Sei sulla pagina 1di 391

Antonella Ronchi, GENETICA II per Sc.

Biologiche Modalit di esame: orale


Testi utilizzati

aa. 2008-2009

alberts

orario
Martedi: 8.30 -10.30 Mercoledi: 10.30 -12.30 Venerdi: 8.30 -10.30 U3-04 U3-01 U3-05

Programma: *come si studia un gene: come si definisce la struttura di un gene come si studiano le sequenze regolative di un gene che cosa un gene??? come si studia la funzione di un gene
* micro RNA: struttura e funzione * elementi trasponibili: struttura e funzione

*mutazione e riparazione del DNA: principi di base * retrovirus *genetica dei tumori *genetica dello sviluppo in drosophila *genetica delle immunoglobuline

Come si isola un gene e se ne definisce la struttura? (librerie, clonaggio) Come si puo studiarne lespressione (cellule, sviluppo)? regolative) Come si puo studiarne la funzione? (studio seq.

Overespressione / silenziamento

COSTRUZIONE DI UNA BANCA GENOMICA DI DNA :

..come si isola un gene

Si puo partire da: - DNA totale

collezione di cloni contenenti almeno una copia di ogni sequenza contenuta nel genoma di un dato organismo - singoli cromosomi di un organismo, linea cellulare.. 1) generazione frammenti di DNA -digestione enzimatica totale o parziale -rottura meccanica (sonicazione) 2) loro clonaggio in vettori appropriati (plasmidi, fagi, cosmidi, yac) 3) amplificazione in organismi ospiti (batteri, lieviti) 4) identificazione dellinserto di interesse (screening della libreria) 5) caratterizzazione dellinserto 6) ricostruzione della struttura del gene 7) studio funzionale

Isolamento e studio gene di interesse

genoma umano 3x 109 bp


CTTGTATATATTTTACATAAATACACATAGTGCATGCATATCTATAGAATAGATTCATATATTGATTGATATA TGTAATGCCAAGTATTAGATATGTTTGGGCTCAATAAAAGATGACAATACTGGCTATTACATGGAGTAAGAAT TGAAATGATTTTTTTTTGTTTTGTTTTGTTTTAGGGTCTCTCTATTTAGAATTGCTTGTCTTGTAACTCACTAT GTAGACCAGGCTGTCCTCAGAAATCTGTCTGCCTCTGCCTCCTAAGTGCTAGATCTAGAATGTTTTAATGTTGTG CGTGTTTAACTGCCTGTGAGGTATATATGCCACAGAGCCATAGATCCCTATCCATTCTAGCGTTCATTTGAACTC ACTTTAACAGTTCCTTTGTGCGGTTCTAACATATTTGTGATGGGCTGGCTTTGAAAACTTTCTCGCCCTATCTCC ACACCCAGTACCTCAATCATAATTGAACTCATAGTTTACTTTCTTGAGATCTTAAGGGCAGCCTAATGTTTGTC ACCAAAATATGCGGACTATAGCTATAATCTGAAAACCCCTTTTTTCTTTGGCAGAGAACATTGTAAAAGGCAA GGAAAAATAAGCTTAAAATTAAAAACTTTGCTTTGGTTAAAATAAACTCTATGGGCATGCATATGACTGGTGC ACTAATAGCTTAGGGAAGTCAGAGTCTCAAAGGAAATATTATTAACGTGAGAAGGTGTTTTATTGATTAAAG GAGATTTTTCCTCTCGCAAACACTCATGGAGATAGTGTTCCTATTACTTCTCTCTCGGTGTTGGCTTTTACACAG AAGTTCATTAACATGTGGATATGTGGTGATTGAAGTCAGACCGCTTTTCACAGTGGAGCTGTCTTGATATAAT GAGCTCCTCTTTAATGTTCAAAAATTGTTGTTACTTTCTAAAAGGGGTTGTTTGTGAATTTCATTAAATTTAA TCTCCTCTT

TIPI DI LIBRERIA Libreria genomica: tutto il DNA (seq. codificanti, non codificanti, promotori, introni, seq intergeniche). Libreria cDNA: sequenze codificanti (si parte dallmRNA) Dato che tipi cellulari diversi esprimono geni diversi, la composizione della libreria di cDNA riflette la diversa abbondanza dei trascritti nei tessuti di partenza

Banche da tessuti diversi e/o a stadi di sviluppo diversi contengono cloni diversi e/o in proporzioni diverse

Banche di cDNA:

-clonaggio -espressione

LIBRERIE GENOMICHE
3 metodi di preparazione: 1. Digestione completa (tutti i siti di restrizione per un dato enzima)

*Produce un gran numero di piccoli frammenti diDNA. *Geni contenenti due o pi siti di restrizione per lenzima utilizzato possono essere spezzati e clonati in due o pi pezzi Si usano enzimi che riconoscono siti poco frequenti nel genoma 2 Digestione parziale *Si usano enzimi che tagliano poco frequentementee si riduce il tempo di digestione insieme di lunghi frammenti sovrapponibili 3 Rottura meccanica *Si possono produrre frammenti di DNA pi lunghi *Le estremit non sono uniformi, e occorre una modificazione enzimatica per poter inserire i frammenti generati in un vettore di clonaggio

Come si costruisce una libreria?


-Isolare DNA da un organismo (estrazione di DNA)

-Tagliare DNA per ottenere frammenti della misura desiderata -con enzimi di restrizione -rottura fisica

-Inserire i pezzi di DNA in un vettore di clonaggio (che ne permette la replicazione in un organismo ospite (ex. Batteri)

..per tagliare un DNA:

Enzimi di restrizione: endonucleasi batteriche che riconoscono specifiche sequenze chiamate siti di restrizione e tagliano il DNA idrolizzando il legame fosfodiesterico. La nomencaltura tipicamente inizia con 3 lettere corsive tratte dal nome del batterio. EcoRI HindIII BamHI E. coli RY13 Haemophilus influenzae Rd Bacillus amyloliquefaciens H

Alcuni enzimi generano estremit piatte, altri generano estremit coesive

Molti siti di restrizione sono palindromi di 4-, 6-, o 8-coppie di basi. Maggiore la lunghezza del sito riconosciuto dallenzima di restrizione, minore la probabilit di trovare nel genoma siti riconosciuti da quellenzima

Estremit di DNA ottenute dal taglio possono essere riligate (se compatibili) utilizzando lenzima DNA Ligasi molecola di DNA ricombinante

Vettori di Clonaggio
molecole piccole e di sequenza nota replicazione indipendente dalla cellula ospite (p.es. resistenza a antibiotici)

marcatori che permettano il riconoscimento della cellula trasformata presenti in pi copie per cellula: * alto numero di copie

* basso numero di copie

-Plasmidi -Fago -Cosmidi -Yeast artificial chromosomes (YACs) -Bacterial artificial chromosomes (BACs)

Differenza sostanziale: LUNGHEZZA DELL INSERTO CHE POSSONO OSPITARE

Vettori PLASMIDICI

trasformazione in batteri
ORIGINE DI REPLICAZIONE per moltiplicazione nei batteri

MARCATORE DI SELEZIONE (resistenza antibiotico)

SITO DI CLONAGGIO multiplo -MCS-

SELEZIONE COLORE: - se non c inserto, il gene intatto LacZ in grado di metabolizzare Un substrato COLONIE BLU -Se c INSERTO, il gene LacZ interrotto colonie bianche

con inserti diversi

senza inserto

con inserti diversi

Fago lambda

virus batteriofago che puo dare : -ciclo litico (infezione e lisi della cellula batterica con rilascio di nuove particelle fagiche) -ciclo lisogenico (integrazione nel genoma del fago nel DNA della cellula ospite)

I geni che controllano il ciclo lisogenico possono essere rimossi (non essenziali) e sostituiti con linserto di interesse

lambda puo essere utilizzato come vettore

Dimensione media dellinserto clonabile= lunghezza della regione genica rimossa =

15kb circa

ciclo lisogenico

ciclo litico

Estremit laterali: sequenze COS riconosciute dal sistema di impaccamento nel capside
placche di lisi

Inserti molto maggiori o inferiori di 15kb non si clonano perch il sistema di impaccamento nel capside riconosce solo molecole lunghe piu o meno come il DNA di lambda wt

Cosmidi
1. 2. 3. 4. 5. Caratteristiche congiunte di plasmidi e fagi Non presente in natura Sequenza origine (ori) per E. coli. Marcatore selezionabile, e.g. ampR. Siti di restrizione per clonggio.

6.

Siti COS del fago per permettere limpacchettamento nei capsidi fagici di e quindi linfezione di E. coli

Permettono il clonaggio di inserti di 37-52 kb

YAC Cromosomi artificiali del lievito (Yeast Artificial Chromosomes):

caratteristiche: 1. 2. 3. 4. 5. 6. Telomeri di lievito alle estremit. Sequenza centromerica del lievito (cen) Marcatore selezionabile (dipendenza aminoacidica, URA, TRP,etc.) su entrambe le braccia. Sequenza di replicazione autonoma (ARS) Siti di restrizione (per il clonaggio del DNA). Trasformazione nel lievito e crescita in terreno selettivo

INSERTI molto grandi, fino a 500 kb.

BAC Cromosomi artificiali batterici (Bacterial Artificial Chromosomes):

1. 2. 3. 4.

Sequenza origine (ori) derivata dal plasmide fattore F di E. coli Multipli siti di clonazione (siti di restrizione). Marcatori selezionabili Propagazione in batteri

INSERTI FINO a 350 kb

Numero di cloni richiesti per avere una libreria rappresentativa di tutto il genoma umano a seconda dei vettori di clonaggio

Per avere il 99% di probabilit di avere tutto il genoma rappresentato: 820.000 cloni

una volta costruita la libreria genomica nel vettore scelto,come si fa a recuperare il clone (i cloni) corrispondenti al gene di interesse?

come si analizza la libreria?

screening library

Isolamento di cloni portanti linserto di interesse

Screening della libreria genomica

Ibridazione
Presuppone la conoscenza di una sequenza nella regione di interesse, che viene utilizzata come PROBE probe marcata radioattivamente o rilevabile per chemiluminescenza

II lezione

Screening di una biblioteca genomica (ex plasmidica)

1. 2. 3. 4. 5. 6. 7.

I vettori plasmidici contenenti il DNA genomico digerito sono trasformati in E. coli e piastrati in terreno selettivo (e.g., ampicillina). Le colonie cresciute sono replicate su una membrana (E. coli continua a crescere su membrana). I batteri sono lisati e il DNA denaturato Il DNA legato alla membrana poi ibridato con un DNA complementare (e.g., DNA marcato con 32P). Le sonde in eccesso non ibridate sono lavate via dal filtro. Libridazione delle sonde rilevata attraverso esposizione su pellicola autoradiografica (o attraverso rilevazione per chemioluminescenza). I cloni positivi vengono riamplificati dalla piasta copia per le analisi successive

LIBRERIE DI cDNA

Il cDNA derivato da mRNA, quindi la libreria di cDNA riflette lattivit genica al momento in cui sono isolati gli mRNA Varia: -da tessuto a tessuto -a secondo del momento nello sviluppo 1. 2. 3. Isolamento di mRNA Sintesi di cDNA Clonaggio di cDNA in vettori

Isolamento RNA

attacco di linker per poter ligare i cDNA in vettori

RNAsi H, DNA polimerasi, DNA ligasi

trascrittasi inversa

Costruzione di una libreria di espressione

cassetta di espressione: *promotore: forte, inducibile *segnali terminazione Marcatore di selezione per cellule mammifero (resistenza ad antibiotici: neomicina, puromicina igromicina)
In aggiunta alle sequenze per il mantenimento/Propagazione in batteri in cui la libreria viene Mantenuta e amplificata

Screening di una libreria di espressione (cDNA):

A) -ibridazione acidi nucleici (come per libreria genomica)

B)-screening immunologico per clonare geni da proteine note (purificate, e contro le quali sia disponibile un anticorpo)

Isolamento e studio gene di interesse


costruzione libreria: *generazione frammenti di DNA *clonaggio in vettori appropriati *identificazione dellinserto di interesse

caratterizzazione dellinserto ricostruzione della struttura del gene


studio funzionale

Chromosome walking

Ricostruzione della sequenza di una regione di DNA

Probe A

Probe a Probe b

Allineamento cloni sovrapposti

ricostruzione regione

Analisi dei cloni positivi

-Analisi di restrizione

-Southern blot -Amplificazione (PCR)

Southern blot:
*Sul DNA cellulare *Sul DNA dei cloni

In che banda si trova il DNA Che ibrida con la probe???

ritaglio clono

Reazione a catena della polimerasi (PCR)

Cicli ripetuti di: Denaturazione del DNA a 94C. Annealing dei primers alle sequenze complementari fiancheggianti la regione bersaglio. Estensione dei primers a 72C utilizzando una DNA polimerasi resistente al calore Taq polimerasi ( derivata da Thermus aquaticus).

SEQUENZIAMENTO INSERTI Il sequenziamento automatico utilizza didesossiNTPs (incorporati, non permettono lallungamento della catena) marcati con coloranti fluorescenti. Combina 4 ddNTPs colorati in una provetta di reazione e lelettroforesi avviene in una corsia unica, o in un capillare contenente poliacrilamide. Laser UV individua i coloranti e legge la sequenza.

cromatogrammi: che corrispondono alla posizione di ciascun nucleotide nella sequenza.

fantoni, tripodi.. Genetica PICCIN

GENOMICA: SEQUENZIAMENTO ED ANALISI DI INTERI GENOMI


Sviluppo e integrazione di: - mappatura genetica (linkage analysis): localizzazione di un gene su un cromosoma, relativamente ad altri geni, usando incroci e genealogie. - sequenziamento - approccio bioinformatico per analizzare il genoma degli organismi 1. 2. 3. 4. Genomica strutturale genetica e mappaggio fisico dei genomi. Genomica funzionale analisi delle funzioni geniche (annotazione del genoma). Genomica comparativa confronto dei genomi di diverse specie, storia evolutiva dei genomi. Genomica evoluzionistica Genomica medica- polimorfismi, geni malattia, variabilit genetica, farmacogenomica etc

PROGETTO SEQUENZAMENTO GENOMA UMANO


Obiettivo primario: sequenziamento del genoma 2 metodologie: 1. Mappatura e sequenza: divisione del genoma in cromosomi segmenti adiacenti sovrapposti lungo il cromosoma ricostruzione della mappa della regione e sequenziamento. -lento ma abbastanza accurato -consorzio pubblico 2. Shotgun e sequenza: rottura casuale del genoma in frammenti sovrapponibili, sequenza e riassemblaggio al computer -piu veloce ma impreciso (problema sequenza ripetute, che si trovano in tutto il genoma) -Celera corporation

1. Mappatura e sequenza: divisione del genoma in segmenti, raffinamento della mappa, e sequenziamento.

Shotgun e sequenza: rottura casuale del genoma in frammenti sovrapponibili sequenza e riassemblaggio al computer Rottura meccanica dei cloni BAC in frammento sovrapponibili di ~2 kb . Isolati in agarosio, purificati, e clonati in vettori plasmidici standard. Sequenziati ~500 bp da ciascun lato dellinserto di 2 kb Si ripete il processo fino a sequenziare 6.5-8.0 volte la lunghezza totale del genoma Si assemblano centinaia di migliaia di sequenze sovrapposte di ~500 bp con computers che lavorano in parallelo.

progetto genoma movie

Caratteristiche del genoma umano

32,000 geni stimati (erano stati previsti 50,000-100,000). Solo 50% in pi rispetto a C. elegans (nematode). Solo 1-1.5% del genoma codifica proteine. 50% costituito da DNA ripetitivo. >95% del genoma in comune con lo scimpanz

Lewin Il gene Zanichelli

19.000 pseudogenes

ANIMAZIONE
http://www.genome.gov/25019879

human genome project: http://www.ornl.gov/sci/techresources/Human_Genome/home.shtml

PUB MED

ATACAGAGTTTAAGTATATAATATAGACTTTAAAATTTCATGGATATATTCCATATCGAAATGTTCAATGATAGAAAAT ATAAGGAAAAGATATTTGGTAGCCAAAAGACAGATTAATTTAGGACATGAAATCTTCTGTCTTTAGGAAATATGCTTTAT TTTCATAGGCTTTTTCTGTTCCAATAATTGAGCCATTAATGTCAACAGAGACTCCCTGGCAGTGATATAGTATGAAGGCAT TTGCAGTAATGCAGTGGCACTTCTTTCTAAATCAGAGACTCTGTTGAAGTAATCACTAAAAATATTAAAATTCTGTTCTA GTTGTTCTGAATTTATAATGTGAAAGTGACTGCACCCATCTTTCAAGAACATAAAGAGCATCCATAATTTAATAATTAAG TAACACATAATAACCAATAATTTTTGTTACCTATAAATAGGCCTGTGTAACAAGAGTAAGGAATACTAAAAGAAGTAGCT GATTGTTAATAAAAACTTTTTTTTCAGAATGTGCTCATTTAAAGCATTTTATAACCTTTATTAAATTGCCATCTTACTAT GCAATTAGAATGCATTGTCATTTTTCTTTCTTTAAAACATTTGCACTTTATCCTTTTCTAAGCTGGTAGAAGTTGGACTCT CACTGCGTTTCTTTTGCTTTTTAAACTTGTATTGGAGTGATGTAGAACTAGGCCTTATCACTGCATAGAAAATTAATTTAA ATGACATATTGTTGCAGTTTCTATGACAACCATATCATGATGCTCATGTTCTTAAAAATTTATAAACTATAATCTGAAGT ATGCTAATTCTAGTGAGTGTAGGCAACAGTCATTTGCTTAATATTCATTTTGCTACTGCGCTCATCAGCTTTGAGAGTCAG ATGGTTAACATTCTGCATTCAATCCGAAGAGGTTTATATGAACTCTTGGGTTTATGCATTTTCCTCAGAAGCTACAGTTAC TGAACTTTTAAGCATGTATAAGAGAACCTTTCGCTGCCTGTTTTCTTGAAGCAATAGGAATGAATACGGGCGTGAACACAT GCTGCTGACTTTCAACATGGCTGCTTTTCTCTCCACCCCTACTGGAAAGACAATATCCTCAAACTAATGTAAAAAAAAAAC TAATAAAAACAAAAATTCAATAACATCCAATGATCTACTTAAGCAACAGTGACTATTCAAATCCTTGGGAACACTGGCTT ATTCCTTCAACTTTAGTTGTTTGAGTTCAAGAAGCTCATATCGCTATTGTATGGTTATGATGTATGATAATGACATGTATC ATCAGTTTAAGGATATTTGCCTAGCACTGATATTAAACATTTTGATTTGAAATACAGGTTGAATTTTTTTTAGGACTGAT TCAAAAATAAAATATGCTATTTAGTCTATGGCTTATAACCATGGACTCTCTTGTTAAATAAAGATGCTTTTAGATATACC ACTTGAAAAATTAGAAATGTATAATTAAAAAAATTTATTTTAGAAATGTATATAATTTGTTGGTTGATAAAAATTAGG TAATTTAATTTAAACAATATATAATGAATAAGATAATTTAACATCAGGTGGAATTATCAAACACCATTTTTGCTAATAT ATTTTATAAAAGTCATTTTTAATTCGTGTTCATTGAATTATAAAAATGCAAAACATAAATCCTTGGTTAACATGCTTTTA ATTATTTTCTTTTCACATGTTAGGCTCTCGGTGAATGCAACAGAAATCCTATACTTAGACATTTTAAAAAGCAATCTGTAG TTTCAAAAGAGAGATTGTTAAGAAACACATTTTAAAATTATAGGACACCAAATTCAGTTTTAAAAACACAATGCATAAA ACATAAAATTCTAAAGCAACTAATCAAACTTCTGAAGAAGGACAATGTCAGTAAGCTGCTTTGCTGGCAGCAACTGGTGA GCGGACCCTTGTCTGTCTTTTATGAGGCAATTACAACAGGTGTCATATTGATTTGCCTACTGTTTCCTGTGTAGCTCGAGTG TATCCTAAATGGAATGACAGTCATCGTAGCGAGTGGTAAACTTCTGGTCTGGAAGGAAGGTTTAGTCAGTCAGTCAGCACC TATGAGGCAGTGTGACAGTGGGCCACGGTGCAAAGGCAACTCAGTATCACACTCACTGAGAGGGGGTACTGGGGAGTTTTA GTGAGGGAGTTTACTGCTGTGTTTGAAACATAACTTTTCATTGTATCCCCCCACCCTGTGTGTTAAATTTGTAAATTGTCC AGATCACTTTTATTTTGGTTAAAAAAAACCCCAAATTCCATATAGGCTTTTCAAAGGAGCATTTGGATGTGTGATAAGCC TTTCTATTTCCTGTGACTGTTTGCCTGGCATTAGCTTCAGTGGCATCCAGTGGTAAAGCAGCTGTAATCCTGACTTGTTCTT TCATGGAGCAGTTCAAACAGGTTAGCTTGATGATTTTAAAGCACGGTTGGTTTATATGGGGCTTGGAGCGGTGGTAGGGGT TACAGTGGTTTCCAACCAGATCCTTGTATTTTTGATGGCGTAATTTCATTACATTTTCCTATTTATTTTCTATTTATAGTA ATGTGAAGTATGCCCATTGAATAATGTCAGCTTAATATTGCAAGGATTTTTGTTTAAAAATTATGGAATTGGTCTCTACA CATTCAATGTATTTTCCAGTTCTTTGATATTTCTACCTAAGCTTGGTTTCTGCCAGTTATGTTGGCTCTAGTGTTTGCCCGT CTCATTTAAGATAAAATGAATGGCCAGTATTATGTATAGTAAAGCCAAGCTTCCTTTGAGTTAAGGCTTTGGAGCATTGT GCAAGCCTAATGTTCTTCCATGAAGTTGGCCCACCCCACTGTGACTAAGAAATGAGATGATTTGAGGGCTATTACATACTT ACGATTTTCATAGTGGATTAGAATAACATTACTTAG

???

Bioinformatica genetica + matematica/computer Applicazioni: 1. Identifica geni entro la sequenza completa del DNA.

2. Allinea e confronta sequenze geniche in un database per determinare la funzione. 3. Predice struttura e funzioni dei prodotti genici. 4. Descrive interazioni tra geni e prodotti genici. 5. Stima relazioni filogenetiche e di popolazioni

PROCARIOTI Ricerca open reading frames (ORFs) piu lunghe possibili allinterno della sequenza. ORF = sequenza potenzialmente codificante che inizia con un codone di start (ATG) e finisce con un codone di terminazione. 6 possibili frames, 3 per ogni strand Efficace per procarioti: NON ci sono introni

EUCARIOTImolto piu complesso per eucarioti: ci sono introni! ANALISI INFORMATICA -Conservazione in SPECIE DIVERSE -Algoritmi di ricerca segnali specifici: - segnali di splicing, giunzioni esoni/introni - isole CpG (promotori e 5 geni) -promoter prediction (tata box, CCAAT, CACC) -segnali terminazione ANALISI SPERIMENTALE -Ibridazione con RNA: NORTHERN BLOT -Conservazione in SPECIE DIVERSE: ZOOBLOT (le sequenze codificanti sono preferenzialmente conservate)

allineamento genomi specie diverse

per poter ricostruire la struttura ESONI - INTRONI di un gene, il sito di inizio e fine della trascizione devo ricorrere all mRNA e confrontarlo con la struttura del DNA

Primer extension: mappaggio del 5 del gene

GENOMA

OK!

struttura

evoluzione

regolazione

Nuovi geni relati

funzione

utilizzo

identificazione sequenze regolative sulla base della loro conservazione in specie diverse

http://genome.ucsc.edu VISTA ENHANCER BROWSER The goal of this project is to identify distant-acting transcriptional enhancers in the human genome by coupling the identification of evolutionary conserved noncoding sequences with a moderate throughput mouse transgenesis enhancer assay.

utr

esoni
http://enhancer.lbl.gov/

enhancer
Promotore

reporter LacZ

http://enhancer.lbl.gov/

location

gene

expression

chr1:63,155,555-63,156,905 chr1:63,176,303-63,177,738 chr1:63,081,370-63,082,915 chr1:63,377,240-63,378,143

APG4C-FOXD3

esprimono

STUDIO SEQUENZE REGOLATIVE


Ex: blocco conservato uomo/pollo rVISTA

Ricerca sequenze conservate in organismi diversi allesterno delle sequenze codificanti:

seq. regolative conservate

blocchi conservati: siti di legame Per fattori trascrizionali

RICERCA DI SITI CONSENSUS PER FATTORI TRASCRIZIONALI

http://www.biobase-international.com/pages/guided_tours/transfac

Test di ipersensibilit alla DNAsiI :

le regioni regolative sono piu accessibili al taglio da parte dellenzima DNAsiI (o altre nucleasi)

*identificazione regioni regolative *identificazioni regioni regolative tessuto specifiche: legate da fattori trascrizionali aperte solo nei tipi cellulari dove il gene espresso
accessibile

Gel shift: legame in vitro DNA marcato-proteina


*Legame DNA/proteina * specificit proteina * identit proteina (uso anticorpi specifici) *modalit legame

Immunoprecipitazione della cromatina ChIP:


*legame in vivo di un fattore trascrizionale ad una sequenza *modificazioni istoniche struttura cromatina *identificazione nuovi target di un fattore trascrizionale

Lega la sequenza di interesse?? (PCR)

Outline of chromatin immunoprecipitation (ChIP) assay. Protein:DNA crosslinks are formed with formaldehyde followed by chromatin fragmentation by sonication. The DNA:protein complexes are immunoprecipitated with antibodies specific for the protein of interest and Protein A agarose beads. The crosslinks are reversed and the DNA is isolated for analysis.

*Ibridazione su vetrini con probes per migliaia di sequenze (ChIP on Chips) *clonaggio e sequenziamento frammenti recuperati

Nuove Sequenze target

TRANSFEZIONE: introduzione nella cellula di costrutti di DNA


*transiente (costrutti non integrati) *stabile (costrutti integrati nel genoma) (Calcio fosfato, elettroporazione, lipidi cationici) DOMANDE *La sequenza che ho identificato effettivamente in grado di attivare/reprimere la trascrizione? E un Promotore, un Enhancer, un silencer? * che cosa succede se muto dei siti specifici? *In quali tipi di cellula funziona questo elemento? (ha effetto tessuto specifico o ubiquitario?) *quale proteina in grado di legarlo? (ex cotransfezione con vettori di espressione per diversi membri di una famiglia di fattori trascrizionali che legano la stessa sequenza ex: GATA1, GATA2, GATA3)

Sequenza regolativa da studiare


TF

TF

Gene reporter: GFP, LacZ , CAT, Luc

Gene di cui posso misurare l attivit saggi colorimetrici, enzimatici, fluorescenza

Attivit reporter

Vettore di espressione

Promotore forte, Inducibile, etc. Wt mut. costrutti

EFFETTO MUTAZIONI

COTRANSFEZIONE CON VETTORE di espressione

GENOMA evoluzione struttura OK!

regolazione OK!

Nuovi geni relati

funzione

utilizzo

IV lezione

GENOMA evoluzione struttura OK!

regolazione OK!

Nuovi geni relati

funzione

utilizzo

SILENZIAMENTO GENICO: RNA interference


*sfrutta un meccanismo fisiologico identificato originariamente nelle piante e nei nematodi *il meccanismo dell RNAi presente in tutte le cellule degli organismi multicellulari e si probabilmente evoluto come meccanismo di difesa contro linfezione di virus a RNA (dsRNA) doppio filamento *Le molecole dsRNA sono processate in corti RNA (siRNA) a singolo filamento dal complesso enzimatico citoplasmatico DICER, che vengono indirizzati al RNA-induced silencing complex (RISC). *RISC media il legame sequenza specifico del siRNA sulla sequenza complementare del mRNA bersaglio corrispondente, impedendone la traduzione attraverso 2 meccanismi

Blocco traduzione

SILENZIAMENTO DEL GENE

Degradazione RNA

DICER L'enzima appartiene alla famiglia delle RNasi di classe III (specifiche per i dsRNAs). Contiene una regione carica positivamente che lega i dsRNA e li taglia in modo ATP dipendente

RISC guida lappaiamento dellRNA interferente con il suo target

RNA ds viene legato dal complesso DICER

DICER taglia dsRNA in frammenti piu piccoli

lRNA ss viene legato dal complesso RISC e si appaia allmRNA complementare lmRNA viene *degradato * ne viene bloccata la traduzione

NON VIENE FATTA LA PROTEINA

Elbashir, S. M. et al.

Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.


Nature (2001).
2nt increase stability easier synthesis

RNAi specifico

RNAi specifico RNai controllo -aspecifico(anticorpo contro lamina A/C rilevabile in fluorescenza)

cellule non trattate

Immunostaining

(gel separazione proteine-trasferimento su filtro proteineibridazione con anticorpo specifico contro Lamina A/C rilevabile in chemioluminescanza)

western blot

Scomparsa proteina

RNAi aspecifico

COME si possono introdurre in cellula??


Transfezione diretta o transfezione con vettori che li esprimono

promotori RNA pol.III sintesi di short hairpin RNA (shRNA) e siRNA in vivo

VETTORI PLASMIDICI VETTORI RETROVIRALI MoMuLV or MSCV silenziamento del provirus durante lo sviluppo le cellule devono essere nel ciclo cellulare per poter essere infettate VETTORI LENTIVIRALI HIV-1 nessun silenziamento: Topi transgenici infettano cellule quiescenti (cellule staminali.)

RNAi come farmaci: specificit

Silenziamento specifico del mutante ras che induce tumore (con RNAi in vettore retrovirale)

Cellule interferite non sviluppano tumore in topo nude (immunosoppresso)

RNAi come farmaci

Silenziamento apoB > riduzione livelli colesterolo in modello murino

postgenomica: RNAi library: libreria di RNAi

fenotipo

gene silenziato

funzione del gene

analisi sistematica per perdita di funzione di geni

..in organismi diversi

Tecnologia RNAi: * strumento per il silenziamento genico *meccanismo

endogeno cellulare

miR (micro RNA): * codificati dal genoma * derivano da intermedi a doppio filamento che vengono poi processati * ruolo fondamentale nella regolazione genica: alcuni sono evolutivamente conservati alcuni sono tessuto-sviluppo specifici

RNAi: prodotti primariamente extracellularmente da virus (sia a Dna sia a RNA).


Nel regno vegetale come difesa antivirale

microRNA: prodotti quasi esclusivamente per via endogena, tipici regno animale. Ruolo

di regolazione genica, rappresentano circa 1-2% RNA totale e regolano circa 30% dei geni

meccanismo molecolare simile

miRNA

STUDIO DEL CONTROLLO DELLO SVILUPPO DEL NEMATODE C. elegans:

LIN4 reprime LIN14

la scomparsa della Proteina LIN14 segna la transizione fra le fasi di sviluppo larvale L1 e L2

959 cellule

2 loci identificati geneticamente come importanti per il controllo dello sviluppo larvale *LIN4 reprime LIN 14, che codifica per una proteina nucleare *LIN 4 non codifica per una proteina ma solo per un RNA complementare al 3UTR di LIN14

*LIN4 codifica per un RNA di 63nt *poi processato 22 mer *22mer si appaia con RNA di LIN14

NO proteina LIN14

Transizione fra fasi larvali successive L1 e L2 determinato dalla scomparsa della Proteina lin14: lin14 serve per specificare la fase L1, deve poi essere eliminata per passare a L2

Levels

lin-14 protein

Lin-14 RNA, non viene piu tradotto Con la comparsa di LIN-4

lin-4 micRNA
Stadi dello sviluppo larvale di C.Elegans

L1

L2

L3

L4

perdita funzione LIN 14: ridotta L1: sviluppo precoce di una larva tardiva con poche cellule acquisto funzione (troppo) LIN14: L1 estesa: non c passaggio alla fase tardiva precoce tardiva

Levels

lin-14 protein

L1

L2

lin-4 micRNA

L3

L4

NB: un singolo miR puo regolare contemporaneamente piu geni (nellesempio, LIN4 reprime LIN14 e LIN28)

*Lin4 reprime lin 14 e lin 28 Progressione late stages *Let7 reprime lin41 Progressione adult stage

LIN-14 and LIN-28 expression levels are decreased by lin-4 RNA expression at the end of the first larval stage to allow progression to late larval stages. In late larval stages, the expression of LIN-41 and other genes may be similarly downregulated by the let-7 RNA, relieving their repression of LIN-29 protein expression and allowing progression to the adult stage. Because the lin-29 mRNA does not contain sites complementary to the let-7 RNA, lin-29 is not likely to be a direct target of let-7.

PASSO SUCCESSIVO:

I MiR SONO CONSERVATI IN ALTRI ORGANISMI??

*nematodi *insetti *piante *mammiferi Ricerca: OMOLOGIA per identificare nuovi miR e miR target in organismi diversi

PREDIZIONE DI GENI TARGET del silenziamento STUDI FUNZIONALI (overespressione/silenziamento)

miRNAs sono coinvolti in numerosi processi cellulari, inclusi sviluppo, differenziamento, proliferazione, apoptosi e risposta a stress ambientali.

ESEMPIO: il genoma di topo codifica per 11 membri della famiglia di LET-7 (OMOLOGIA) DOVE SONO ESPRESSI?
Mansfield et al. Nature Genetics, 2004

MicroRNA-responsive 'sensor' transgenes uncover Hox-like and other developmentally regulated patterns of vertebrate microRNA expression
sequenze target gal on gal off miR blu bianco

a: gene reporter LacZ (sotto il controllo di un promotore ubiquitario) contenente una sequenza target del miR di interesse nel 3UTR. Dove il miR non espresso colore blu. b: nelle cellule in cui espresso il miR complementare alla sequenza target, lmRNA di LacZ viene degradato non ho colore blu

Dove miR espresso, LacZ silenziato Zona chiara

abbozzi degli arti

I microRNA sono coinvolti nella regolazione dei geni Hox

Geni HOX: Molto conservati evolutivamente Fondamentali per *lo sviluppo assi corporei *definizione identit cellulare

miR regolano processi di sviluppo e differenziamento

Regione target molto conservata evolutivamene

Ogni cellula ha un suo repertorio di miR: sistema flessibile


DI REGOLAZIONE DI RNA esistenti *on/off di un target *regolazione fine di un target *un miR puo controllare piu geni contemporaneamente Importante meccanismo regolazione Processi sviluppo differenziamento

precursore linfoide

precursore mieloide

NF1A deve essere spento perch ci sia differenziamento mieloide (sia granulocitario, sia momo/macrofagico)

miR TESSUTO SPECIFICO REGOLATO DA GATA1

modello di zebrefish -labolizione di miR451 (miR451-MO) riduce fortemente la maturazione eritroide

riduzione espressione globine

abolizione GATA1 abolizione miR451

*miR specifici contribuiscono al mantenimento dello stato indifferenziato della cellula staminale *Altri sono espressi in modo differenziale in cells diverse e la loro overespressione spinge la cellula a destini differenziativi diversi C. elegans: formazione di tipi cellulari neuronali diversi, ASEL e ASER

The vertebrate HOX b cluster includes miR-10a and miR-196a genes. miR-196a reprime Hoxb8

MICRO RNA E TUMORI


*in molti tumori umani (leucemie, tumore gastrico, polmonare) c un pattern di espressione di miR alterato.Tumori che originano da stesso tessuto, hanno lo stesso pattern di miR alterati (ex gastrici, liver, colon endoderma) *13q31-32: regione amplificata in linfoma, codifica per miR (He, NATURE2005) coopera con myc: tumori con minore latenza e maggior penetranza in topi trapiantati con cellule che overesprimono myc (E-myc) e la regione amplificata rispetto a cellule che overesprimono solo myc

*myc (oncogene) (ODonnel, Nature 2005)

attiva E2F (progressione ciclo cellulare) attiva miR che reprime traduzione E2F controllo fine
miR

myc

E2F
http://dx.doi.org/10.1016/j.cell.2005.06.036

E2FmRNA

Elementi Genetici Trasponibili (TGE): elementi genetici che hanno la capacit di cambiare posizione nel genoma attraverso meccanismi molecolari diversi
causano mutazioni genetiche complesse e danno un importante contributo allevoluzione del genoma (altra fonte di variabilit genetica oltre mutazione e ricombinazione) *Mutazioni geniche (Inserimenti nei geni), mutazioni cromosomiche (riarrangiamenti, traslocazioni) * modifiche nellespressione genica (Inserimenti nelle sequenze regolatorie). * concorrono alla struttura di geni codificanti (4% geni umani contengono seq. relate a trasposoni) significato evolutivo Sono presenti nei genomi sia di PROCARIOTI dove si possono spostare dal/al cromosoma cellulare, plasmide, cromosoma fagico. EUCARIOTI (20% genoma in Drosophila, 10-20% nelluomo) dove si possono spostare dallo/allo stesso cromosoma o a un cromosoma diverso.

TRASPOSONI

STRUTTURA MOLECOLARE, molto varia:


*DNA *altri simili a virus a RNA ma non fanno particelle non trasmessi orizzontalmente

IDENTIFICAZIONE:
*Evidenze indirette: *TASSI DI MUTAZIONE MOLTO ELEVATI

*ALTE FREQUENZE DI REVERSIONE

Instabilit genetica del mais (McClintock) Disgenesi degli ibridi in Drosophila *Evidenze dirette: instabilit riconducibile a sequenze di DNA che si spostano nel genoma *Criteri molecolari: *duplicazioni di sequenze caratteristiche 4 -15------------------4 -15 *presenti in punti diversi del genoma *presenti in punti diversi in individui diversi

Data la loro eterogeneit rimane un margine di incertezza nella loro identificazione

ELEMENTI TRASPONIBILI NEI PROCARIOTI 2 esempi: 1. Elementi Sequenze di Inserzione (IS). Il pi semplice tipo di elementi trasponibili, in cromosomi batterici e plasmidi.

2.

Transposoni (Tn). Simili a elementi IS ma di maggiore lunghezza, pi complessi strutturalmente e portano geni aggiuntivi.

per esempio geni di resistenza ad antibiotici, che attraverso plasmidi possono essere trasferiti da una specie allaltra

SEQUENZE DI INSERZIONE (IS)


1. 2. 3. 4. 5. Vanno da 768 bp a 5 kb. Diversi IS possono integrarsi in diversi punti specifici del cromosoma

Codificano solo geni per inserzione e excisione.

IS1 il primo identificato in E.coli, presente in 4-19 copie nel cromosoma.

Ai margini di tutti gli elementi IS conosciuti ci sono ripetizioni terminali invertite di 2040bp (ITRs).

importanti per definire se c stato evento di trasposizione

TRASPOSONI (TN) COMPOSTI


Trasportano geni (e.g., un gene per la resistenza agli antibiotici) fiancheggiati in entrambi i lati da elementi IS. Tn10 di 9.3 kb e include 6.5 kb di DNA centrale (include un gene per la resistenza alla tetraciclina) e 1.4 kb di elementi IS invertiti. Gli elementi IS forniscono transposasi e segnali di riconoscimento ITR.

Lintegrazione di un elemento IS pu:

*Interrompere una sequenza o una regione regolatoria. *Alterare lespressione dei geni vicini. *Causare delezioni o inversioni nel DNA adiacente. *Provocare ricombinazioni ( ex. cromosomi/plasmidi) *Conferire nuove caratteristiche (ex. resistenza ad antibiotici)

INSTABILITA GENETICA NEL MAIS


1938 Marcus Rhodes: incrociando linee pure di mais pigmentate si ottenegono pannocchie con cariossidi gialle o a macchie con proporzioni che spiegate in termini mendeliani implicherebbero *alte frequenze di mutazione (A a, colore incolore; dt Dt giallo dotted) *alte frequenze di reversione (A a; Dt dt)

Il carattere dotted fortemente instabile

Mc Clintock

c/c = pannocchie gialle

C/- = pannocchie viola

Il carattere del colore della pannocchia instabile. Se avviene reversione in una cellula, questa produrr pigmento viola e conseguentemente una macchia. Prima avviene la reversione nello sviluppo e pi grande sar la macchia. McClintock concluse che lallele c dovuto ad un transposone non autonomo chiamato Ds inserito nel gene C gene (Ds = disassociazione). transposone autonomoAc controlla il trasposone Ds (Ac = attivatore).

Pigmento (C=color)

quando AC (activator) promuove la transposizione di Ds (defettivo) in C perdo colore

quando AC (activator) promuove la transposizione di Ds fuori da C recupero colore nella progenie della cellula in cui avvenuta lexcisione

NB: Se, attraverso una serie di incroci viene perso AC, il carattere C si stabilizza

L elemento Ac autonomo, mentre l elemento Ds non autonomo (defettivo). Ac 4,563 bp con 11 bp ITRs e 1 unit di trascrizione codificante una transposasi di 807 aminoacidi. Ac attiva Ds; Ds varia in lunghezza e in sequenza, ma ha gli stessi ITRs di Ac.

Molti elementi Ds sono versioni delete o riarrangiate di Ac: Ds derivano da Ac. Ac/Ds transpongono solo durante la replicazione del cromosoma

movie!
march 2009

DISGENESI DEGLI IBRIDI IN DROSOPHILA 2 ceppi di Drosophila: linea M


linea P

..speciazione disgenesi: dovuta a elemento trasponobile P che si inserisce nei geni disattivandoli: -alto tasso di mutazione e reversione a carico di singoli geni disgenesi -alto tasso riarrangiamenti cromosomici e aberrazioni cromosomiche

*perch la disgenesi si manifesta solo nellincrocio femmina M x maschi P e non nel reciproco?

*perch le Drosophile P non muoiono a seguito riarrangiamenti/mutazioni?

Elemento P: transposone, porta: * gene transposasi, che permette trasposizione (espresso nelle cellule germinali) *repressore trasposasi, che previene trasposizione (espresso nelle cellule somatiche)

Nelluovo non c repressore: trasposizione e disgenesi La presenza nel citoplasma della CELLULA UOVO del repressore inibisce la trasposizione

lelemento P si comporta da parassita: * SI MUOVE SOLO IN GERM LINE (minimizza i danni per lospite, costituito dalla linea P)

www.mun.ca/biology/scarr/P_element

STOP

Lewin, genes VIII

Elementi Genetici Trasponibili (TGE): elementi genetici che hanno la capacit di cambiare posizione nel genoma attraverso meccanismi molecolari diversi STRUTTURA MOLECOLARE, molto varia:

*DNA *altri simili a virus a RNA MA non fanno particelle non trasmessi orizzontalmente IDENTIFICAZIONE: *Evidenze indirette: *TASSI DI MUTAZIONE MOLTO ELEVATI

*ALTE FREQUENZE DI REVERSIONE

*Evidenze dirette: instabilit riconducibile a sequenze di DNA che si spostano nel genoma *Criteri molecolari: *duplicazioni di sequenze caratteristiche 4 -15------------------4 -15 *presenti in punti diversi del genoma *presenti in punti diversi in individui diversi

ELEMENTI TRASPONIBILI IN

EUCARIOTI

*costituiscono parte rilevante del genoma di piante e animali.

*lo spostamento puo essere * neutro per lospite * dannoso (aberrazioni cromosomiche/ Mut/riarr) * potenzialmente positivo: contribuiscono alla diversit genetica dellorganismo possono essere reclutati ex. come sequenze regolative nuove funzioni

Nature 2006

Trasposoni a DNA
miniature inverted-repeat TE

I trasposoni a DNA tendono ad avere una vita breve nelle specie:

la trasposasi non distingue fra elementi attivi e inattivi

accumulo di elementi inattivi nel genoma

trasposizione sempre meno efficiente estinzione :fossili

Trasposoni con intermedi a RNA: retro trasposoni: *elementi retrotrasponibili autonomi a RNA (LTRgag-pol) duplicazione *retrotrasposoni senza LTR (LINEs) (endonucleasi) *non coding retrotrasp (SINEs), derivanti da geni per tRNA, 5S e 7SL
sfruttano per la trasposizioni enzimi dei retrotrasposoni autonomi

DNA

RNA

trascrittasi inversa

DNA DNA

Element LINE/SINE LTR DNA All TEs

Human 33.4% 8.1% 2.8% 44.4%

Fly 0.7% 1.5% 0.7% 3.1%

Worm 0.4% 0.0% 5.3% 6.5%

Arabodopis 0.5% 4.8% 5.1% 10.5%

http://nitro.biosci.arizona.edu/courses/EEB600A-2003/lectures/lecture26/lecture26.html

Non-LTR retrotransposons

Alu1 SINEs (short-interspersed sequences) ~300 bp, ripetuti 300,000-500,000 volte Fiancheggiati da 7-20 bp di ripetizioni dirette. inserzioni AluI SINEs possono essere causa di malattia >proteina non funzionale. L-1 LINEs (long-interspersed sequences) Elementi 6.5 kb, (~5% del genoma). L1 lunico elemento LINE attivo nelluomo Contengono ORFs con omologia alla trascriptasi inversa; non hanno LTRs. Alcuni casi di emofilia (OMIM-306700) sono il risultato di nuove inserzioni di L1.

conseguenze
mutazioni loss of function gain of function

nuove funzioni

sequenze codificanti sequenze regolative rimodellamento cromatina e struttura cromosomi (centromeri, telomeri) DOMESTICATION

..mutazioni indotte da transposoni: ex nelluomo


Eur J Hum Genet. 1993;1(1):30-6.

Haemophilia B due to a de novo insertion of a human-specific Alu subfamily member within the coding region of the factor IX gene.

alterazione espressione genica


L1 determina un rallentamento della polimerasi c correlazione fra velocit di trascrizione e n di L1 presenti negli introni di un gene

RECLUTATI COME ELEMENTI REGOLATORI


(circa25% promotori nelluomo contengono seq. derivate da TE) *Prevalenza TE nelle sequenze regolative: cooptati *possono regolare espressione genica: trascrizione traduzione *possono essere cooptati come promotori alternativi: ex: lespressione di cyp19 (aromatasi, sintesi estrogeni) placenta-specifica presente in uomo ma non in topo guidata da un ERV Endogenous Retroviral like element)

conseguenze
mutazioni loss of function gain of function

nuove funzioni

sequenze codificanti sequenze regolative rimodellamento cromatina e struttura cromosomi (centromeri, telomeri) DOMESTICATION

promoter disruption

alternative start cis addition

alternative polyA miRNA targeting alternative splicing protein modification

antisense transcription silencing

DNA binding proteins


proteine centromeriche fattori trascrizionali

rag1/rag2
catalizzano i riarrangiamenti somatici Ricombinazione VDJ che permettono la formazione degli anticorpi. Agiscono tagliando specifiche sequenze di DNA (RSS) che fiancheggiano gli elementi V, D,J.

RAG1 deriva dagli elementiTransib (trasposoni di invertebrati)


conservazione aa conservazione RSS

http://biology.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pbio.0030181

elementi dinamici
lineage specific activity & extinction: alcuni genomi ne hanno piu di altri genomi diversi ne hanno di tipo e variet diversi dovuto a diverso successo nellespansione/estinzione

lineage specific introduction: in specie diverse attraverso infezione e trasferimento orizzontale (elementi retrovirali derivanti da retrovirus) lineage specific formation: ex SINE da geni per tRNA (seq. Alu nelluomo)

topi geneticamente identici

dennis C 220 NAture

uso retrovirus endogeni come marcatori genetici retrotype ricostruzione storia evolutiva

Retrovirus: virus a RNA


*si replicano attraverso intermedi di DNA a doppia elica. *infettano solo cellule eucariotiche *conseguenza per la cellula ospite (oltre allinfezione stessa):

-sequenze retrovirali integrate (provirus) possono modificare la cellula ospite (se lintegrazione avviene a carico di cellule germinali la modificazione puo trasmettersi alla progenie) -sequenze cellulari (ospite) possono ricombinare con le sequenze virali ed essere trasposte insieme al retrovirus riarrangiamenti -sequenze cellulari trasportate dal retrovirus possono cambiare le proprieta della cellula infettata virus oncogeni

Struttura del retrovirus:

*2 copie di un genoma costituito da 7-10 kb di ssRNA *Nucleo virale proteico *Involucro glicolipidico (glicoproteine che mediano il riconoscimento della cellula ospite)

1 RNA convertito in DNA dallenzima virale trascrittasi inversa, che si trova nella particella virale e manca di attivit esonucleasica 3 - 5 (no proofreading molte mutazioni). trascrittasi inversa: VIRALE 2 il DNA si integra nel genoma dellospite ed trascritto. trascrizione ad opera della pol.II dellospite 3 RNA: * tradotto a dare proteine virali * impaccato nel capside (informazione genetica del virus)

RU5---------------U3R

genomic RNA

U3RU5-----------------U3RU5 LTR LTR

integrated provirus (DNA)

IRS: inverted repeat sequences LTR: long terminal repeats, segnali di regolazione. Forti enhancer, in grado di attivare la trascrizione di geni cellulari adiacenti allinserzione. NB: le sequenze promotrici sono al 3 sullRNA, al 5 nel DNA alterazione espressione geni cellulari adiacenti lintegrazione

Geni retrovirali:

gag (group antigen): codifica il nucleo proteico pol (polymerase): codifica la trascrittasi inversa per l enzima per lintegrazione provirale. env (envelope): codifica linvolucro glicoproteico.

i 3 geni sono processati a dare piu proteine attraverso diversi meccanismi molecolari: -reading frames diversi -splicing alternativi -tagli proteolitici delle proteine
lewin il geneVIII

esempio di retrovirus: HIV infetta e distrugge le cellule dei linfociti T

.conseguenze integrazione elementi retrovirali nel genoma della cellula ospite

come vettori per gene therapy

mutagenesi inserzionale ..proliferation

perch abbia successo bisogna avere:


*efficiente trasferimento genico alla cellula bersaglio *livello di espressione del transgene appropriato *mantenimento dellespressione genica nel tempo *espressione genica regolata *tolleranza immunitaria verso il prodotto del transgene *sicurezza

MoMLV based retrovirus:

PRO: alta efficienza infezione stabilit costrutto

CONTRO: infettano solo cells proliferanti mutagenesi inserzionale

vettori lentivirali: infettano anche cells quiescenti alti livelli di espressione no mutagenesi inserzionale

MUTAZIONE

cambiamento che altera la sequenza del DNA. La mutazione puo essere trasmessa alla progenie della cellula in cui si verifica. Mutazione in avanti Reversione

Selvatico (Wild type, wt)

Mutato (Mut.)

Mutazioni

GENOMICHE: alterano il numero cromosomico CROMOSOMICHE: alterano la struttura dei singoli cromosomi GENICHE: alterano la funzione dei singoli geni

Riarrangiamenti grossolani nel gene: delezioni, duplicazioni, inversioni

Mutazioni che interessano singole coppie di basi: mutazioni puntiformi AGeTC A T, G C, A C, G T Delezioni inserzioni coppie di basi

La conseguenza della mutazione negli organismi pluricellulari dipende da: -cellula in cui si verifica (somatica o germinale) -momento dell sviluppo in cui si verifica (precoce o tardivo) Progenie normale tessuto somatico tessuto germinale Progenie normale

Mutazione somatica Clone cellulare mutante

Progenie mutante Mutazione germinale

Mutazioni Somatiche avvengono in cellule somatiche e coinvolgono solo lindividuo in cui avviene la mutazione Mutazioni Germinali alterano i gameti e passano alla generazione successiva.
3

La conseguenza della mutazione negli organismi pluricellulari dipende da -cellula in cui si verifica: -germinale -somatica

-momento dello sviluppo in cui si verifica (precoce o tardivo)

sviluppo

Insorgenza precoce: maggior numero di cells mutate

La mutazione un evento raro che si verifica con frequenze variabili da gene a gene e nei diversi organismi

tasso di mutazione = probabilit di un particolare tipo di mutazione per generazione per un certo gene frequenza della mutazione nella popolazione = numero di volte in cui una

particolare mutazione si ritrova in una popolazione di cellule o individui

Mutazione in avanti: ordine di grandezza: 10-6-10-9 Reversione: ordine di grandezza 10-9 10-12 Piu rara !!!

MUTAZIONI GENICHE
Mutazioni puntiformi:
1. Sostituzioni di coppie di basi. GT AG TC AT GC AC e 2. Delezioni e inserzioni di coppie di basi

A carico di: -sequenze codificanti: conseguenze su STRUTTURA DELLA PROTEINA -sequenze regolative: conseguenze su DOVE, QUANDO, QUANTO il gene espresso
6

STOP

La mutazione inserisce un codone di STOP

mutazioni regolative
10
Pierce

Reversione: la soppressione della mutazione puo avvenire allinterno dello


stesso gene *Reversione allo stesso aminoacido ripristina la funzione Reversioni vere UCC (Ser) UGC (Cys) UCC (ser) Reversioni equivalenti UCC (Ser) UGC (Cys) AGC (Ser) *Reversione a un altro aminoacido ripristina parzialmente o pienamente la funzione

*II mutazione in un sito diverso dalla mutazione originale e maschera o compensa la mutazione originale senza ripristinare il tipo selvatico. ex: inserzione vicina ripristina il frame di lettura perturbato da una delezione o viceversa
NOTA BENE: la reversione un fenomeno talmente raro che si evidenzia praticamente solo nei microrganismi elevati numeri di individui-

11

Reversione: la soppressione della mutazione puo avvenire grazie ad una seconda mutazione che avviene in un gene diverso originariamente mutato

I mut. riduce efficienza produzione B

II mut. aumenta efficienza conversione B>C

Le 2 mutazioni si compensano
12

MUTAZIONI SPONTANEE E INDOTTE


Mutazioni spontanee: Errori della DNA polimerasi:
-errori di incorporazione durante la replicazione del Dna (che possono essere riparati dalla attivit proofreading della polimerasi stessa) -errori di allineamento (SEQ: RIPETUTE!!!)

Alterazioni chimiche spontanee


-Depurinazione: Comune; A o G sono rimossi e rimpiazzati con una base a caso -Deaminazione: Gruppo aminico rimosso da una base (C U); nel successivo giro di replicazione (CG TA) -Tautomerizzazione delle basi

Elementi trasponibili
13

Errori della DNA polimerasi:

Appaiamento errato
1:4

14

ERRORI DELLA DNA POLIMERASI: PIU FREQUENTI IN PRESENZA DI SEQUENZE RIPETUTE

15

Malattie da espansione di triplette nelluomo: un caso particolare di sequenza ripetute che costituiscono regioni di instabilit, la cui errata copiatura causa di malattia

16

ESPANSIONI ALTO NUMERO DI COPIE IN REGIONI NON CODIFICANTI


-DISTRUZIONE REGIONE CROMATINICA E ABOLIZIONE TRASCRIZIONE DEL GENE (STESSO EFFETTO DI MUTAZIONI CHE LO INATTIVANO, Ex: Xfragile) -CTG (distrofia miotonica) Ipotesi: lRNA CUG sequestra fattori di splicing utili per il processamento di altri trascritti (non sono note altre mutazioni inattivanti il gene legate alla malattia).

ESPANSIONI MODERATE SEQ. CODIFICANTI (CAGn)


* neurodegenerative a insorgenza tardiva

POLIGLUTAMINE

*non sono note altri tipi di mutazione associate alla malattia *la sequenza espansa trascritta e tradotta *soglia critica di n di ripetizioni associata allinsorgenza malattia *maggiore il numero di ripetizioni, piu precoce linsorgenza della malattia *?? formazione di aggragati proteici
17

NB: la presenza di mutazioni anche in DNA di cellule che non replicano -ex cells nervose, muscolari- suggerisce che la mutazione possa essere causata anche da meccanismi che non coinvolgono la replicazione del DNA

mutazioni indotte da mutageni fisici o chimici


MUTAGENI FISICI: RADIAZIONI (e.g., raggi-X, UV) radiazioni ionizzanti: elevata energia, rompono i legami covalenti nel DNA, causando
rottura di singolo o doppio filamento.

UV (254-260 nm): causa formazione di dimeri di purine e pirimidine adiacenti nella


catena del DNA.

18

MUTAGENI CHIMICI:
1) Analoghi di Basi Simili alle basi normali, incorporate nel DNA durante la replicazione, causano misappaiamenti (ex 5BrDu) e blocco della replicazione del DNA. - ex farmaci ANTITUMORALI

2) Agenti modificatori delle basi: la base modificata si appaia in modo scorretto


(Agenti deaminant,i idrossilanti, alchilanti)

19

3) Agenti intercalanti:

sottili molecole idrofobiche che si inseriscono tra coppie di basi adiacenti (e.g., proflavina, bromuro di etidio). Causano inserzioni/delezioni durante la replicazione del DNA.

Nota Bene:
*La mutazione spontanea e indotta, una volta generate, sono indistinguibili, quello che cambia levento che le ha generate *La possibilit di indurre elevate frequenze di mutazione grazie alluso di mutageni un prezioso strumento di analisi genetica in quanto la frequenza di mutazione spontanea molto bassa
20

Sistemi di riparazione del DNA

H. sapiens

FONDAMENTALI PER LA SOPRAVVIVENZA

Soprattutto negli eucarioti superiori (vita lunga, n divisioni cellulari altissimo) sono

-vede molti geni dedicati

-sistemi molto conservati evolutivamente

Lewin, Il gene zanichelli

21

La riparazione del DNA richiede:


-identificazione sito mutato
(DISTINZIONE DA PROCESSI FISIOLOGICI)

-segnalazione alla cellula

-blocco ciclo cellulare

-attivazione risposta

-decisione cellulare: -riparazione -bypass lesione -morte cellulare (apoptosi)

Attivazione programmi specifici


22

Meccanismi di riparazione del DNA:

Griffiths, Zanichelli

-RIPARAZIONE DIRETTA DEL DANNO ATTRAVERSO SISTEMI ENZIMATICI


Ex: DNA fotoliasi alchiltransferasi

-RIPARAZIONE PER EXCISIONE DI NUCLEOTIDI Eliminazione del DNA danneggiato e uso della sequenza complementare come stampo per la sintesi di nuovo DNA integro

23

La riparazione per excisione un meccanismo fondamentale di riparo anche nelluomo. Diverse malattie sono associate a malfunzionamento dei sistemi riparativi

24

identificazione geni coinvolti: analisi di complementazione su fibroblasti da pazienti XP diversi

Xp1

Xp2

Xp1

Xp3

fusione fibroblasti

fusione fibroblasti

UV

UV NON RIPARA

RIPARA

geni diversi

stesso gene

25

XPA

XPG

26

Xeroderma pigmentosum group A. XPA Xeroderma pigmentosum group B. XPB Xeroderma pigmentosum group C. XPC

Xeroderma pigmentosum group D XPD ERCC5

Xeroderma pigmentosum group E. DDB2 Xeroderma pigmentosum group F. ERCC4 Xeroderma pigmentosum group G. RAD2 ERCC5

Xeroderma pigmentosum variant. XPV PolH

Legend: The nucleotide excision repair pathway involves several different disorders including xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy and at least eleven genes.

27

E Coli

Problema: qual il filamento corretto? quello Metilato

MECCANISMO DI RIPARAZIONE POSTREPLICATIVO

La perdita/mutazione degli omologhi umani dei geni MutS, MutL, Muth coinvolta nellinsorgenza di una forma di tumore al colon

geni mutatori

28

Meccanismo SOS: sintesi translesione procarioti

SISTEMI ERROR-PRONE

SOS: Bypass della lesione che rimane e viene trasmessa alle cellule figlie eucarioti

Riparazione rotture doppio filamento


29

DANNO

RIPARO

SISTEMA DI RIPARAZIONE

MORTE CELLULA

ACCUMULO

30

31

http://www.weizmann.ac.il/Livneh/JNCI/intro.html

TUMORI

32

TUMORE: malattia genetica dovuta allaccumulo in un clone cellulare di mutazioni in geni che presiedono al controllo del bilanciamento fra proliferazione e differenziamento cellulare e che controllano lintegrit dellinformazione genetica

-oncogeni -oncosoppressori -geni implicati nella riparazione del DNA (mutator genes)

*Virtualmente le cellule di ogni tessuto possono dare origine a tumori eterogeneita

*Il tipo cellulare da cui ha origine il tumore ne determina levoluzione:

-velocita di crescita -capacita di colonizzare tessuti adiacenti -trasporto nel circolo sanguigno -capacita di colonizzare tessuti diversi (metastasi)

carcinomi epiteli sarcomi fibroblasti, ossa, muscoli, vasi linfomi, mielomi sangue

Tumore: accumulo di mutazioni allinterno dello stesso clone cellulare che porta a proliferazione incontrollata
2 meccanismi concorrono allaccumulo di mutazioni nella stessa cellula:

*insorgenza di mutazioni che conferiscono vantaggio proliferativo *mutazioni che riducono la stabilit genetica genetic instability accumulo mutazioni
tumore in situ tumore che invade tessuti circostanti disseminazione in tessuti e organi distanti metastasi

destino cellulare normale: differenziamento

Mutazione che conferisce vantaggio proliferativo Proliferazione clonale: clone amplificato= bersaglio per mutazioni successive

Origine clonale dei tumori

prove:

*Tumori femminili

Tutti i tessuti femminili sono mosaici per inattivazione di X Femmine eterozigoti G6PD (su X) hanno nei tessuti sani sia cellule sia cellule mentre i tumori sono o o

*traslocazioni

in alcuni linfomi

In alcuni tumori tutte le cellule presentano lo stesso riarrangiamento cromosomico caratteritico

ACCUMULO MUTAZIONI -oncogeni -oncosoppressori

-geni implicati nella riparazione e segregazione del DNA (mutator genes)

lewin gene VIII

Segnali attivatori

Equilibrio Proliferazione differenziamento

Segnali inibitori

Eccesso segnali proliferatori


Attivazione oncogeni

Proliferazione incontrollata

Perdita segnali inibitori


oncosoppressori

ATTIVAZIONE ONCOGENI:
Mutazioni acquisto di funzione dominanti

INATTIVAZIONE ONCOSOPPRESSORI:
Mutazioni con perdita di funzione recessive

TUMORE

quasi sempre.

VIRUS TRASFORMANTI: tumori virus a DNA virus a RNA


portano geni in grado di promuovere la trasformazione tumorale

*virus

a DNA: producono proteine che INATTIVANO GENI ONCOSOPPRESSORI

*virus

a RNA:

attivano pathways oncogenici

VIRUS TRASFORMANTI: tumor virus a DNA


POLYOMA, PAPILLOMA, ADENOVIRUS

virus a RNA

1919 Rous:virus del Sarcoma di pollo: prima dimostrazione che esistono GENI in grado di contribuire allinsorgenza di tumori

induce tumori in animali e trasforma cellule in coltura il genoma virale ha dimensioni ridotte identificazione gene responsabile induzione tumore: V-src (presente oltre a gag, pol env, costituisce differenza fra virus oncogeni e non)

1976:

Verma & Bishop: identificazione controparte cellulare: (per ibridazione con DNA genomico cellulare)

c-src

gli oncogeni virali derivano da geni cellulari catturati da virus

gene cellulare

genoma virale

NB: mancano introni!!

virus trasducenti defettivi

l integrazione di un gene di origine cellulare porta alla perdita di geni virali Il virus non e piu in grado di trasdursi a meno che la stessa cellula non venga infettata da un virus wt che fornisce le funzioni mancanti (virus helper)

delezione-fusione

mRNA di fusione gag-onc

virus trasducente defettivo

La maggior parte dei virus oncgeni sono defettivi: l integrazione di un gene di origine cellulare porta alla perdita di geni virali

Il virus non e piu in grado di trasdursi a meno che la stessa cellula non venga infettata da un virus wt che fornisce le funzioni mancanti (virus helper)

a) non trasformanti, hanno lunga latenza (per indurre tumore deve integrarsi in vicinanza
di protooncogeni cellulari, evento a bassa probabilita) (conferito dal v-onc)

b) virus defettivi, necessitano di un helper per riprodursi. Hanno potere trasformante c) si riproducono autonomamente e hanno potere trasformante (v-onc) ROUS

CLONAGGIO NUOVI ONCOGENI:


ricerca GENI capaci di *indurre trasformazione colture cellulari *indurre tumori in vivo
*crescono indefinitamente in coltura

immortalizzazione trasformazione

in coltura

*crescono in assenza di segnali mitogeni (fattori di crescita) *non risentono inibizione da contatto (segnali inibitori da cells vicine) formazione di foci

in vivo

*sviluppano tumori in topi nude

metastasi

*le cellule migrano a formare nuove colonie

IDENTIFICAZIONE DI ONCOGENI CELLULARI *BASATA SULLO STUDIO DEI RETROVIRUS


A) studio di retrovirus contenenti v-onc, in grado di *trasformare cellule in coltura
*indurre tumori in animali

ex v-src -retrovirus hanno genoma piccolo: facile identificazione v-onc: v-src -ibridazione con genoma cellula ospite identificazione c-onc: c-src -confronto v-onc vs. c-onc mutazioni oncogene mutazioni

che trasformano protooncogene src in oncogene

Protooncogene: gene cellulare che normalmente regola la proliferazione cellulare. A seguito di mutazioni gain of function si trasforma in oncogene in grado di concorrere allo sviluppo del tumore

B) clonaggio e studi di geni adiacenti nel genoma di cellule tumorali ad LTR virali

non trasformanti, hanno lunga latenza (per indurre tumore deve integrarsi in vicinanza di protooncogeni cellulari, evento a bassa probabilita)

*BASATA SULLO STUDIO DI CELLULE TUMORALI


C) isolamento da cellule tumorali delle sequenze di DNA con potere trasformante (che trasferite in cellule sane sono ingrado di trasformarle in cells tumorali)

il DNA di cellule tumorali contiene geni in grado di trasformare cellule in coltura e di indurre tumori in topi nude

isolamento sequenza responsabile oncogene

Approccio sperimentale:

sfrutta la presenza di sequenze ripetute Alu nel genoma umano, assenti nel topo ( marcano il DNA umano)

uso come probe per screening della libreria seq. Alu che permettono di recuperare DNA umano sequenza trasformante

prova: se il DNA isolato contiene l oncogene deve essere in grado di: * trasformare cellule sane se introdotto per transfezione *indurre tumori in topi nude.

ONCOGENI :
geni implicati nella trasmissione segnali mitogeni: -fattori di crescita -recettori per fattori di crescita -molecole trasduzione del segnale (chinasi associate alla membrana e citoplasmatiche) -fattori trascrizionali nucleari

v-scr ROUS

MECCANISMI DI ATTIVAZIONE DI ONCOGENI


( mutazioni che trasformano un protooncogene in oncogene) -in gene viene a trovarsi sotto il controllo di un LTR virale attivazione costitutiva (continua, anche in assenza di stimoli mitogeni), ad alti livelli -riarrangimenti -amplificazione genica (piucopie del gene= piu prodotto genico) -fusioni con proteine virali -traslocazioni (proteine di fusione) -mutazioni

LTR

il protooncogene acquista nuove funzioni oncogene

ex riarrangiamenti:
lo stesso gene ABL riarrangiato

ABL: codifica per una tirosina kinasi *nel virus defettivo leucemia murina di Abelson * a seguito di traslocazione in leucemie umane traslocazione 9:22 CROMOSOMA PHILADELPHIA

proteina di fusione gag-abl proteina di fusione bcr-abl

glivec

ex: overespressione

MYC, FATTORE TRASCRIZIONALE NUCLEARE

overespresso in *leucemia aviaria in cui finisce sotto il controllo dellLTR virale *leucemia umane traslocazione 8:14 linfoma Burkitt sotto il controllo enhancer Immunoglobuline (espresse solo in cells B)

NB: il primo esone di myc non tradotto, quindi entrambi i riarrangiamenti (in cui viene perso il primo esone) portano alla produzione di proteina myc normale MA a livelli costitutivi -indipendenti da stimoli mitogeni- ed elevati

ATG

ex1

ex2

ex3

deregolazione di myc

Reflecting on 25 years with MYC Natalie Meyer and Linda Z. Penn dec 2008

mad

mad MAX reprime geni proliferazione attiva proliferazione

MAX

MAX

DNA polymerasi,cycline, etc.

myc

myc MAX

stimoli mitogeni

NB: myc mRNA e proteina sono fortemente instabili, per avere laccumulo necessario uno stimolo mitogeno sostenuto e persistente
leterodimero mad max reprime i target attivati da myc max equilibrio proliferazione/differenziamento

nella traslocazione 8:14 myc finisce sotto il controllo del locus Igg, che va incontro a ipermutazione somatica *myc oltre ad essere overespresso puo accumulare mutazioni *le diverse mutazioni myc determinano diverse caratteristiche della leucemia ex: minore latenza e maggiore penetranza

Igg

Myc WT

proliferazione p53

tumore II evento (perdita 53)

I evento

richiede 2 eventi

tumore perch myc insensibile al controllo da p53 Igg Myc MUT. I evento

basta 1 evento

Reflecting on 25 years with MYC Natalie Meyer and Linda Z. Penn nat. rev cancer 2008

ex mutazioni: ras, protein kinasi

proliferazione

costitutivamente attiva

ex mutazioni

oncogeniche di recettori per fattori di crescita

Recettore tronco costitutivamente attivato in assenza di ligando

dimerizzazione costitutiva in assenza di ligando

de carli genetica generale e umana

GENI

-fattori di crescita -recettori per fattori di crescita -molecole trasduzione del segnale (chinasi associate alla membrana e citoplasmatiche) -fattori trascrizionali nucleari

MUTAZIONI

COOPERAZIONE FRA ONCOGENI: (myc + ras mut.)

*nella trasformazione cellulare

* in vivo nel topo

La mutazione contemporanea di piu oncogeni accelera la progressione tumorale


MouseMammaryTumorVirus

50

25

100

topi transgenici

oncogeni: forme attivate di geni cellulari che da soli o cooperando con altri geni inducono tumori implicazione: lattivazione del gene ha effetto dominante

MA
alcune evidenze suggeriscono che esistono elementi genetici nella cellula normale in grado di ripristinare funzione defettiva nella cellula tumorale fusione di cellula tumorale con cellula normale: *risponde a fattori di crescita *non da tumori in animali

WT

esistono geni ONCOSOPPRESSORI, persi nella cellula tumorale


T1 T2 fusione fra 2 cellule da tumori diversi: *risponde a fattori di crescita *non da tumori in animali COMPLEMENTANO

esistono piu geni ONCOSOPPRESSORI

WT

se lintroduzione di un allele funzionante ripristina la funzione deduco che nella cellula tumorale entrambi gli alleli devono essere persi

microcellula contenente un unico cromosoma

mutazione loss of function di entrambi gli alleli


linattivazione puo avvenire attraverso meccanismi diversi: * mutazioni funzionali * delezioni regione contenente il gene WT WT Mut. WT Mut. del.

ex.

II

Modello di gene oncosoppressore: RETINOBLASTOMA, Rb

60% casi: *sporadico (non famigliare) *unilaterale *insorgenza in et adulta

40% casi: *famigliare *autosomico, DOMINANTE*, alta penetranza *bilaterale, con piu tumori indipendenti *insorgenza in et pediatrica *i pazienti sviluppano spesso osteosarcomi

Forma sporadica: sono necessari 2 eventi di mutazione nella stessa cellula a carico dei
2 alleli Rb bassa probabilit, evento raro (monolaterale, et adulta) Mut. WT II evento Mut. del. WT WT

+/+

I evento

+/-

-/-

Forma ereditaria: tutte le cellule ereditano gi un allele mutato (+/-) e quindi basta un
Mut. solo evento di mutazione che distrugga lallele Rb in una qualsiasi delle cellule della retina (bilaterale, et precoce) Mut. del. NB: la trasmissione della malattia DOMINANTE ma I evento a livello cellulare devo perdere i 2 alleli: RECESSIVO -/WT

-/+

ereditato gi mutato da tutte le cellule

Meccanismi di perdita dellallele sano

oppure silenziamento oncosoppresore per meccanismi epigenetici

CLONAGGIO DEL GENE RB COME SCHEMA GENERALE PER CLONAGGIO DI GENI ONCOSOPPRESSORI
*studi citologici per definire la regione minima di delezione comune in pazienti diversi regione in cui si trova loncosoppressore

gene oncosoppressore

T1 T2 T3 WT per Rb, 5-10% dei tumori ereditari hanno delezioni nella regione 13q14

perdita di eterozigosi, LoH: confronto fra tessuto sano e malato DELLO STESSO
ex: ho a disposizione un pannello di 4 marcatori (L1-L4) distribuiti sul cromosoma 13 che sono presenti allo stato eterozigote nellindividuo in esame

INDIVIDUO per la perdita di eterozigosi di loci polimorfici a posizione NOTA sul genoma

cellule sane:eterozigoti Locus1 locus2 locus3 locus4

confronto

cellule malate: omozigoti per L1 e L2

il gene oncosoppressore vicino ai loci L1 ed L2 (la perdita di un loro allele coincide con linsorgenza del tumore) conoscendo la posizione di L1 e L2 nel genoma risalgo alla posizione delloncosoppressore
delezione

loncosoppressore sta qui!

I +/+ +/-

II -/-

*posso partire da un pannello di marcatori che coprono tutto il genoma *maggiore la densit di marcatori, piu preciso il mappaggio

PAZIENTI DIVERSI

marcatori possibili: *isoforme proteina (poche) *polimorfismi di restrizione *SNP: polimorfismi singolo nucleotide

RB: controllo del ciclo cellulare: entrata

in fase S

RB -/- cells

virus a DNA

ex myc timidina kinasi DNA polimerasi

cicline D ed E: controllo G1>S ciclina D: dipendente da mitogeni, agisce su Rb ciclina E: progressione irreversibile, svincolata da mitogeni

*Mutazioni in p53 sono implicate in ~50% dei tumori umani, tra cui: seno, cervello, fegato, polmoni, colon retto, vescica, e sangue *Lo sviluppo dei tumori richiede mutazione nei due alleli p53. *Codifica una proteina di 393 aa coinvolta nella trascrizione, nel controllo del ciclo cellulare, nella riparazione del DNA e nellapoptosi. *p53 interagisce con numerose altre proteine, agendo come controllo superiore del checkpoint

p53

forma ereditaria di perdita di un allele di p53 sindrome di Li-Fraumeni: insorgenza precoce vari tumori

Modello murino : topi p53-/- nascono ma sviluppano tumori 100% casi entro 10 mesi di et topi transgenici che overesprimono p53 invecchiamento precoce

p53 induce apoptosi *in modo diretto (attivando e reprimendo geni) *in modo indiretto

p53 attiva la trascrizione di bax reprime trascrizione bcl2

bax

bax

apoptosi

bax bcl2 bcl2 bcl2 proliferazione

p53 attiva mdm2 che ne media la degradazione via ubiquitinazione


meccanismo di inattivazione della risposta da p53
mdm2: oncogene amplificato in tumori. Se overespresso degradazione p53 tumori

myc

oncogeni!!

p53 indotto da myc : spegnimento del segnale mitogeno!

myc

P53 lega il DNA come omotetramero

*le mutazioni che inattivano p53 nei tumori sono di varia natura *alcune hanno effetti specifici sulle funzioni diverse di p53 apoptosi arresto ciclo cellulare Mut dominanti negative

Mut. Wt

Haplo-insufficiency increases the probability of completing a multistep tumorigenesis pathway Kim C. Quon et al. Genes Dev. 2001; 15: 2917-2921
perdita 1 allele

perdita 2 allele

permette espansione clonale> maggiore probabilit ulteriori mutazioni

tumori ereditari Haplo-insufficiency increases the probability of completing a multistep tumorigenesis pathway. Strong (A) or partial (B) haplo-insufficiency allows cells that are heterozygous for a tumor suppressor gene to undergo clonal expansion. This increases the size of the target cell population available to complete a multistep tumorigenesis pathway, and thus greatly increases the probability of tumors occurring. For partially haplo-insufficient tumor suppressor genes (B), loss of the remaining tumor suppressor gene allele (loss of heterozygosity, LOH) is required to complete tumorigenesis. (C) In the absence of haplo-insufficiency, no clonal expansion of heterozygous cells occurs, and therefore insufficient numbers of cells are available to complete the pathway, and tumors fail to occur or only rarely occur. (D) In familial cancers, all cells are heterozygous to begin with, and therefore no clonal expansion is necessary to increase the size of heterozygous target cell population. Therefore, tumors can arise even in the absence of haplo-insufficiency. Cells carrying two wild-type alleles of a tumor suppressor gene are shown in white; heterozygous cells with one mutant allele are in light pink; tumor cells with one or two mutant alleles are in dark pink; (X) mutant tumor suppressor alleles.

INSTABILITA GENOMICA E TUMORI


-caratteristica comune delle cellule tumorali *INSTABILITA CROMOSOMINCA (CIN): *CARIOTIPO ANOMALO (aneuploidia, riarrangiamenti grossolani) *perdita controllo spindle checkpoint (ex, APC) *replicazione del DNA anche in presenza di danno (geni che codificano per proteine che servono alla riparazione del DNA, ATM/ATR, BRCA1, BRCA2) *telomeri *INSTABILITA MICROSATELLITI (MIN): associata ad errori nel Mismatch repair (MMR)

95% HNPCC Hereditary Non Polyposis Colonrectal Cancer: mutazioni nei geni MLH1&2

perdita 2 alleli geni NER + evento mutageno esterno

perdita 2 alleli per geni del mismatch repair

perdita controllo mitotic spindle checkpoit

spindle checkpoint

signal transduction DNA repair mismatch repair

angiogenesi

MODELLO MULTISTEP DI EVOLUZIONE TUMORALE

vertebrati: vita lunga necessit di avere continua proliferazione cellulare sviluppo (1014 cells) mantenimento riparo

costo= tumori

rischio aument con et rischio maggiore per tessuti ad alta rigenerazione

MECCANISMI CHE LIMITANO LESPANSIONE


Dipendenza da segnali mitogeni per la proliferazione: perch una cellula POSSA DIVIDERSI deve: *essere esposta a segnali mitogeni prolungati+ segnali specifici (ex. contatti cellula-cellula) *superare segnali antiproliferativi (ex. TGF, interferoni) *contrastare il pathway differenziativo di default *riuscire a contrastare esaurimento nutrienti (ex richiamando nuova angiogenesi) *aggirare il segnale di senescenza dato dallerosione dei telomeri *essere in grado di migrare nei vasi e di attecchire in tessuti diversi da quello di origine

SENESCENZA: blocco in G1 di cellule vitali, insensibili ai mitogeni. Puo essere indotta da oncogeni

PUNTI di controllo:

checkpoints (riparazione, apoptosi, senescenza) eliminazione cellule precancerose (anossia) pressione selettiva cellule circostanti pressione selettiva tessuti diversi

TUMORI possono originarsi da cellule staminali o da progenitori che riacquistano capacit di self renewal a scapito della capacit di differenziare

stessi pathways che controllano stem cell self renewal sono spesso attivati in tumori

tumori eterogenei contengono poche cancer stem cells capaci di automantenersi e differenziare parzialmente. Queste cellule sono le uniche in grado di trasferire tumore

ex AML: cells CD34+CD38- (HSC), trasferiscono AML in topi nude cells CD34+CD38+ (piu differenziate) NON trasferiscono tumore

.cercare di colpire le cellule staminali tumorali da cui origina il tumore implicazione per la terapia piuttosto che le cellule tumorali che da esse si originano !!

EPIGENETICA E TUMORI
CROMATINA ATTIVA: Iperacetilata e ipometilata Il reclutamento di deacetilasi istoniche e di altri complessi richiama

DNA metiltransferasi

DNA viene metilato

CROMATINA SILENZIATA (non trascritta)

IN MOLTI TUMORI SI HA PERDITA DI CONTROLLO DELLA METILAZIONE:


*silenziamento oncosoppressori per ipermetilazione *attivazione di oncogeni dovuta a demetilazione *mancata metilazione seq. controllano segregazione segregazione aberrante *mutazioni puntiformi causate da deaminazione di sequenze metilate

Mut. puntiformi

segregazione aberrante

silenziamento oncosoppressori

attivazione oncogeni

Cellule normali: metilazione concentrata su sequenze ripetitive del genoma e isole CpG dei promotori sono solitamente non metilate Cellule tumorali: non c compartimentalizzazione della metilazione DNA ripetitivo non metilato, promotori metilati (silenziati)

MICRO RNA E TUMORI


*there is altered expression of miRNA genes in several human malignancies, including chronic lymphocytic leukemia, pediatric Burkitts lymphoma, gastric cancer, lung cancer, and large cell lymphoma * tumori stessa origine hanno lo stesso pattern di miR alterati (ex gastrici, liver, colon endoderma) *13q31-32: regione amplificata in linfoma, codifica per miR (He, NATURE2005) coopera con myc: tumori con minore latenza e maggior penetranza in topi trapiantati con cellule che overesprimono myc (E-myc) e la regione amplificata rispetto a cellule che overesprimono solo myc attiva E2F (progressione ciclo cellulare) attiva miR che reprime traduzione E2F controllo fine
miR

*myc (oncogene) (ODonnel, Nature 2005)

myc
E2F
E2FmRNA

http://dx.doi.org/10.1016/j.cell.2005.06.036

Singola cellula uovo fertilizzata

intero organismo

? Come si originano lasimmetria e la specializzazione cellulare?

Quali processi agiscono nello sviluppo ?

- mammiferi: zigote omogeneo e specializzazione successiva - Drosophila: cellula uovo gi asimmetrica ..ma fondamentalmente gli stessi pathways e gli stessi meccanismi sono comuni fra Drosophila e mammiferi

la proteina di Drosophila vicaria lassenza di quella murina in topo


Proteine omologhe in organismi diversi svolgono essenzialmente le stesse funzioni

LOGICA GENETICA ALLA BASE DEI MECCANISMI DI CONTROLLO DELLO SVILUPPO: Cascata di eventi che specificano progressivamente il patrimonio trascizionale (identit) della cellula differenziata Attuazione programma trascrizionale specifico per ogni cellula
Gene A, espresso in cellule eritroidi Gene B, espresso in cellule epatiche Gene C, espresso in cellule muscolari

Il repertorio di fattori trascrizionali espresso in una data cellula determina il programma trascrizionale che essa in grado di attuare

Regolatori della trascizione sono i Fattori trascizionali

Lo stesso gene puo essere espresso in tessuti diversi sotto il controllo di sequenze regolative composte da siti per TF diversi

CONTROLLO COMBINATORIO
* Ogni gene controllato da una combinazione di fattori trascrizionali che ne legano le seq. regolative (riconoscono le proprie sequenze consensus -ex AGATAAG-) *Alcuni fattori trascrizionali sono ubiquitari, alcuni tessuto-specifici (T.S) *Un fattore trascrizionale puo controllare decine di geni (agisce in trans)

CASCATA

Il repertorio di fattori trascrizionali espresso in una data cellula determina il programma trascrizionale che essa in grado di attuare Ad ogni stadio dello sviluppo e del differenziamento cellulare vengono espresse combinazioni diverse di fattori trascrizionali

Lo sviluppo di un determinato organo puo essere visto come lattuazione di una cascata di programmi trascrizionali, da una cellula piu indifferenziata ad una piu specializzata.
Ex: sistema emopoietico

Risalendo la cascata, si arriva.. Allo zigote, totipotente

REGOLATORI

Circuiti integrati di trasduzione del segnale che convergono su fattori trascrizionali che -in cascataattuano programmi trascrizionali specifici BERSAGLI globulo rosso

Catene Globiniche

CORREDO genetico dello sviluppo:


-ristretto gruppo di geni che controllano sviluppo -la maggior parte sono

*FATTORI TRASCRIZIONALI *COMPONENTI VIE TRASDUZIONE DEL SEGNALE -lespressione spazio-temporale di questi geni quasi sempre strettamente correlata con le regioni in cui questi geni agiscono -molti di questi geni sono altamente conservati fra i diversi phyla animali

Come due cellule uguali possono diversificarsi e specializzarsi a fare cose diverse?

repressione induzione

2 segnali ambientali che provengono da cellule vicine: REPRESSIONE

Inibizione reciproca:

Piccole fluttuazioni casuali

Le cellule che riescono ad inibire maggiormente le cellule vicine rafforzano la propria specializzazione e impediscono alle vicine di assumere la stessa specializzazione

epidermide

Cell sensoriale: setole

Delta inattivato in un gruppo di cellule: non c inibizione laterale > tutte cellule fanno Peli sensori

RISULTATO: PATTERN REGOLARI penne pollo

baffi topo Tabin C. occhi insetti ..ETC..

Nature, Zelhof et al

2 segnali ambientali che provengono da cellule vicine:

INDUZIONE

Ex: WNT, egf, fgf


LIGANDO RECETTORE TRASDUTTORE SEGNALE FATTORE TRASCR.

GENI BERSAGLIO

DI INTERI CAMPI DI CELLULE

MORFOGENI: INDUTTORI CHE CONTROLLANO IL DESTINO CELLULARE


COME SI CREA UN GRADIENTE DI MORFOGENO che definisce territori cellulari diversi?

SVILUPPO DEI PIANI CORPOREI DI DROSOPHILA -asse anteroposteriore -asse dorsoventrale

Controllo genetico dei primi eventi di specializzazione cellulare/sviluppo

schiusa

Luovo fecondato si sviluppa attraverso una fase di sincizio seguita dalla formazione di cellule separate e dalla formazione di cellule primordiali germinali

L ORGANIZZAZIONE CORPOREA SEGMENTALE

ORGANIZZAZIONE CORPOREA SEGMENTALE segmenti: -testa -torace -addome

larva a 10 h dopo fecondazione programma di segmentazione definito

ogni segmento presenta: -compartimento anteriore A -compartimento posteriore P

parasegmenti: -sfalsati di un compartimento

Come si identificano i geni che controllano le prime fasi dello sviluppo?

MUTANTI

-Letali embrionali precoci

geni espressi nelloogenesi (MATERNI) e nello zigote (ZIGOTICI)

-Alterazioni struttura embrione

geni che controllano numero e polarit dei segmenti (gap, pair rule, segment polarity)

-Mutanti con alterazioni in strutture corporee specifiche

geni che controllano identit dei segmenti geni selettori (OMEOTICI)

VISUALIZZAZIONE ESPRESSIONE GENICA NELLO SVILUPPO - mRNA -proteine

Strumenti molecolari per visualizzare -mRNA -proteine

hairy in red Kruppel in green giant in blue

www.bio.davidson.edu/.../fly/embryred.jpeg

B C

TRAPIANTI

ESPRESSIONE ECTOPICA

Gene territorio specifico eyless (Pax6)

OVERESPRESSIONE

testa

GENI REPORTER iniezione /transfezione

Ftz eve

MUTANTI

-Anteriore -Posteriore -Terminali

Fenotipo mutanti geni che controllano parti:

Non si formano

MADRE DA 4 COORDINATE INDIPENDENTI NELLUOVO:


UOVO STRUTTURA ASIMMETRICA -Anteroposteriore : -SISTEMA ANTERIORE gradiente bicoid -SISTEMA POSTERIORE (addome) nanos -Sistema terminale: coda e testa Torso -Dorsoventrale: Toll receptor Dorsal

DEFINIZIONE ASSE CORPOREO: ANTERO-POSTERIORE


-alcune informazioni di base sono gi contenute nelluovo Evidenza genetica: Femmine bicoid -/EFFETTO MATERNO

uova che producono embrioni morti anche se maschio bicoid +

Non c bicoid nelluovo Evidenza molecolare: il trascritto gi presente nelluovo

.alcune informazioni di base sono gi contenute nelluovo, MA GENI ZIGOTICI

-altre informazioni invece devono essere presenti nello ZIGOTE Evidenza genetica: ex engrailed, richiesto per la segmentazione ZIGOTE -/- MUORE

Evidenza molecolare: il trascritto presente nello zigote ma non nelloocita

GENI EFFETTO MATERNO: BICOID

Gradiente di bicoid inibito nella parte posteriore da nanos

overespressione

testa

Le cellule del follicolo in cui luovo si sviluppa forniscono i segnali materni

Il principale gene attivato da bicoid e represso da nanos bicoid lega in modo cooperativo il promotore hunckback hb (il legame ad un sito facilita quello al sito Attiva trascrizione blocca successivo)
traduzione

solo dove c tanto bicoid si attiva hb

Bicoid

Nanos

Bicoid: -attiva trascrizione hunchback -reprime traduzione Caudal Nanos: -reprime traduzione hunchback

I livelli relativi di Bicoid, Caudal e hunchback lungo lasse dellembrione determinano lespressione dei geni GAP lungo lasse dellembrione

SEGMENTI

A: Hb alto bicoid alto P: Caudal alto Nanos alto

gradienti materni Geni GAP: organizzazione in regioni generali, ex. Krupper Pair rule: agiscono su segmenti alterni: -even skipped, hairy: pari -fushi tarazu, odd: dispari

Polarit segmantale: organizzazione interna dei segmenti: -gooseberry -engrailed

WT

MUT

anticorpo

Gene reporter (b-gal) sotto il Controllo delle seq. Regolative di engrailed

Espressione di engrailed: polarit dei segmenti

gradiente materno + geni gap (regioni generali) definisce strisce discrete

? come ?
controllo indipendente di elementi in cis che regolano un gene (ex even skipped)

A R

Il segmento caratterizzato da un specifica concentrazione relativa di fattori trascizionali (Giant, bicoid, Kr) che riconoscono siti di legame sulla regione regolativa che dirige lespressione del gene target (EVE) in quel segmento R striscia 2: Hb++ e bicoid+ Giant- Kruppel-

Gerarchia della segmentazione

-risposta concentrazione dipendente a informazioni presenti come gradiente

-azione integrata di attivatori e repressori che delimitano la regione di espressione del gene target -meccanismo combinatorio: diverse combinazioni di attivatori e repressori controllano geni diversi -combinazioni di fattori trascrizionali (trans) -combinazioni di sequenze regolative (cis)

Sistema gerarchico di specificazione progressiva

Numero e orientamento dei segmenti

Numero e orientamento dei segmenti


Identit dei segmenti

Geni GAP GENI OMEOTICI

UBX reprime geni per lala in T3

Mutante Ultrabithorax: Ubx assente in T3

Trasformazione T3 (altere) in T2 (ali)

Antennapedia: zampe al posto delle antenne

espressione ectopica di Antp

http://zygote.swarthmore.edu/droso4.html

Casares and Mann showing that if they added the mouse homologue of extradenticle to the anal precursor precursor develops into an antenna. Since extradenticle mutant legs were produced in flies that lacked wildtype thoracic), wherein Antennapedia represses head-forming genes. (This plan is then modified by Scr which promotes athoracic development in the third thoracic segment). In dominant Antennapedia mutants, the homothorax gene in the h formation of legs.

antennal versus leg development in Drosophila. Nature 392: 723 - 726. a fly's leg. Nature 392: 657 - 658.

W. J. 1987. Molecular analysis of the dominant homeotic Antennapedia phenotype.EMBO J. 6: 201 - 206. a leg into an antenna in Drosophila. Nature 292: 635 - 638.

Eyeless (pax6):

se assente - non si forma locchio espressione ectopica: -struttura oculare sulla zampa

Analogamente pax6 regola la formazione dellocchio in molti organismi

aniridia

MAN

CAT

MOUSE

FATTORI TRASCRIZIONALI: -HOMEODOMAIN 60AA 5 -ESPRESSI COLINEARMENTE: antero posteriore 3

The vertebrate homeotic complex comprises four distinct Hox gene clusters (Hox A, B, C, D)

COME LALTERAZIONE DELLESPRESSIONE DEI DETERMINING GENES PUO INFLUENZARE LA DIVERSITA MORFOLOGICA *ALTERAZIONE REGIONE DI ESPRESSIONE *ALTERAZIONE DOMINI FUNZIONALE DELLA PROTEINA *ALTERAZIONE SEQUENZE REGOLATRICI

DIVERGENZA

REGIONE CODIFICANTE REGIONE REGOLATIVA

Diversificazione del piano strutturale generale e dei segmenti corporei Spostamento spaziale dei confini di espressione dei geni Hox!

*ALTERAZIONE REGIONE DI ESPRESSIONE

VERTEBRE CERVICALI

VERTEBRE TORACICHE

The Origins of Form

Ancient genes, recycled and repurposed, control embryonic development in organisms of striking diversity

By Sean B. Carroll

HOXc6 serpente

pollo

Hox genes determine the form, number, and evolution of repeating parts, such as the number and type of vertebrae in animals with backbones. In the developing chick (left), the Hoxc-6 gene controls the pattern of the seven thoracic vertebrae (highlighted in purple), all of which develop ribs. In the garter snake (right), the region controlled by the Hoxc-6 gene (purple) is expanded dramatically forward to the head and rearward to the cloaca.

*ALTERAZIONE DOMINI FUNZIONALE DELLA PROTEINA ..perch gli insetti non hanno arti addominali Ubx di insetto e artropode hanno C-ter diverso Ubx di insetto reprime

Ubx di artopodo NON reprime

drosophila

NB: nel torace degli insetti lespressione di Dll e Ubx non si sovrappongono temporalmente

Dll, che specifica per gli arti

Dll

T1 T2 T3

crostaceo

Ubx di insetto

Ubx di artropode

espressione ectopica di Ubx insetto e artropode in torace di drosophila

*ALTERAZIONE SEQUENZE REGOLATRICI che riconoscono il fattore trascr. Ubx reprime II paio di ali negli insetti

NON reprime nei lepidotteri e coletteri

perch sono mutate le sequenze target

Homeotic Genes and the Evolution of Anthropods and Chordates by Sean B. Carroll Figure 4 (from page 78 of Shaking the Tree: Readings from Nature in the History of Life edited by Henry Gee)

Asse dersoventrale

Dorsal

Gradiente nucleare

Sog, laterale snail

zen

GENETICA DEL SISTEMA IMMUNITARIO Assicura protezione contro infezioni provocate da virus, batteri, funghi Riconoscimento aggressione estranea Attivazione cellule appropriate Eliminazione agente estraneo RISPOSTA ASPECIFICA : INFIAMMATORIA COMPLEMENTO

RISPOSTA SPECIFICA: CELLULE B T

Sistema del complemento: Risposta infiammatoria

complementano lazione del sistema immunitario.

20 proteine sintetizzate nel fegato poi rilasciate nel sangue dove si attivano in presenza di infezione lisi batteri attirano fagociti

RISPOSTA SPECIFICA cellule B: produzione anticorpi

T killer: riconoscono e uccidono cellule infette T helper: stimolano proliferazione cellule B e Killer

T soppressori: attenuazione della risposta B e T di memoria: assicurano maggior efficacia nella risposta a seguito di una seconda esposizione allo stesso antigene Macrofagi:inglobano agenti infettanti e processano i loro antigeni presentandoli alle cellule B e T helper

antigene: sostanza esogena in grado di indurre la produzione di anticorpi

(tipicamente, proteine e polisaccaridi derivanti dallagente infettante)

SPECIFICITA DELLA RISPOSTA SI BASA SU:

ANTICORPI, PRODOTTI DALLE CELLULE B

RECETTORI DELLE CELLULE T

superfamiglia delle immunoglobuline

2 catene leggere 2 catene pesanti

parte variabile superficie di riconoscimento dellantigene (>1010 antigeni diversi) -parte variabile catena leggera e pesanteparte costante funzione effettrice diversi tipi di risposta

IgM: risposta precoce primaria

sistema digerente, lacrime, latte


cummings Eredit

IgG: primaria e secondaria

Funzione effettrice diversa, stesso antigene riconosciuto

IgG

IgM

derma, tonsille implicate allergie

IgA IgE

Switch di classe durante la risposta

Come agiscono gli anticorpi

cummings Eredit

NB: una

cellula B produce un solo tipo di anticorpo

(NB:, cfr esclusione allelica!)

produzione di immunoglobuline

eliminazione cells B autoreattive incontro con antigene

rilascio nel circolo sanguigno: quiescenza ESPANSIONE CLONALE del clone la cui IgM riconosce lantigene secrezione IgG

DeCarli Genetica Generale e Umana

Switch di classe: passaggio alla produzione di IgG, IgE, IgA con stessa specifit per antigene e diversa funzione effettrice

maturazione Ig memoria

Da dove deriva la capacit di generare un repertorio di anticorpi in grado di riconoscere un numero di antigeni praticamente illimitato?
-RICOMBINAZIONE SOMATICA dei loci codificanti per le immunoglobuline -VARIABILIT NEI SITI DI RICOMBINAZIONE -IPERMUTAZIONE SOMATICA

VARIABILITA 250VH 10D 4JE= 250x10x4= 10000 catene pesanti H 250VK 4JK= 250x4 = 1000 catene leggere K 2V 3J = 6 catene leggere

107 combinazioni H x L

con i meccanismi aggiuntivi (riarrangiamenti giunzione e ipermutazione somatica)

1010

DeCarli Genetica Generale e Umana

Uomo: cr.14=catene pesanti H cr. 2 =catene leggere K cr.22=catene leggere

DNA dei loci IGG riarrangiato nelle cellule B rispetto alla linea germinale

RICOMBINAZIONE SOMATICA

CATENA PESANTE

la ricombinazione fra sequenze con spaziatori diversi (12 o 23) impone ordine VDJ, impedendo che vengano saltati i frammenti D

CATENA LEGGERA

VARIABILITA 250VH 10D 4JE= 250x10x4= 10000 catene pesanti H 250VK 4JK= 250x4 = 1000 catene leggere K 2V 3J = 6 catene leggere

107 combinazioni H x L

con i meccanismi aggiuntivi (riarrangiamenti giunzione e ipermutazione somatica)

1010

anche migliaia di basi!

struttuta riconosciuta dalle proteine che effettuano il taglio (Rag1 & Rag2)

1 giro di elica

2 giro di elica

rag1/rag2
catalizzano i riarrangiamenti somatici Ricombinazione VDJ che permettono la formazione degli anticorpi. Agiscono tagliando specifiche sequenze di DNA RSS che fiancheggiano gli elementi V, D,J. RAG1 simile agli elementiTransib (trasposoni di invertebrati)

conservazione aa

conservazione RSS

http://biology.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pbio.0030181

Variabilit al sito di giunzione


persi o aggiunti

se il riarrangiamento non in frame, presumibilmente viene introdotto uno STOP a valle > riarrangiamento non produttivo

IPERMUTAZIONE SOMATICA

activation-induced cytidine deaminase (AID)= durante trascrizione deamina la citosina (C>U) sul DNA. Se DNA viene replicato CG> TA

RIPARAZIONE: *corretta, BER> CG * creazione sito abasico ad opera di Uracil-N glicosilasi > sito abasico > inserzione base a caso * mismatch repair, error prone >A oT

NB

Tutte le IGG possono essere in membrana o essere secrete

GENI PER LE CATENE PESANTI: splicing alternativo x selezione Igg

*di membrana *secrete

poliA alternativi

SWITCH DI CLASSE:
*splicing alternativo SOLO per IgM e IgD, le uniche a poter essere coespresse sulla stessa cellula

*RIARRANGIAMENTO DEL DNA

IgM

IgD

*IRREVERSIBILE *INDOTTO DA SEGNALI SPECIFICI nel corso della risposta

*tipo antigene *tipo T helper *interazione con altre cellule del sistema immunitario

RIARRANGIAMENTO DEL DNA

IgE IgA

Ziqiang Li et al. Genes Dev. 2004; 18: 1-11

Figure 2. Model of class switch recombination

S: promotori attivati

differenzialmente nella risposta

fanno partire trascritti sterili che richiamano fattori/cofattori che mediano il taglio del DNA

ESCLUSIONE ALLELICA: ogni cellula produce un solo tipo di anticorpo


Chr 2 Lk Chr 14 H Chr 22 L

M P

M P

M P

..ma ogni cellula possiede 2 alleli (di origine materna, M e paterna P) per ciascun locus

Riarrangiamenti casuali in successione temporale in cui un riarrangiamento produttivo + blocca lulteriore riarrangiamento sullaltro allele (che viene escluso)

le cellule B in cui non si verificano riarrangiamenti produttivi per una catena H e una catena L, vengono eliminati

CELLULE T: presentano un TCR T Cell Receptor che riconosce lantigene presentato insieme ad una molecola MHC

MHC: complesso maggiore di istocompatibilit, topo HLA: human leucocyte associated antigen, uomo

MHC I antigeni da trapianto: espressi su tutte le cellule, permettono riconoscimento MHC II: espressi su linfociti B e macrofagi: riconosciuti da linfociti T helper>
attivazione risposta self/non self da parte dei linfociti killer. Riconoscimento di ogni cellula dellorganismo che viene infettata

no TRC

riconoscono troppo il self non riconoscono self

riconoscono poco il self: riconosceranno il proprio MHC solo se associato a antigeni esterni

MHC: complesso maggiore di istocompatibilit, topo HLA: human leucocyte associated antigen, uomo

superfamiglia immunoglobuline

MHC

* allelismo multiplo * siti molto polimorfici * codominanti microrganismi: evoluzione peptidi che non complessano MHC

elevata variet nella popolazione

sistema immunitario: evoluzione continua di nuovi polimorfismi

linkage disequilibrium: forte associazione allelica differenziale (combinazione alleliche con frquenza maggiore dellatteso) che presumibilmente conferisce protezione contro un dato antigene

chr 6 M chr 6 P

chr 6 M chr 6 P

aplotipo A3B18C2D1 ogni individuo 2 aplotipo A9B21C3D6 2 aplotipi HLA

chr 6

esistono *molti geni HLA *ogni gene HLA ha molti alleli codominanti (ex A1..A9) gemelli monozigotici > identici milioni di combinazioni alleliche diverse

fratelli (vedi ex) 25% probabilit di essere compatibili estranei: bassissima (nulla) probabilit <1/200.000

APLOTIPO: combinazione genotipica degli alleli sul cromosoma

SUCCESSO TRAPIANTI: compatibilit HLA fra donatore e ricevente HLA: antigeni da trapianto

MHC estraneo + peptide proprio

se somiglia a

MHC proprio + peptide estraneo

reazione immuntaria di rigetto

correlazioni fra specifici alleli HLA e malattie:

correlazione fra HLA e suscettibilit a infezioni

linkage disequilibrium

Common west African HLA antigens are associated with protection from severe malaria.
Hill AV, Allsopp CE, Kwiatkowski D, Anstey NM, Twumasi P, Rowe PA, Bennett S, Brewster D, McMichael AJ, Greenwood BM. Institute of Molecular Medicine, University of Oxford, John Radcliffe Hospital, UK. A large case-control study of malaria in West African children shows that a

population they account for as great a reduction in disease incidence as the sickle-cell haemoglobin variant. These data support the hypothesis that the extraordinary polymorphism of major histocompatibility complex genes has evolved primarily through natural selection by infectious pathogens.

human leucocyte class I antigen (HLA-Bw53) and an HLA class II haplotype (DRB1*1302-DQB1*0501), common in West Africans but rare in other racial groups, are independently associated with protection from severe malaria. In this

Association between an MHC class II allele and clearance of hepatitis B virus in the Gambia.
Thursz MR, Kwiatkowski D, Allsopp CE, Greenwood BM, Thomas HC, Hill AV. BACKGROUND. The course of hepatitis B virus (HBV) infection does not appear to be determined by variations in viral virulence and may be influenced by the host immune response. CONCLUSIONS. The MHC class II allele DRB1*1302 was associated with protection against persistent HBV infection among both children and adults in the Gambia.

GATA1

proteina eritroide-specifica che lega enhancer -globina *Gel shift, competizione, footpronting *deduzione consensus

GATA

*ricerca consensus su altri geni eritroidi

tutti geni eritroidi hanno consensus GATA

master gene del differenziamento eritroide

Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells
Shih-Feng Tsai*, David I. K. Martin*, Leonard I. Zon*, Alan D. D'Andrea*, Gordon G. Wong & Stuart H. Orkin*

Nature 339, 446-451 (8 June 1989) Genes expressed in erythroid cells contain binding sites for a cell-specific factor believed to be an important regulator for this haematopoietic lineage. Using high-level transient expression in mammalian cells, we have identified complementary DNA encoding the murine protein. The factor, a new member of the zinc-finger family of DNA-binding proteins, is restricted to erythroid cells at the level of RNA expression and is closely homologous between mouse and man.

clonaggio da cDNA expression library

cDNA

A B C

*clonaggio DNA da cellule di topo *studio proteina zinc finger

1 struttura gene 2 domini proteici

famiglia ruolo

*pattern di espressione

erithroid cells , megaKaryocites, eosinophils, mast cells, Sertoli cells of the testis

A: clonaggio e caratterizzazione Famiglia di fattori trascrizionali : 1-3 ematopoietici

1 eritroide 2 progenitori 3 T cells

GATA 4-6: altri tessuti

FUNZIONE DEL GENE


ABOLIZIONE FUNZIONE

OVERESPRESSIONE

ESPRESSIONE ECTOPICA

ESPRESSIONE LIVELLI DIVERSI

in sistemi cellulari in sistemi animali: topo, zebrafish

Vannucchi A.

GATA1 -/- RESCUING:

SU CELLULE ES IN TOPO

*PROTEINA

WT

*PROTEINA MUTATA (DELEZIONI VARI DOMINI, MUTAZIONI PUNTIFORMI ETC)

*ALTRE PROTEINE GATA

NF CF

-N GATA-1 NF n CF riescono a fare rescue -Entrambi i domini Zinc-Finger sono necessari per la funzione di GATA-1 (funzionano anche ZFs di altri geni!)

ruolo dominio proteico NFinger

wt

E9.5

wt

E15.5

NF

NF

NF

FOG

I VARI GATA SONO INTERSCAMBIABILI?

il livello si GATA importante?? delezione sequenze regolative

overespressione

CONTROLLO CICLO CELLULARE : bilanciamento proliferazione/differenziamento Fattori di crescita autoregolazione induzione bclxl ha effetto antiapoptotico

differenziamento

TRANSCRIPTIONAL REGULATION

struttura del gene e sequenze regolative

come???? DNAseI etc reporters etc.. in vivo in vitro

TRANSLATIONAL REGULATION: alternative ATG

POSTTRANSLATIONAL REGULATION: *acetylation *phosphorilation *SUMOilation *protein degradation

PROTEIN-PROTEIN INTERACTIONS
synergism (FOG1, Cp2) Modulo GATA-1-Cp2 Attivazione di geni eritroidi (GATA-1, NF-E2p45, EKLF)

antagonism (Pu.1)

..modello multistep

ACUTE MEGAKARYOBLASTIC ANEMIA

TRANSIENT MYELOPROLIFERATIVE DISEASE

MUTANTI: LINEA SOMATICA LEUCEMIE


Acquired somatic mutations in GATA1 occur in virtually all children with Down Syndrome (DS) and congenital transient myeloproliferative syndrome (TMD) or acute megakaryocytic leukemia (AMKL, M7-ANLL). The mutations have also been detected in umbilical cord blood of DS patients and in fetal liver of aborted DS embryos. The mutations occur in-utero probably during fetal liver hematopoiesis. They consist of insertions, deletions and base substitution in exon 2 and vicinity and all result in elimination of the full length GATA1 protein with preservation of the GATA1s isoform. The presence of GATA1s in the absence of full length GATA1 blocks megakaryocytic differentiation and promote proliferation of megakaryoblasts. The genes on chromosome 21 that promote this abnormality are unknown. GATA1 mutations are almost always associated with the M7 leukemia in DS although they were also described in a pair of twins with acquired trisomy 21 and in one adult non DS patient with M7. The down-regulations of genes regulated by GATA1 may explain the exquisite sensitivity of DS leukemic blasts to ACA-C.

miR TESSUTO SPECIFICO REGOLATO DA GATA1

modello di zebrefish -labolizione di miR451 (miR451-MO) riduce fortemente la maturazione eritroide

riduzione espressione globine

abolizione GATA1 abolizione miR451