Sei sulla pagina 1di 36

U2BP

3 47 AAG 5

51

52 GCA

47

52

AAAAA

AAG GCA

U1 or U7 Double
3
47 AAG

5
52 GCA

51

47

52

AAAAA

AAG GCA

pBabe puro gag LTR


SV40

puro LTR U1/U2 /U7

gag LTR

SV40

puro p antis LTR

CELLULAR SYSTEM
Muscular biopsy from a 48-50 patient Immortalization with Large T Antigen Infection with retroviral vectors containing the different therapeutic RNAs Puromycin selection Analysis of the expression of the transgene RT-PCR and western analysis

M
238 217 201 190 180 160

C U1-5

In vivo expression of antisense RNAs

U1-5
probe 5'AAUUUUUCUCAUACCUUCUGCUUGAU 3'

M
307

C U2BP

5'

U2BP
AAAAAGAAGAAAAAGAAAAAUUAGAAAC

3'

238 217 201 190 180

probe

RT-PCR
47 51 52 53

(single antisense)
51

RT
U1-5 Duch U1-5 U2BP U7d Duch

47

51 47

52 52

- M

RT-PCR

(double antisense)
47 51 52 53

5-3 dBP 5BP Duchenne

RT

47 47

51 52

52

AAGGCA

Western analysis
100 g of total proteins

Duchenne

5-3 dBP 5BP SMC dyst

-427 kDa

In mioblasti DMD si ha ripristino di sintesi di distrofina e del complesso del sarcoglicano

Verso un approccio di terapia genica

Modello animale del topo mdx


STOP

22

23

24

pre-mRNA della distrofina

STOP

22

23

24

22 23

24

Splicing
STOP

22

23

24

mRNA

22

24

STOP

22

23

24

AAAAA

degradazione

traduzione

Trasduzione in vivo di molecole antisenso:uso di vettori AAV


Il virus AAV ha unalta efficienza di trasduzione nei muscoli e non patogenico
U1/U7 promoter

Antisense

5-ITR

CMV promoter

GFP

Wpre

3-ITR

SV40 misc intron

BGH pA

-Iniezione intramuscolo -Somministrazione sistemica mediante iniezione nella vena caudale

I muscoli iniettati vengono analizzati per: - analisi molecolare, (RT-PCR, Western) - immunoistochimica - saggi funzionali

La distrofina localizza correttamente alla periferia delle fibre e lespressione mantenuta per diversi mesi

Iniezione intramuscolo

Anche il complesso distrofina-sarcoglicano ripristinato

Iniezione sistemica di AAV-U1

tricipite

estensore

dorso

Gluteo

quadricipite

Gastrocnemio tibiale

*cuore

* diaframma

Localizzazione di distrofina e complesso sarcoglicano

QuickTime e un decompressore TIFF (LZW) sono necessari per visualizzare quest'immagine.

QuickTime e un decompressore TIFF (LZW) sono necessari per visualizzare quest'immagine.

I topi iniettati hanno livelli serici pi bassi di CK

Saggi funzionali - Creatin kinasi

15000 1000 5000 0

b /

wt

6 l

x d m mdx

7 U U1

I topi iniettati mostrano recupero della forza muscolare


60 m 40 / N k 20 0 7 5 c

Saggi funzionali - Forza

b /wt

6 l

x d m mdx

7 U U1

1 U U7

60
2

m 40 / N k 20 0

wt

mdx

- m x d

GFP+

GFP-

singole fibre
G / 1 U

Saggi funzionali - Treadmill exhaustion test


I topi iniettati mostrano aumento della resistenza allo sforzo

30 20 l

n i m 10 0

7 5 c 6 l Wt B

x d m mdx

1 U AAV-U1

Settembre 2006

Stato dellarte per una sperimentazione di terapia genica della DMD basata sullapproccio dellexon skipping mediato da AAV-U1

Vettore AAV9 in sostituzione di AAV1 (tale vettore risulta avere un tropismo per il muscolo molto maggiore di AAV1 e in particolare per il muscolo cardiaco) Collaborazione con il gruppo del Prof. Barry Byrne (Florida) capo del National Gene Vector Laboratories (NGVL) per la produzione di virus ricombinanti di purezza GMP e per analisi tossicologica Registrazione di AAV9-U1 come farmaco orfano. Elaborazione di un CTD (Common Technical Document) da sottoporre allISS, e successivamente allEMEA, per la richiesta di autorizzazione a sperimentazione clinica e registrazione del farmaco

Stato dellarte della sperimentazione clinica su DMD

PTC124 (PTC therapeutics)


Plasmide codificante distrofina full-length (Transgene e Mirus) Intramuscolare (completato) Intravena (comincia inizio 2007) AAV1 codificante microdistrofina (AskBio) Exon skipping con oligonucleotidi: 2-O-metil fosforotioato contro esone 51, (intramuscolo, cominciato; intravena pianificato per 2007, Universita di Leiden e Prosensa) Morfolino contro esone 51, (intramuscolo, cominciato; intravena pianificato per 2007; UK MDEX Consortium) Fosforotioati contro esone 19, 1 soggetto (intravena, completato, Dr. Takeshima) Exon skipping con U7 snRNA : Fase di preparazione di un AAV2/1 (Danos - Genethon)

Table 1 Summary of clinical trials for treatment of human diseases by AAV gene transfer
Disease deficiency Alzheimer s disease Canavan disease s Cystic fibrosis Hemophilia B Hemophilia B Leber congenital amaurosis (blindness) Parkinson s disease Muscular dystrophy Parkinson s disease
1-Antitrypsin

Transgene
1-Antitrypsin

Serotype AAV-2, AAV-1 AAV-2 AAV-2 AAV-2 AAV-2 AAV-2 AAV-2 AAV-2 AAV-1/2 hybrid AAV-2

Route of administratio n Intramuscular Intracranial or ex vivo Intracranial Nasal, sinus, and bronchial epithelium Intramuscular Hepatic artery Subretinal space Intracranial Intramuscular Intracranial

Target cell Skeletal muscle fibers Neurons Neurons Lung epithelial cells Skeletal muscle fibers Hepatocytes Photoreceptors Neurons Skeletal muscle fibers Neurons

Clinical trials Phase I/II Phase I/II Phase I Phase I, phase II Phase I/II Phase I/II Phase I/II approved Phase I Phase I initiated Phase I

Nerve growth factor Aspartoacylase CFTR Factor IX Factor IX RPE65 Aromatic lamino acid decarboxylase Microdystrophin Glutamic acid decarboxylase

Strategia generale per la costruzione di un vettore virale


I genomi virali contengono sia geni che sequenze regolatorie che agiscono in cis
sequenze responsabili della replicazione e della incapsidazione

La maggior parte delle sequenze che agiscono in cis si trovano al di fuori dei geni virali
si sfrutta questa segragazione per progettare vettori virali ricombinanti.

I geni virali e le sequenze che agiscono in cis sono separate su diverse molecole
i prodotti dei geni virali agiscono in trans
i geni virali possono essere forniti in un virus helper, in un plasmide o essere stabilmente integrati nel DNA della cellula packaging

le sequenze cis sono associate al gene terapeutico ed introdotte nella stessa cellula
produzione di particelle trasducenti difettive nella replicazione

Ciclo vitale di un retrovirus


RNA genomico, 2 copie. Lenzima trascrittasi inversa converte lRNA in DNA a doppio filamento nel citoplasma della cellula infetta. (Il DNA anche convertito in forma circolare, che per non sembra essere un intermedio della replicazione). Il DNA lineare migra nel nucleo e viene integrato nel DNA della cellula ospite. Il DNA integrato chiamato provirus. Lapparato della cellula ospite trascive il provirus producendo RNA virali che fungono sia da mRNA che da genomi che saranno impaccati nei nuovi virioni. 2 copie di RNA genomico vengono incapsidate in ogni virione

Struttura genomica ed espressione genica dei retrovirus


Il genoma tipico contiene 3 geni
gene regione codificante che d origine a pi di una proteina gag (componenti del core nucleoproteico) pol (replicazione e ricombinazione) env (componente della membrana esterna)

I tre geni sono


Per lespressione di pol deve essere ignorato un codone di stop


soppressione da parte di un glutamil-tRNA se la fase di lettura la stessa di gag slittamento del ribosoma se la fase di lettura diversa da gag la quantit di gag prodotta 20 volte superiore a quella di pol

Lefficienza del processo del 5%

Vettori retrovirali
U3 1 R U5 U3 R U5 Gag-Pol 2
3 Componenti separate

Env 3

U3 1

R U5
p

Gene terapeutico

U3

R U5

Gag-Pol Env oppure 3


p

2
p

VSV-G Titoli di 1010 unit trasducenti (t.u.)/ml

Titoli di 107 unit trasducenti (t.u.)/ml

Vettori Retrovirali:
Pro

situazione attuale e prospettive future


linfociti e precursori delle linee ematopoietiche efficace terapia genica di due bambini affetti da imunodeficienza

efficiente trasduzione ex vivo di cellule in attiva replicazione notevole esperienza clinica ex vivo integra garantendo espressione prolungata, ma a basso livello

Contro
integrazione random
attivazione di oncogeni shut-off trascrizionale dipendente dal sito di integrazione

capacit di impaccamento limitate (max. 7 kb)

Sviluppi futuri: vettori lentivirali

Vettori lentivirali
I lentivirus hanno un genoma pi complesso
oltre ai geni gag, pol ed env, il genoma contiene due geni regolatori , tat e rev essenziali per il controllo dellespressione genica, ed un numero variabile di geni accessori.

Originariamente derivati da HIV-1 per trasdurre linfociti


pseudotipizzazione con VSV-G espande il trofismo vettori pseudotipizzati con VSV-G possono essere somministrati direttamente in vivo
efficiente trasduzione di neuroni e cellule della glia del sistema nervoso centrale di roditori e primati

Vettori ibridi derivati da lentivirus non umani (SIV, FIV)


virus originale non infettivo per gli esseri umani
la reale efficacia in vivo deve essere ancora dimostrata

Vettori lentivirali
Trasporto attivo del complesso di pre-integrazione attraverso i pori nucleari
possibilit di trasdurre anche cellule quiescenti
efficaci nel trasdurre cellule quiescenti ex vivo trasduzione diretta in vivo potrebbe soffrire di alcune limitazioni
barriere tissutali nel caso della mucosa resporatoria condizione intracellulare (necessit di replicazione) nel caso degli epatociti

devono ancora essere definiti il potenziale reale ed i limiti della trasduzione diretta in vivo mediata da vettori lentivirali

Limite comune a vettori retro- e lentivirali


la fase a RNA obbligatoria nel ciclo vitale impone determinati limiti nella cassetta di espressione, tra cui la mancanza di introni e di segnali di poliadenilazione.

Virus Adeno Associati (AAV)


Parvovirus, inizialmente scoperti come contaminanti di preparazioni di Adeno, richiedono la presenza di un virus helper (per esempio, Adenovirus) per linfezione produttiva
ad oggi sono stati caratterizzati 6 sierotipi
la maggior parte deli studi si concentrata su AAV-2

Ad oggi non sono stati associati a nessuna patologia


caratteristica ideale per derivare un vettore di terapia genica

Il genoma del virus naturale integra preferenzialmente in un sito specifico del genoma umano (AAVS1 nel cromosoma 19 q13.3-qter)

Struttura genomica dei Virus Adeno Associati


ITR (145 nt) ITR

Rep
Integrazione Incapsidazione Rescue

Cap

Replicazione del DNA Integrazione Rescue

Proteine del capside: VP1, VP2, VP3

Ciclo vitale dei Virus Adeno Associati


Fase di latenza Fase litica
Ad

Rescue Ad Replicazione

Integrazione sito-specifica

Vettori AAV: struttura e produzione


ITR (145 nt) ITR

Promotore-Transgene (max 4.5 kb)

1) Plasmide esprimente i geni rep e cap 2) Adenovirus helper oppure 2bis) Plasmide esprimente i geni di Adenovirus con funzione helper

Vettori AAV:
Pro

situazione attuale e prospettive future


descritte sia forme episomali che integrate

efficiente trasduzione in vivo di cellule sia quiescenti che in attiva replicazione espressione prolungata del transgene bassa immunogenicit

Contro
la massima capacit di impaccamento 4,5 kb con il sistema di produzione attuale si ottengono preparazioni a titolo relativamente basso e contaminate da virus

Sviluppi futuri:
miglioramento dei sistemi di produzione aumento dellefficienza di integrazione sito-specifica