Sei sulla pagina 1di 102

Discovering Genomics,

Proteomics And Bioinformatics

By A.Malcolm Campbell& Laurie J.Heyer


Cold Spring Harbor Laboratory Press, 2003

Teaching genomics to undergraduate students


is like vaccinating against flu:
Each year the novelties that have come to
dominate the field have to
be evaluated and course materials redesigned
to prepare the student
body for the ever-changing
information landscape.
Medicina Molecolare e Neoplasie
- Genetica - Analisi cromosomi

- Genomica - Analisi DNA


genomico/cDNA

- Proteomica - Analisi RNA

- Epigenetica - Analisi proteine


Genetica Molecolare

Struttura e Funzione dei Geni

Genomica

Progetto Genoma - Sequenziamento


1400n
m

700n
m
Gb
Mb (1000 Kb)
(1000Mb)

30n
m
300nm Kb (1000 bps)
11n
m

Nucleotid
2nm e (1 bp)
Human Chromosomes

p arm
Male 46,XY
centromere

q arm Female 46,XX


telomere
Genome Anatomy

Transcribed gene
EUCHROMATIN 1,5%
1 gene 1 protein old dogma!

polymorphisms > 1 protein

98,5% NON CODING

intragenic = introns
Intergenic
repetitive
G-BANDING KARYOTYPE
Cromosoma 12 Cloni/Sonde Geni
regione 12q12regione 12q12
Metodi
utilizzati
Cariotipo

Gene
Candidato
FISH (PDGFRB 5q33)
Chromosome 5

9.4

3’
PDGFRB

q33

5’ COSMID 4-1 + COSMID 9-4

4.1

DUAL COLOR FISH


I-FISH M-FISH nl(5) der(5)

der(12)

der(12)
nl(5)

der(5)
Interphase FISH

ABL1
D-FISH, dual colour dual fusion

ABL1
fusion

BCR fusion

normale Ph+
BCR
Braccio corto, p

Braccio lungo, q

banda gene
genecandidato
candidato separazione
rottura e (break apart)(split)
separazione

CROMOSOMA

sonda monocolore complementare a tutto il gene


sonde bicolore fiancheggianti il gene
RT - PCR

RT: trascrizione inversa PCR : reazione a catena


della DNA-polimerasi
• Le molecole di mRNA (5’ 3’)
vengono retrotrascritte in Sintesi del filamento senso (5’ 
cDNA (filamento antisenso 3’) e amplificazione del cDNA
3’5’)
Filamento senso
5’ ------------------------AAAA 3’ mRNA
5’ 3’cDNA
cDNA
3’ 5’
Filamento antisenso
3’ 5’
VAL 617F in PV

PV

WT
INS 959_960 CATG vs CCTG

WT
959

965

WT GATCT CT G GC AG T G G A G G AAGTCTCTTTAAGAAAATAG
B GATCT CT G CATG GC AG T G G A G G AAGTCTCTTTAAGAAAATAG
D GATCT CT G CCTG GC AG T G G A G G AAGTCTCTTTAAGAAAATAG
Journal of Molecular Diagnostics,2006
Types of genes wich may mutate to cause cancer

food

viruses Tumour suppressor genes

proto-oncogenes
chemical
DNA repair genes

checkpoint genes

tobacco smoke radiation


Proto - Oncogene
Oncogene è ciò
Un gene il cui
che risulta dal
prodotto ha la
proto-oncogene
capacità di
dopo insulto
indurre
genetico e il cui
trasformazione
prodotto ha la
cellulare a
capacità
seguito di insulti
trasformante
genetici
Tumour Suppressor Genes

1) The gene’s normal function is to regulate cell division.


To lose gene activity both alleles need to be mutated

2) The first mutation may be inherited or somatic

3) the second mutation will often be a gross event leading


to loss of heterozygosity in the surronding area (deletion)

es: retinoblastoma gene (13q14)


Retinoblastoma Gene (13q14)
both copies of gene as to be inactivated

somatic mutation heredity

first allele inactivation

somatic mutation

second allele inactivation


p53 Mutant Mice Develop Cancer
Mutazione dominante negativa

Una mutazione il cui prodotto

interferisce con il prodotto del gene

normale nella stessa cellula


REPAIR GENES

• BER Base Excision Repair

• NER Nucleotide Excision Repair

• MMR Mismatch Repair (HNPCC)


Checkpoints Genes

Sistema cellulare di protezione dall’instabilità


genomica e della tossicità derivata dal danno al
DNA
Functional Goals Of Mutations
• Induzione di segnali di crescita

• Perdita di capacità di sopprimere

• Regolazione anormale dell’apoptosi

• Diminuzione della stabilità genomica

• Evasione delle difese immunologiche


Proteomica

Caratterizzazione della neoplasia attarverso le


sue proteine
( elettroforesi bidimensionale: gradienti di pH +
peso molecolare - spettrometria di massa )
Dogma Della Biologia

DNA

RNA Proteine
Microarray showing genes
distinguishing ALL from AML.
The 50 genes most highly
correlated with the ALL-AML
class distinction are shown. Each
row corresponds to a gene, with
the columns corresponding to
expression levels in different
samples. Expression levels for
each gene are normalized across
the samples such that the mean is
0 and the SD is 1. expression
levels greater than the mean are
shaded in red, and those below
the mean are shaded in blue. The
scales indicated SDs above or
below the mean.
Epigenetica:

( Espressione Genica )

Metilazione
De-acetilazione
RNA interferents
Epigenetica:
Metilazione
* * *
ATG

5’- Promoter exon 1 exon 2 exon 3 -3’

* CpG Sequenze di DNA di 200-2000 basi con


Island: una più alta frequenza di CG rispetto al
resto del genoma.
Circa 30000 nel genoma, il 50-60% è
localizzato all’interno dei promotori
genici.
La metilazione del promotore a livello
delle CpG è associata a silenziamento
trascrizionale e deacetilazione degli
Copia inattiva Copia attiva
del gene (“imprinted”) del gene

• acetilazione istonica
• acetilazione istonica • metilazione
• metilazione

attività deacetilasica repressione della trascrizione


attività acetilasica attivazione della trascrizione
INIBITORI

Azacitidina, Decitabina, Zebularina

Acido Valproico, Tricostatina A,


SAHA, Fenil-butirrato, MGCD0103

Substrati non-Istonici
Fattori di trascrizione
t(9;22)(q34;q11) D-FISH
normal BCR/ABL1

BCR/ABL1 + loss 5'ABL1BCR/ABL1 + loss 5'ABL1/3'BCR

der(9)
+ DNA probe+apten
DNA target

DENATURATION DETECTION
Ab
I) anti-apten

Ab
HYBRIDIZATION II)
Mutations can be
induced by
chemical
modification
of a base
B.G. 138/00
Tecniche di Citogenetica e di Biologia Molecolare
Epigenetica:

( Espressione Genica )

Metilazione
Acetilazione
RNA interferents
Gene
Expression
is
a multistage
process
WHO Integrated Classifications
Morphology: Immunology:
Cytology Immuno-cyto-
Histopathology histochemistry

Molecular
Cytogenetic Genetics
The New England Journal of Medicine. Jan 4, Vol 356, No. 1, 79-81
Eredità di tipo Mendeliano
Dominante
Recessiva

Penetranza
Cancers Selected Syndromes

Selected human
cancers
associated
with
Mendelian
syndromes
Oncogeni
Proto - Oncogeni (c-onc)
Mutazioni
Virus RNA
Oncogene tumorali
(v-onc)
spliced RNA copies
of the c-onc
no introns
Domande
• Che cos’è la citogenetica molecolare ?
• Che cos’è un oncogene ?
• Che cos’è un gene checkpoint ?
• Che cosa studia l’epigenetica ?
• Quale è la differenza tra DNA genomico e cDNA ?
• Strumenti di analisi dell’espressione genica
• Che cos’è un gene soppressore?
• A cosa servono i telomeri?
B.G. 138/00
• Enhanced Mutagenesis Spontaneous
biosynthetic errors induced by
endogenous/exogenous agents

• Inefficient repair

• Clonal selection
REPAIR GENES

• BER Base Excision Repair

• NER Nucleotide Excision repair

• MMR Mismatch repair (HNPCC)


GEL ELETTROFORETICO IN AGAROSIO

123 bp ladder λ /Hind


III
Migrazione Elettroforesi
I-FISH
-NUMERICAL ABERRATIONS

Monosomy / Trisomy

Amplification

-STRUCTURAL ABERRATIONS

Deletion / Duplication

Translocation / Inversion
Epigenetica:MetilazioneMethylation Specific PCR (MSP)
‘‘U’’ Primer:
Trattamento con Sodio Bisulfito
NH2
* *O * DNA NON metilato:
CACATTACCACTAAC
N Deaminazione NH 5’…. GUGTAATGGUGATUG ….3’
ATG

5’- O Promoter DNA


exon 1 metilato:
exon 2 exon 3 -3’
N N O
H H CACATTACCACTAAC

* CITOSINA
CpG di DNA di5’….
SequenzeURACILE 200-2000 basi con
GCGTAATGGCGATCG ….3’
Island: una più alta frequenza di CG rispetto al
‘‘M’’ Primer:

NH2
resto del genoma.
NH2 DNA NON metilato:
CH3 CH3
Circa 30000 Nnel genoma,
NDeaminazione il 50-60% è
CGCATTACCGCTAGC
localizzato all’interno dei promotori
5’…. GUGTAATGGUGATUG ….3’
N O genici. N O
H H DNA metilato:
5-metilcitosinaLa metilazione del promotore
5-metilcitosina a livello
CGCATTACCGCTAGC
delle CpG è associata a silenziamento
5’…. GCGTAATGGCGATCG ….3’
trascrizionale e deacetilazione degli