Sei sulla pagina 1di 50

Le Tecnologie di

Biologia Molecolare
nella ricerca Biomedica
La possibilità di accedere a tecnologie del DNA ricombinante
rappresenta un grande vantaggio per la ricerca biomedica.

Queste tecnologie possono essere particolarmente utili per:

g) Aiuto nella formulazione di una diagnosi;


h) Caratterizzazione funzionale di un fattore genetico;
Tecnologie considerate

PCR DNA
RT-PCR cDNA
Sequenziamento DNA

Southern Blot DNA


Northern Blot RNA
Diagnosi di difetto genetico

Paziente con cariotipo XY ma con fenotipo femminile

15-20% di questi pazienti hanno un’alterazione del gene SRY

Analisi del gene SRY

Delezione Mutazione puntiforme

Totale Parziale
Delezione Mutazione puntiforme

Totale Parziale

PCR Sequenziamento
Migrazione elettroforetica del DNA
Il DNA (e l’RNA) possiede carica negativa e pertanto in
particolari matrici (gel di agarosio e poliacrilammide) se
sottoposto ad un campo elettrico tende a migrare verso il polo
positivo.

La velocità con cui un frammento migra verso il polo positivo è


proporzionale alla sua dimensione
M
1,353 bp

1,078 bp
852 bp

603 bp

310 bp

271 bp

194 bp

Necessari metodi di rilevamento per 98 bp

“vedere” il DNA (o RNA) EtBr


PCR

Polymerase Chain Reaction

Reazione a catena di polimerizzazione del DNA

Obiettivo
Produrre una notevole quantità di copie di un frammento di
DNA di interesse che viene sottoposto ad amplificazione
PCR

1988
PCR

Primer F
5’ 3’

3’ Primer R 5’
Regione di interesse
(non necessaria la conoscenza della sequenza)

Reazione enzimatica con: DNA polimerasi

dNTP (dATP, dCTP, dTTP, dGTP)


A C T G

2 primers (innesco)

Template (stampo)
PCR

Animazione
Applicazioni della P C R

Fornisce una risposta qualitativa (c’è


o non c’è?) su una data sequenza
genomica
PCR – analisi mutazionale di geni

Prodotti di PCR

Sequenziamento diretto
SSCP
DDGE
PCR – Tipizzazione polimorfismi
(varianti neutre del DNA)

Prodotto di PCR

Digestione enzimi di restrizione


RFLP
VNTR (Variation
Number Tandem
Repeat)
SNP (Single Nucleotide
Polimorphism)
PCR – Genotipizzazione VNTR
(Microsatelliti)

GATCAGCTGAGGACTATAGCCAGTCGTGTGTGTGTGTGTGTGTGTGTGTACTGACCCAGTTTAACAGAATAGCAAC

p M
RT - P C R

Polymerase Chain Reaction

Reazione a catena di polimerizzazione del DNA


Il materiale di partenza è RNA che viene
retrotrascritto in cDNA

Studio dell’espressione dei geni (++)


RT
AAAAA AAAAA

AAAAA AAAAA

tessuto

AAAAAAAAAAAAAAAA
TTTTTTTTTTTTTTTTT

Reverse transcriptase

cDNA
RT - PCR

cDNA

PCR positiva = gene espresso nel tessuto da


cui è stato estratto l’RNA
RT - PCR
Qualitativa: “espresso, non espresso”
Quantitativa: “quanto è espresso”
(con speciali accorgimenti e/o speciali apparecchiature)

Serve anche a verificare eventuali fenomeni di splicing alternativo in


funzione dei primers utilizzati

Isoforma 1
Isoforma 2

Rapidità, scarsità di materiale


RT-PCR
Un vantaggio della tecnologia di RT-PCR è la possibilità di amplificare e
sequenziare direttamente un gene che possiede una struttura
esoni/introni molto frammentata.

- Disponibilità di un tessuto che esprima il gene


RT-PCR

Analisi di mutazioni che non interessano il cds ma che comprendono siti


di splicing

ag gt ag at ag gt

Splicing normale
Splicing aberrante

- Disponibilità di un tessuto che esprima il gene


Sequenziamento

Per sequenziamento si intende la lettura ordinata


delle basi che compongono una catena di DNA

La tecnologia odierna permette di attuare facilmente


questo processo solo in presenza di una notevole quantità
di copie del frammento da sequenziare

Prodotti di PCR

Cloni plasmidici, BAC, PAC


DNA genomico
Sequenziamento

Senso della lettura

Lettura possibile di 600-800 basi dopo l’oligonucleotide-innesco


Sequenziamento

GTTTCAT
AGTCAAAGTACAGTGATCATAGCGATATCGATGTGTGACAGTAG
MOLTE COPIE!!!!!

Reazione enzimatica con: DNA polimerasi

dNTP (dATP, dCTP, dTTP, dGTP) - 90%


A C T G

ddNTP (ddATP, ddCTP, ddTTP, ddGTP) – 10%


A C T G

1 Primer innesco

Sintesi nuovo DNA


Sequenziamento
GTTTCAT
AGTCAAAGTACAGTGATCATAGCGATATCGATGTGTGACAGTAG
GTCACT
GTCACTAGTAT
GTC
GTCACTAGTATCGCTATA
GTCACTAGTATCG
GTCACTAGTATCGCTATAGCT
GTCACTAGTATCGCTATAGCTACACAC

GTCACTAGTATCGCTATAGCTACACACTGTCATC
Sequenziamento
GTTTCAT
AGTCAAAGTACAGTGATCATAGCGATATCGATGTGTGACAGTAG
G
GT
GTC
GTCA
GTCAC
GTCACT
GTCACTA
GTCACTAG
GTCACTAGT
GTCACTAGTA
GTCACTAGTAT
GTCACTAGTATC
GTCACTAGTATCG Migrazione elettroforetica
GTCACTAGTATCGC +
GTCACTAGTATCGCT
GTCACTAGTATCGCTA Lettura fluorocromi
GTCACTAGTATCGCTAT
GTCACTAGTATCGCTATA
GTCACTAGTATCGCTATAG
GTCACTAGTATCGCTATAGC
GTCACTAGTATCGCTATAGCT
GTCACTAGTATCGCTATAGCTA
GTCACTAGTATCGCTATAGCTAC
GTCACTAGTATCGCTATAGCTACA
GTCACTAGTATCGCTATAGCTACAC
Sequenziamento

+ Lettore laser

Animazione
Ibridazione Acidi Nucleici
SONDA (DNA
o cDNA) TAGCAAACGCATCACGTCA

TAGCAAACGCATCACGTCA
ATCGTTTGCGTAGTGCAGT
Ibridazione Acidi Nucleici

In funzione di alcuni parametri operativi della tecnica


possiamo ottenere ibridazioni altamente specifiche
oppure permettere ibridazioni meno specifiche.
Southern Blot
Attuata sul DNA

DNA digerito con enzimi di restrizione e


sottoposto a elettroforesi

Tecnica che fornisce una risposta qualitativa


e quantitativa

Tecnica utilizzata per individuare la presenza


(o assenza) di un frammento di acido nucleico
in un genoma
Southern Blot
M T
Migrazione
Gel agarosio -
10 Kb

5 Kb
DNA Digestione con
EcoRI 3 Kb

Trasferimento Denaturazione 2 Kb
su membrana di nylon Con NaOH 2.5 Kb
+

Fissazione
Southern Blot
ATGGCAGTAACG
Marcatura

ATGGCAGTAACG

Ibridazione

Lavaggi

Rivelazione
Southern Blot

3 Kb

EcoRI EcoRI
ATGGCAGTAACG

3 Kb
Applicazioni possibili

Identificazione aberrazioni cromosomiche


strutturali

Delezioni
Duplicazioni
Inversioni
……
Tutte quelle aberrazioni cha causano un
cambiamento della lunghezza del frammento
compreso tra i due siti di taglio dell’enzima
utilizzato e contenente la sequenza specifica
della sonda utilizzata.
SB - Delezione
EcoRI EcoRI EcoRI EcoRI EcoRI

WT -

wt/wt wt/- -/-


SB - Delezione
EcoRI EcoRI EcoRI EcoRI EcoRI EcoRI

WT -

wt/wt wt/- -/-


SB - Duplicazioni
EcoRI EcoRI EcoRI EcoRI EcoRI EcoRI EcoRI

WT -

wt/wt wt/- -/-


SB - Inversioni
EcoRI EcoRI EcoRI EcoRI EcoRI EcoRI

WT -

wt/wt wt/- -/-


EcoRI

delezione
EcoRI
EcoRI

Test.

Paziente 1

Paziente 2

Paziente 3

Paziente 4

Paziente 5

Paziente 6

Paziente 7
Southern Blot - Test

Paziente 8

Paziente 9

Paziente 10
Southern Blot – tra specie
diverse
Attuando lavaggi meno stringenti posso
evidenziare sequenze simili tra specie
diverse, ossia permettere un minor
numero di legami tra sonda e sequenza
omologa, e quindi evidenziare la presenza
o meno di una sequenza simile.

ZOO-BLOT
H. Sapiens

Dog

Cat

Mouse

Rat

Pig

Cattle

Goat

Sheep
ZOO - Blot

Turtle

Chiken
Northern Blot
Attuata sull’RNA

RNA non digerito

Tecnica che fornisce una risposta qualitativa e


quantitativa

Tecnica utilizzata per individuare la lunghezza di un


mRNA e per studiare l’espressione di un gene nei
diversi tessuti
Northern Blot
M T
AAAAAAA Migrazione
Gel agarosio -
10 Kb
AAAAAAA AAAAAAA
5 Kb Trsferimento
AAAAAAA
Su membrana
3 Kb
mRNA
2 Kb
2.5 Kb
+

Fissazione
Northern Blot
ATGGCAGTAACG
Marcatura

ATGGCAGTAACG

Ibridazione

Lavaggi

Rivelazione
Northern Blot

3 Kb

ATGGCAGTAACG
AAAAAAAAAA
3 Kb
AAAAAA
AAAAAA

Espres. Ubiquitaria

Splicing Alternativo
Testicolo

Ovaio

Fegato

Milza

Pelle

Intestino
Northern Blot

Cervello

Surrene

HeLa

Placenta

Rene
AAAAAA

Espres. Specifica
Testicolo

Ovaio

Fegato

Milza

Pelle

Intestino
Northern Blot

Cervello

Surrene

HeLa

Placenta

Rene
Quantitativa
AAAAAA

Testicolo

Ovaio

Fegato

Milza

Pelle

Intestino
Northern Blot

Cervello

Surrene

HeLa

Placenta

Rene
Quantitativa
AAAAAA

10 dpc

11 dpc

12 dpc
Testis

13 dpc

14 dpc

10 dpc
Northern Blot

11 dpc

12 dpc
Ovary

13 dpc

14 dpc

HeLa
Southern e Northern Blot

Tecniche di ibridazione di acidi nucleici

Tecniche cha forniscono una risposta quantitativa

Tecniche cha forniscono una risposta qualitativa


Southern e Northern Blot

Evidenziare e quantificare la presenza di una


regione genomica

Evidenziare e quantificare la presenza di un


trascritto di un gene in un dato tessuto in un
dato momento