore size distribution and the
best state of preservation.
Conclusion
Several studies on different parameters of bone preservation
have been carried out to understand the diagenetic process
(Hedges & Millard 1995; Nielsen-Marsh 1997; Nielsen-
Marsh & Hedges 1999). To date, few have correlated bone
preservation with the presence of DNA and only Sosa et al.
(2013) described the relationship between the preservation of
the organic/inorganic component and DNA survival in ancient
samples. The study of aDNA is limited by DNA degradation
and contamination by contemporary exogenous DNA in
almost all ancient remains. Therefore, we tried to obtain a
clearer picture of the relationships between the state of human
bone preservation and the presence of aDNA. On this basis,
we propose an approach to selecting ancient bone samples
suitable for aDNA analysis.
We employed several multidisciplinary methods to
describe the natural diagenetic states of bone preservation
observed in bone tissue samples from several different
archaeological sites. The archaeological bone samples were
found to contain both well-preserved organic and inorganic
components and to yield amplifiable DNA. Moreover, our
data show that the SF is the parameter best associated with the
 8 G. Scorrano et al.
presence of DNA. Therefore, since SF calculation is rapid,
inexpensive and requires a small quantity of sample, its
evaluation constitutes an efficient step to take before
proceeding with time-consuming and costly aDNA analyses.
Declaration of interest
The authors report no conflicts of interest. The authors alone are
responsible for the content and writing of this article.
This study was partially supported by MIUR-PRIN: Grant number
2010EL8TXP_001 allotted to O.R. We wish to thank Kenneth Britsch for
his assistance with the English revision of the manuscript.
References
Alessio M, Bella F, Cortesi C. 1966. University of Rome Carbon-14
Dates, IV. Radiocarbon 8:404–405.
Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM,
Howell N. 1999. Reanalysis and revision of the Cambridge reference
Ann Hum Biol Downloaded from informahealthcare.com by Tulane University on 09/29/14
sequence for human mitochondrial DNA. Nat Genet 23:147.
Bada JL, Wang XS, Poinar HN, Pääbo S, Poinar GO. 1994. Amino acid
racemization in amber-entombed insects: implications for DNA
preservation. Geochimi Cosmochim Ac 58:3131–3135.
Barrett EP, Joyner LG, Halenda PH. 1951. The determination of pore
volume and area distributions in porous substances. I. Computations
from nitrogen isotherms. J Am Chem Soc 73:373–380.
Bollongino R, Tresset A, Vigne J-D. 2008. Environment and
excavation: Pre-lab impacts on ancient DNA analyses. CR Paleovol
7:91–98.
Brown TA, Nelson DE, Vogel JS, Southon JR. 1988. Improved collagen
extraction by modified Longin method. Radiocarbon 30:171–177.
For personal use only.
Brunauer S, Emmett PH, Teller E. 1938. Adsorption of gases in
multimolecular layers. J Am Chem Soc 60:309–319.
Cai DW, Han L, Zhang XL, Zhou H, Zhu H. 2007. DNA analysis of
archaeological sheep remains from China. J Archaeol Sci 34:
1347–1355.
Collins MJ, Penkman KE, Rohland N, Shapiro B, Dobberstein RC, Ritz-
Timme S, Hofreiter M. 2009. Is amino acid racemization a useful tool
for screening for ancient DNA in bone? Proc R Soc Biol Sci 276:
2971–2977.
Colonese AC, Zanchetta G, Fallick AE, Martini F, Manganelli G, Lo
Vetro D. 2007. Stable isotope composition of late glacial land snail
shells from Grotta del Romito (Southern Italy): Palaeoclimatic
implications. Palaeogeogr Palaeocl 254:550–560.
Cooper A, Poinar HN. 2000. Ancient DNA: do it right or not at all.
Science 289:1139.
De Angelis F, Scorrano G, Rickards O. 2013. DNA antico: principi e
metodologie. Med Secoli 25:51–83.
Deagle BE, Eveson JP, Jarman S. 2006. Quantification of damage in
DNA recovered from highly degraded samples-a case study on DNA
in faeces. Front Zool 3:11.
Fabbri PF, Graziosi P, Guerri M, Mallegni F. 1989. Les hommes des
sépoltures de la grotte du Romito à Papsidero (Cosenza, Italie).
In: Giacobini G, editor. Hominidae: Proceedings of the 2nd
International Congress of Human Paleontology. Milano: Jaca book.
p 487–494.
Featherstone JD, Pearson S, LeGeros RZ. 1984. An infrared method for
quantification of carbonate in carbonated apatites. Caries Res 8:
63–66.
Fiammenghi CA. 2003. La Necropoli di Elea-Velia: qualche osserva-
zione preliminare. Pozzuoli: Naus.
Graziosi P. 1971. Derniéres découvertes de gravures paléolithiques dans
la grotte du Romito en Calabre. In: École Pratique des Hautes Études,
Vie Section, Centre de Recherches Historiques, editor. Mélanges
offerts à André Varagnac. Paris: Sevpen. p 355–357.
Hammer M. 2001. The superefficient company. Harvard Busi Rev 79:
82–91.
Hedges REM, Millard AR. 1995. Bones and groundwater—
towards the modeling of diagenetic processes. J Archaeol Sci 22:
155–164.
Hofreiter M, Jenicke V, Serre D, von Haeseler A, Pääbo S. 2001. DNA
sequences from multiple amplifications reveal artifacts induced by
Ann Hum Biol, Early Online: 1–10
cytosine deamination in ancient DNA. Nucleic Acids Res 23:
4793–4799.
Lee-Thorp JA, van der Merwe NJ. 1991. Aspects of the
chemistry of modern and fossil biological apatites. J Archaeol Sci
18:343–354.
Loreille O, Vigne JD, Hardy C, Callou C, Treinen-Claustre F,
Dennebouy N, Monnerot M. 1997. First distinction of sheep and
goat archaeological bones by the means of their fossil mtDNA.
J Archaeol Sci 24:33–37.
Lowell S, Shields JE, Thomas MA, Thommes M. 2004. Characterization
of porous solids and powders: surface area, pore size and density, vol.
16. New York: Springer.
Martini F, Bisconti M, Casciarri S, Fabbri PF, Leonini V, Lo Vetro D,
Mallegni F, et al. 2004. La nuova sepoltura epigravettiana ‘Romito 7’
a Papasidero. In: I.I.P.P., editor. Atti della XXXVII Riunione
Scientifica I.I.P.P., ‘Preistoria e Protostoria della Calabria’. Firenze:
Istituto Italiano di Preistoria e Protostoria. p 101–111.
Martini F. 2002. Grotta del Romito. Firenze: Museo e Istituto Fiorentino
di Preistoria.
Nielsen-Marsh CM, Gernaey A, Turner-Walker G, Hedges REM, Pike
A, Collins MJ. 2000b. The chemical degradation of bone. In: Cox M,
Mays S, editors. Human osteology in Archaeology and Forensic
Science. Cambridge: Cambridge University Press. p 439–455.
Nielsen-Marsh CM, Hedges REM, Mann T, Collins MJ. 2000a.
A preliminary investigation of the application of differential scanning
calorimetry to the study of collagen degradation in archaeological
bone. Thermochim Acta 365:129–139.
Nielsen-Marsh CM, Hedges REM. 1999. Bone porosity and the use of
mercury intrusion porosimetry in bone diagenesis studies.
Archaeometry 41:165–174.
Nielsen-Marsh CM, Hedges REM. 2000. Patterns of diagenesis in bone
I: The effects of site environments. J Archaeol Sci 27:1139–1150.
Nielsen-Marsh CM. 1997. Studies in archaeological bone diagenesis.
Oxford: University of Oxford.
Ohtani S, Yamada Y, Yamamoto T, Arany S, Gonmori K, Yoshioka N.
2004. Comparison of age estimated from degree of racemization of
aspartic acid, glutamic acid and alanine in the femur. J Forensic Sci
49:441–445.
Okazaki M, Yoshida Y, Yamaguchi S, Kaneno M, Elliott JC. 2001.
Affinity binding phenomena of DNA onto apatite crystals.
Biomaterials 22:2459–2464.
Pääbo S, Irwin D, Wilson A. 1990. DNA damage promotes jumping
between templates during enzymatic amplification. J Biol Chem 265:
4718–4721.
Pääbo S, Poinar H, Serre D, Jaenicke-Despres V, Hebler J, Rohland N,
Kuch M, et al. 2004. Genetic analyses from ancient DNA. Annu Rev
Genet 38:645–679.
Paget E, Monrozier LJ, Simonet P. 1992. Adsorption of DNA on clay-
minerals—Protection against Dnasei and influence on gene-transfer.
FEMS Microbiol Lett 97:31–39.
Poinar HN, Hoss M, Bada JL, Pääbo S. 1996. Amino acid racemization
and the preservation of ancient DNA. Science 272:864–866.
Reiche I, Favre-Quattropani L, Vignaud C, Bocherens H, Charlet L,
Menu M. 2003. A multi-analytical study of bone diagenesis: the
Neolithic site of Bercy (Paris, France). Measurement Sci Technol 14:
1608–1619.
Rolfo MF, Lelli R, Martı́nez-Labarga C, Passacantando D, Scorrano G,
Salari L, Rickards O. 2012. La comunità neolitica di grotta Mora
Cavorso a Jenne (Rm): osservazioni deposizionali, paleobiologiche e
faunistiche. In: Negroni Catacchio, N, editor. Preistoria e Protostoria
in Etruria. Decimo incontro di studi. L’Etruria dal Paleolitico al Primo
Ferro: lo stato delle ricerche. Milano: Centro Studi di Preistoria e
Archeologia. p 131–145.
Rolfo MF, Mancini D, Salari L, Zarattini A. 2010. La grotta di ‘Mora
Cavorso’ a Jenne (Roma). Nuove ricerche. In: Ghini G, editor. Atti del
VI incontro di studi ‘Lazio e Sabina’. Roma: Quasar. p 11–17.
Shemesh A. 1990. Crystallinity and diagenesis of sedimentary apatites.
Geochimi Cosmochim Ac 54:2433–2438.
Smith CI, Nielsen-Marsh CM, Jans MME, Collins MJ. 2007. Bone
diagenesis in the European Holocene I: patterns and mechanisms.
J Archaeol Sci 34:1485–1493.
Sosa C, Vispe E, Nunez C, Baeta M, Casalod Y, Bolea M, Hedges RE,
Martinez-Jarreta B. 2013. Association between ancient bone preser-
vation and dna yield: a multidisciplinary approach. Am J Phys
Anthropol 151:102–109.
 DOI: 10.3109/03014460.2014.954614
Surovell TA, Sitner MC. 2001. Standardizing infra-red measures of bone
mineral crystallinity: An experimental approach. J Archaeol Sci 28:
633–642.
Turner-Walker G, Nielsen-Marsh CM, Syversen U, Kars H, Collins MJ.
2002. Sub-micron spongiform porosity is the major ultra-structural
alteration occurring in archaeological bone. Int J Osteoarchaeol 12:
407–414.
Appendix: Ancient DNA protocols applied in the
present work
Extraction and analysis of ancient DNA were carried out at the
aDNA Laboratory, Departmental Center of Molecular Anthropology
for Ancient DNA Studies, University of Rome, Tor Vergata, in
Villa Mondragone, Monte Porzio Catone, Rome (http://www2.bio.
uniroma2.it/biologia/laboratori/lab-antropologia/DNAntico/DNA_
antico/Facilities.htm). The laboratory has state-of-the-art facilities for
aDNA studies, including a contamination-resistant facility, maintained at
positive pressure, UV-irradiated and HEPA-filtered, with restricted
Ann Hum Biol Downloaded from informahealthcare.com by Tulane University on 09/29/14
access to minimize potential contamination with extant human DNA.
Ancient DNA extraction
To maximize the potential for success and minimize the potential for
inhibition/contamination, a silica-based approach was used (Yang et al.,
1998). This method has the advantage that it is more specific for DNA
and less likely to co-purify PCR inhibitors. However, since silica
particles are powerful PCR inhibitors, care must be taken to ensure that
the final extract is free of residual silica particles. DNA was extracted
using a QIAquickÔ PCR Purification kit (Qiagen). The kit provides spin
For personal use only.
columns, buffers and collection tubes for silica-membrane-based puri-
fication of PCR products from 100 bp to 10 kb. This protocol is ideally
suited for aDNA samples analysis since the DNA templates are highly
degraded and the target regions for amplification are generally quite
small (100–250 bp).
Extraction was performed on ancient bones. The procedure was
divided into four different steps as follows. After pre-treatment with
sterile surgical blades and overnight UV irradiation to remove potential
contaminants on the outer surface of the bone samples, &500 mg of
bone was pulverized using a mortar and pestle. Lysis and digestion: 2 mL
of extraction buffer (0.5 M EDTA pH 8, 10% SDS and 20 mg/mL
proteinase K) were added to the powder. The solution was incubated in a
shaking water bath at 55  C overnight and then at 37  C for 24 hours.
DNA extraction: the extraction solution was centrifuged for 15 minutes
at 4000 rpm and the supernatant was transferred to a new 50 mL FalconÕ
tube. Five volumes of PB (QIAquickÔ PCR purification kit, Qiagen,
containing guanidine hydrocloride and isopropanol) were added to the
solution. The solution was filtered using a QIAquickÔ column by
centrifugation at 12 800 rpm for 2 minutes until the entire volume was
filtered. The DNA entrapped in the filter was washed by adding 750 mL
PE (QIAquickÔ PCR purification kit, containing ethanol) and
centrifuged at 12 800 rpm for 2 minutes. Then, 100 mL of TE buffer
(QIAquickÔ PCR purification kit, containing 10 mM Tris-Cl, 1 mM
EDTA, pH 8.0) were added into the filter tube to elute the DNA and the
DNA solution was centrifuged at 12 800 rpm for 2 min.
DNA quantification
The number of molecules of mitochondrial DNA (mtDNA) was
quantified using a 7500 Fast real-time PCR System (Applied
Biosystems). Two different fragment lengths were amplified from the
HVS-I: the shorter 67 bp delimited by primers F16453 (50 CCGGGCCC
ATAACACTTG 30 ) and R16497 (50 ACCCTGAAGTAGGAACCAGAT
GT 30 ) and the longer 129 bp delimited by primers F16453 and R16560
(50 AGACCTGTGATCCATCGTGATG 30 ). All quantitative PCR
(qPCR) assays were carried out in a 25 mL reaction volume containing
12.5 mL TaqManÕ (Applied Biosystems), 0.5 mL Probe (6-FAM-
TAGCTAAAGTGAACTGTATCC-MGB, Applied Biosystems), for-
ward and reverse primers (100 mM), 2.5 mL of DNA extract and
ddH2O up to 25 mL. Thermocycling conditions were initial enzyme
Chemical parameters for ancient DNA analysis 9
Verzijl N, DeGroot J, Thorpe SR, Bank RA, Shaw JN, Lyons TJ, et al.
2000. Effect of collagen turnover on the accumulation of advanced
glycation end products. J Biol Chem 275:39027–39031.
Yang DY, Eng B, Waye JS, Dudar JC, Saunders SR. 1998.
Technical Note: Improved DNA extraction from ancient
bones using silica-based spin columns. Am J Phys Antrhopol 105:
539–543.
activation at 95  C for 20 seconds, followed by 40 cycles at 95  C for 3
seconds and 60  C for 30 seconds. The starting quantity of aDNA was
determined by comparing it to a standard curve of a known amount of
modern DNA. Five-fold serial dilutions, from 270 to 2.70*106
molecules/mL, for the two modern DNA fragments, were used to make
the standards.
mtDNA amplification and sequencing
The hypervariable regions HVS-I and HVS-II (each &400 bp long) of
the control region D-loops of the mtDNA were sequenced through short
(80–140 bp) and overlapping fragments. Enzymatic amplification of
these traits was performed using a PCR assay. The reaction mixture
contained: DNA template 2–3 mL, 1X PCR Gold Buffer (Applied
Biosystems), 2.5 mM MgCl2 (Applied Biosystems), 1 mM dNTPs
(Invitrogen), 80 nM Primers L (Eurofins MWC Operons), 80 nM
Primers H (Eurofins MWC Operons), 0.1 mg/mL BSA (New England
BioLabs Inc.), 1 U AmpliTaq Gold (Applied Biosystems), ddH2O up
to 25 mL.
Cycle conditions were initial denaturation at 94  C for 15 minutes,
38–55 cycles of 30 seconds at 92–94  C, 30 seconds at 53–58  C and 30
seconds at 72  C, followed by a final extension at 72  C for 10 minutes.
Table A1 lists the primers covering the HVS-I and HVS-II regions.
PCR products were visualized by electrophoresis on 1.5% agarose gel
stained with GelStar (Cambrex, Rockland, ME). Positive amplification
products were purified with ExoSAP-IT (USB Affymetrix).
Dye labelling was performed with both forward and reverse primers
(used for the amplification fragments; Table A1) to obtain overlapped
sequences of both strands using Big Dye Terminator chemistry (v1.1,
Applied Biosystems) following the manufacturer’s procedure. Cycle
conditions provide 25 cycles at 96  C for 10 seconds, at 50  C for 5
seconds and at 64  C for 4 minutes. The products were purified
using CENTRI-SEP Columns (Princeton separations) and/or standard
ethanol precipitation technique and submitted to capillary electrophor-
esis on an ABI Prism 3130 Avant (Applied Biosystems). The results of
some of the ancient samples are shown in Table A2.
PCR product cloning
All samples were cloned. Cloning was performed by using a TOPO TA
cloning kit (Invitrogen, Carlsbad, CA) according to the supplier’s
protocol. Selected colonies of the positive transformants were individu-
ally suspended in 20 mL of the PCR product and then analysed
and sequenced. At least 15 clones corresponding to each amplified
region were sequenced to obtain a statistically significant consensus
sequence.
DNA analysis in faunal remains
To authenticate the results, sheep faunal remains were analysed.
Cytochrome B (Loreille et al., 1997) and D-loop (Cai et al., 2007) of
mtDNA were analysed.
The reaction mixture contained: DNA template 2–3 mL, 1X PCR
Gold Buffer (Applied Biosystems), 2.5 mM MgCl2 (Applied
Biosystems), 1 mM dNTPs (Invitrogen), 80 nM Primers L (Eurofins
MWC Operons), 80 nM Primers H (Eurofins MWC Operons), 0.1 mg/
mL BSA (New England BioLabs Inc.), 1 U AmpliTaq Gold (Applied
Biosystems), ddH2O up to 25 mL.
For L15496 and H15661, the cycle conditions were initial denatur-
ation at 94  C for 15 minutes, 38–55 cycles at 92–94  C for 30 seconds,
at 53  C for 30 seconds and at 72  C for 30 seconds, followed by a final
 10 G. Scorrano et al. Ann Hum Biol, Early Online: 1–10

Table A1. Primers for amplification reactions of HVS-I and HVS-II of mtDNA in human samples and faunal remains.

Region Primer forward (L) Primer reverse (H)

Human
HVS-I L15996 CGAAGCTTCTCCACCATTAGCACCCAAAG H16139 TACTACAGGTGGTCAAGTAT
L16055 GAAGCAGATTTGGGTACCAC H16164 TTTGATGTGGATTGGGTTT
L16131 CACCATGAATATTGTACGGT H16218 TGTGTGATAGTTGAGGGTTG
L16159 TACTTGACCACCTGTAGTAC H16236 CTTTGGAGTTGCAGTTGATG
L16209 CCCCATGCTTACAAGCAAGT H16271 GGTTTTGATGTGGATTGGGT
L16287 CACTAGGATACCAACAAACC H16331 TTGACTGTAATGTGCTATGT
H16379 CAAGGGACCCCTATCTGAGG
H16401 GCGGGATATTGATTTCACGG
HVS-II L29 CCGAAGCTTGGTCTATCACCCTATTAACCAC H108 GATACTGCGACATAGGGTGCT
L48 CTCACGGGAGCTCTCCATGC H170 GTTCGCCTGTAATATTGAACG
L100 ATAGCATTGCGAGACGCTG H285 GGTTTGGTGGAAATTTTTGT
L172 CTGGCCACAGCACTTAAACAC H389 CTGGTTAGGCTGGTGTTAGG
L261 ACAATTGAATGTCTGCACAGC H408 GGCCTCGAGCTGTTAAAAGTGCATACCGCCA
Faunal
D-loop L15496 TTAAACTTGCTAAAACTCCCA H15661 AATGTTATGTACTCGCTTAGCA
Cyt b L15690 CACATCTAAACAACGAAGCAT H15784 CTAGTTGTCCAATAATAATGTAG
Ann Hum Biol Downloaded from informahealthcare.com by Tulane University on 09/29/14

Table A2 mtDNA sequences of archaeologists, laboratory staff and some samples from the Velia site. mtDNA positions were numbered according to
the rCRS (Andrews et al., 1999).

Samples HVS-I sequence HVS-II sequence

Archaeologists and laboratory staff
1 16126C; 16153A; 16294T; 16296T 73G; 150T; 199C; 263G
2 CRS 152C; 263G
3 16183G, 16189C; 16215G; 16223T; 16278T; 16295T; 16365T 73G; 153G; 195C; 225A; 226C; 263G
4 16129A; 16182C; 16183C; 16189C; 16223T; 16249C; 16359C; 16362C 73G; 195C; 204C
For personal use only.

5 16192T; 16239T; 16256T; 16270T; 16291T; 16385G 73G; 263G

6 16193T; 16224C; 16311C 73G; 263G
7 16336A 263G
Sample analysed
Velia a CRS 263G
Velia b CRS 263G
Velia c 16093C; 16224C; 16311C 73G; 152C; 263G
Velia d 16126C; 16289G; 16294T; 16296T 73G; 263G
Velia e 16126C; 16294T; 16296T 73G; 263G
Velia f 16145A; 16176G; 16223T; 16367G 73G; 152C; 263G
Velia g 16252G; 16336A; 16390A 73G; 263G
Velia h 16069T; 16126C; 16261T 73G; 263G
Velia i 16129A 263G

extension at 72  C for 10 minutes. For the cytochrome B fragment Since the animal bones yielded the expected sequences (sheep DNA
(L15690 and H15784), the cycle conditions were 38–55 cycles at from sheep bone), it is reasonable to expect that the human DNA is
92–94  C for 30 seconds, at 55  C for 1 minute and at 72  C similarly preserved in human bones from the same site rather than
for 10 seconds. Table A1 lists the primers used for each fragment derived from contamination.
analysed.