Sei sulla pagina 1di 17

Genom i gen

Genom i gen

Genomika oblast mol.biologije koja se bavi


Genom – skup svih nasledih informacija u ćeliji
ispitivanjem strukture i organizacije genoma

Mitohondrijalni genom 0,01%


Jedarni genom 99,99%
37 gena

Molekularna biologija
Genom i gen

 1995. objavljena sekvenca prvog bakterijskog genoma (H. influenzae)

 1996 sekvenciran genom kvasca.

 1997. Sekvencirana E. coli.

 1998. Sekvenciran C. elegans.

 Mart 2000. Celera objavljuje sekvencu D. melanogaster.

 Maj 2000. HGP objavljuje sekvencu hromozoma 21.

 Decembar 2000. Sekvencirana A. thaliana.

Molekularna biologija
Genom i gen

16. februar 2001. Celera


15. februar 2001 HGP publikuje publikuje radni nacrt u
radni nacrt u Nature Science.

Molekularna biologija
Genom i gen

Veličina genoma nije proporcionalna stepenu složenosti organizama

Genomika Komparativni eukariotski genomi


Veličina genoma Godina
Kičmenjaci Broj gena
Mb sekvencioniranja

Homo sapiens 3,200 25,000 2001

Mus musculus 2,600 30,000 2002

Fugu rubripens 365 33,700 2002

Gallus gallus 1,000 20 – 23,000 2004

Molekularna biologija
Genom i gen

Genomika Komparativni eukariotski genomi


Veličina genoma Godina
Beskičmenjaci Broj gena
Mb sekvencioniranja

Drosophila melanogaster 137 13,600 2000

Anopheles gambiae 278 46,000 – 56,000 2002

Gljive

Scbizosaccaromyces pombe 13,8 4,824 2002

Saccharomyces cerevisiae   12,7 5,805 1997

Molekularna biologija
Genom i gen

Genomika Komparativni eukariotski genomi


Godina
Biljke Veličina genoma Mb Broj gena
sekvencioniranja

Arabidopsis thaliana 125 25,498 2000

Oryza sativa 430 41,000 2002

Protisti

Plasmodium falciparum 23 5,300 2002

Molekularna biologija
Genom i gen

1 Geni koji kodiraju pojedine polipeptide – prepisivanjem nastaje iRNK


- STRUKTURNI GENI

2 Geni čijim prepisivanjem nastaje rRNK i tRNK


- STRUKTURNI GENI

3 NEKODIRAJUĆE SEKVENCE DNK ( ranije smeće DNK)


- REGULATORNE SEKVENCE ( sadrže uputstva za razviće organizama)
- SPARIVANJE HOMOLOGIH HROMOZOMA TOKOM MEJOZE
Genom i gen

GENOM je organizovan tako da u njemu postoje :

1. PONOVLJENE (REPETITIVNE) sekvence koje se ponavljaju više puta u jednom


haploidnom setu hromozoma. Ne postoje kod prokariota. Mogu biti:

1a. MNOGOSTRUKO PONOVLJENE SEKVENCE

1b.SREDNJE (INTERMEDIJARNO) PONOVLJENE SEKVENCE

2. JEDINSTVENE SEKVENCE

Molekularna biologija
Genom i gen

1a.MNOGOSTRUKO PONOVLJENE SEKVENCE javljaju se u hiljadama i milionima puta

 Predstavljaju nekodirajući deo genoma


 Nazivaju se (neopravdano) i ‘’ DNK smeće ‘’

SATELITI
su kratke sekvence od nekoliko nukleotida koje se uzastopno ponavljaju i predstavljaju
visoko ponovljene sekvence
Kod čoveka čine manje od 10% genoma
Smešteni uglavnom u regionu centromera
Smatra se da učestvuju u sparivanju homologih hromozoma, kao i održavanju strukture
hromozoma

Molekularna biologija
Genom i gen

1b. SREDNJE (INTERMEDIJARNO) PONOVLJENE SEKVENCE

Predstavljaju sekvence koje su ponovljene umereni broj puta


Rasute su po celom genomu u obliku kraćih ili dužih ponovljenih nizova

Čine ih :

1.UZASTOPNO PONOVLJENI GENI

2.FAMILIJE GENA

3. POKRETNI GENETIČKI ELEMENTI

Molekularna biologija
Genom i gen

UZASTOPNO PONOVLJENI GENI

Geni za rRNK ( 350 kopija )


nalaze se na kratkim kracima svih
akrocentričnih autozoma tj. na
hromozomima 13, 14, 15, 21 i 22
Akrocentrični hromozomi
nose gene za sintezu rRNK.
Geni za tRNK ( 1310 kopija) 3 različita gena u 350 kopija
gena

1310 kopija gena za tRNK

Molekularna biologija
Genom i gen

FAMILIJE GENA

Sastoje se od članova koji imaju sličnu strukturu a koji su nastali duplikacijama


predačkog gena, koje su tokom vremena mutirale na različite načine.
I njihovi produkti odlikuju se sličnom primarnom strukturom i pripadaju familiji
proteina.

POKRETNI GENETIČKI ELEMENTI

su nizovi nukleotida koji menjaju mesto u genomu


Zauzimaju preko 45% genoma čoveka
Nazivaju se transpozoni (‘’skoči-geni’’)

Molekularna biologija
Genom i gen

2. JEDINSTVENE SEKVENCE

Geni koji su prisutni samo jednom u okviru jednog haploidnog seta


hromozoma

U humanom genomu geni koji kodiraju većinu polipeptida su


jedinstvene sekvence

U genomima višećelijskih organizama, jedinstvene sekvence čine 25


-50% ukupnog broja gena

Molekularna biologija
Genom i gen

Količina DNK u genomu eukariota daleko premašuje zbir gena koji kodiraju sve proteine prisutne u ćelijama.
To znači da deo genoma sadrži nizove nukleotida koji ne nose šifru za sintezu proteina.

Segmenti gena koji sadrže informaciju za sintezu proteina su nazvani EGZONI, a nekodirajući nizovi između
njih su INTRONI

Geni prokariota su kontinuirani – sadrže samo kodirajuće sekvence

ATACCGATGAAACAGGACCACACCTTACGCCGAAATTTAGCCCAGCTAGACATT

Kod prokariota introni ne postoje ili ima vrlo mali broj introna, pa su njihovi geni neprekinuti nizovi
kodirajućih nukleotida.

Molekularna biologija
Genom i gen
Geni eukariota su diskontinuirani (mozaični, modularni) – sadrže kodirajuće– EGZONI i nekodirajuće
sekvence - INTRONI
5’ kraj 3’ kraj

E1 I1 E2 I2 E3 I3 E4 I4

E1 E2 E3 E4

E1 E2 E3

E1 E2 E4

Kombinacijom 4 egzona može da nastane 11 različitih polipeptida

Najveći gen u genomu čoveka je gen koji kodira mišićni protein distrofin; distrofin je
veliki protein (sadrži 3685 aminokiselina) pa je i gen koji ga kodira ogroman. Introni
kojih ima 79 u njemu zauzimaju više od 99% ukupne dužine a egzoni ostalih 1%.

Molekularna biologija
Genomika

Kvasac Vinska mušica

4% 17%

96% 83%

Sisari
8%

92%

Broj gena koji sadrži introne raste sa


evolutivnom složenošću organizama

Molekularna biologija