BIOLOGICAL

MOLECULES
Prepared by:
Mrs. Eden C. Sanchez
Enzymes
 Enzymes are biological catalysts
that speed up the rate of the
biochemical reaction.
 All known enzymes are proteins
except ribozymes
 Ribozymes are special RNA
species also act as enzymes
e.g. hammerhead ribozyme.
Enzymes
 Consist of one or more polypeptide chains and
may have molecular weights ranging from a few
thousand to millions.
 Ribonuclease consists of one polypeptide chain
and has a molecular weight of approximately
13,700 daltons
Enzymes
 Aldolase is involved in glucose metabolism, has
a molecular weight of 156,600 daltons
 Pyruvate dehydrogenase that converts acetyl
CoA before entering the citric acid cycle has a
molecular weight of about 1, 000, 000 daltons.
 Many enzymes require inorganic ions or complex
organic molecules for their activity. These non-
protein components are generally called
cofactors.
 Enzyme Structure
 The active site of an enzyme is the region that
binds substrates, co-factors and prosthetic groups
and contains residue that helps to hold the
substrate.
 Active sites generally occupy less than 5% of the
total surface area of enzyme.
 Active site has a specific shape due to tertiary
structure of protein.
 A change in the shape of protein affects the shape
of active site and function of the enzyme.
Active Site
o Active site can be further divided into:

Active Site

Binding Site Catalytic Site

It chooses the substrate It performs the catalytic

and binds it to active site. action of enzyme.
 Active Site
Substrate molecule:
Substrate molecules are the
chemicals that an enzyme
acts on. They are drawn into Active site:
the cleft of the enzyme. The active site contains both binding
and catalytic regions. The substrate
is drawn to the enzyme’s surface and
the substrate molecule(s) are
positioned in a way to promote a
reaction: either joining two molecules
together or splitting up a larger one.
Enzyme molecule:
The complexity of the
active site is what makes
each enzyme so specific
(i.e. precise in terms of the
substrate it acts on).

This model (above) is an enzyme called

Ribonuclease S, that breaks up RNA
molecules. It has three active sites (arrowed).
Co-Factors
o Co-factor is the non protein molecule which carries out
chemical reactions that can not be performed by standard 20
amino acids.
o Co-factors are of two types:
 Organic co-factors
 Inorganic cofactors
Inorganic Co-Factors
 These are the inorganic molecules required for
the proper activity of enzymes.
 Examples:
 Enzyme carbonic anhydrase requires Zn for it’s
activity.
 Hexokinase has co-factor Mg
Inorganic Co-Factors
Enzyme Inorganic Ion Required
 Peroxidase  Fe
 Cytochrome oxidase  Cu
 Carboxypeptidase A  Zn
 Nitrate Reductase  Mo
Organic Co-Factors
o These are the organic molecules required for the
proper activity of enzymes.
o Example:
 Glycogen phosphorylase requires the small organic
molecule pyridoxal phosphate.
 Organic cofactors are also called coenzymes.
 Example:
 Flavin adenine dinucleotide (FAD)
 Nicotinamide adenine dinucleotide (NAD)
 Tetrahydrofolate (THF)
 Coenzyme A (CoA)
Types of Organic Co-Factors
Prosthetic group
 a tightly bound organic co-
factor e.g. Flavins, heme
and biotin.
Coenzyme
 is loosely bound organic
co-factor. E.g. NAD
Types of Co-Factors
 An enzyme with it’s co-factor removed is designated as
apoenzyme (protein part free of cofactors)
 The complete complex of a protein with all necessary
small organic molecules, metal ions and other
components is termed as holoenzyme of holoprotein.
Substrate
 The reactant in biochemical reaction is termed as
substrate.
 When a substrate binds to an enzyme it forms an
enzyme-substrate complex.

Substrate Joins Enzyme

 Site of Enzyme Synthesis
o Enzymes are synthesized by ribosomes which are
attached to the rough endoplasmic reticulum.

o Information for the synthesis of enzyme is carried

by DNA.

o Amino acids are bonded together to form specific

enzyme according to the DNA’s codes.
 Intracellular & Extracellular Enzyme
o Intracellular enzymes are synthesized and retained in the cell for the
use of cell itself.
o They are found in the cytoplasm, nucleus, mitochondria and
chloroplast.
Example :
 Oxydoreductase catalyses biological oxidation.
 Enzymes involved in reduction in the mitochondria.

o Extracellular enzymes are synthesized in the cell but secreted from

the cell to work externally.
Example :
 Digestive enzyme produced by the pancreas, are not used by the
cells in the pancreas but are transported to the duodenum.
 CHARACTERISTICS
 Enzymes speed up the reaction by lowering the activation
energy of the reaction.
 Their presence does not effect the nature and properties of end
product.
 They are highly specific in their action that is each enzyme can
catalyze one kind of substrate.
 Small amount of enzymes can accelerate chemical reactions.
 Enzymes are sensitive to change in pH, temperature and
substrate concentration.
 Turnover number is defined as the number of substrate
molecules transformed per minute by one enzyme molecule.
Enzymes
 NOMENCLATURE OF ENZYME
o An enzyme is named according to the name of the
substrate it catalyses.
o Some enzymes were named before a systematic way of
naming enzyme was formed.
Example: pepsin, trypsin and rennin
o By adding suffix -ase at the end of the name of the
substrate, enzymes are named.
o Enzyme for catalyzing the hydrolysis is termed as
hydrolase.
Example :
maltase
maltose + water glucose + glucose
Examples
 Classification of Enzyme
A systematic classification of enzymes has been
developed by International Enzyme Commission.

 This classification is based on the type of reactions

catalyzed by enzymes.

 There are six major classes.

 Classification of Enzyme
1. Oxidoreductases – catalyze oxidation-reduction
reaction involving substrate molecules
Subclass:
 Oxidases – oxidation of substrate
 Reductases – reduction of a substrate
Example: Lactate dehydrogenase
 Dehydrogenases - introduction of a double bond by formal
removal of H2 from the substrate
2. Transferases – catalyze the transfer of functional groups
between two substrates
 Classification of Enzyme
Subclass:
 Transaminases – transfer of an amino group between
substrates
 Kinases – transfer of a phosphate group between substrates
Example: Glucokinase
3. Hydrolases – catalyze substrate hydrolysis reaction
(addition of water molecule to a bond causing the bond to
break
Subclass:
 Lipases – hydrolysis of ester linkages in lipids
 Classification of Enzyme
 Proteases – hydrolysis of peptide linkages in proteins
 Nucleases – hydrolysis of sugar-phosphate ester bonds in
nucleic acids
 Carbohydrases – hydrolysis of glycosidic bonds in
carbohydrates
 Phosphatases – hydrolysis of phosphate-ester bonds
Example: Lipase
4. Lyases – catalyze the addition of a group to a double bond
or the removal of a group to create a double bond in a manner
that does not involve hydrolysis
 Classification of Enzyme
Subclass:
 Dehydrases – removal of water from a substrate
 Decarboxylases – removal of CO2 from a substrate
 Deaminases – removal of NH3 from a substrate
Example: Pyruvate decarboxylase
5. Isomerases – catalyze the conversion of a substrate into
another compound that is isomeric with it
Subclass:
 Racemases – conversion of D to L isomer or vice versa
 Mutases – conversion of one structural isomer to another
 Classification of Enzyme
 Epimerases – conversion of one sugar epimer to another
Example: Phosphoglucomutase
6. Ligases – catalyze the bonding together of two substrate
molecules with the participation of ATP
Subclass:
 Synthetases – formation of new bond between substrates
with ATP participation
 Carboxylases – formation of new bond between substrate
and CO2, with ATP participation
Example: Asparagine synthetase
 Factors Affecting Rate of Enzyme
Catalyzed Reaction
1. Temperature
2. Hydrogen ion concentration (pH)
3. Substrate concentration
Temperature
 Raising the temperature increases the rate of enzyme
catalyzed reaction by increasing kinetic energy of
reacting molecules.
 Enzymes work maximum over a particular
temperature known as optimum temperature.
Enzymes for humans generally exhibit stability
temperature up to 35-45 ᵒC.
 However some times heat energy can also
increase kinetic energy to a point that exceed the
energy barrier which results in denaturing of
enzymes.
Hydrogen ion concentration (pH)
 Rate of almost all enzymes catalyzed reactions
depends on pH
 Most enzymes exhibit optimal activity at pH
value between 5 and 9
 High or low pH value than optimum value will
cause ionization of enzyme which result in
denaturation of enzyme
Substrate concentration
 Assuming that the amount of enzyme is constant,
an increase in substrate concentration causes a
diminishing increase in the reaction rate.
 A maximum rate is obtained at a certain
concentration of substrate when all enzymes are
occupied substrate (the rate cannot increase any
further).
Inhibitors
 Any substance that can diminish the velocity of an
enzyme catalyzed reaction is called an inhibitor.
 The prevention of an enzyme process as a result
of interaction of inhibitors with the enzyme -
Inhibition
NUCLEIC ACID
NUCLEIC ACID
 Chemical carriers of cell’s genetic information
 Come in two forms – Deoxyribonucleic acid
(DNA) and Ribonucleic acid (RNA)
 Biopolymers made up of nucleotides linked
together by phosphodiester linkages.
 Friedrich Miescher discovered nucleic acids
('nuclein') in 1868.
Role of Nucleic Acid
 Dictate amino-acid sequence in proteins
 Give information to chromosomes, which is then
passed from parent to offspring
Nucleotides
 Basic unit/building blocks of nucleic acids
 Composed of an aldopentose (sugar)bonded to a
phosphate group and linked to a heterocyclic purine or
pyrimidine base (nitrogenous base)
 Ribose is the pentose in RNA while deoxyribose is in
DNA
 The heterocyclic amines in dioxyribonucleotides are
substituted purines – adenine and guanine, and
substituted pyrimidines – cytosine and thymine
 In ribonucleotides, thymine is replaced by a different
pyrimidine base - uracil
 RIBOSE DEOXYRIBOSE

CH2OH CH2OH
O OH O OH

C C C C

H H H H H H H H

C C C C

OH OH OH H
DNA Structure
 Consists of alternating sugar-phosphate backbone
with different nitrogenous bases attached
 Nucleotide sequence in a DNA strand is written
using the one letter abbreviation for each
nitrogenous base of the nucleoside (A, G, C, T, U)
 Consists of two polynucleotide strands coiled around
each other in a double helix
 The two strands run in opposite directions
(antiparallel) and are held together by a hydrogen
bonds between specific base pairs
 The two strands are complementary (but not
identical) due to specific base pairing, thus
 A is always paired with T and
 C is always paired with G
 The bases are joined by hydrogen bonds,
individually weak but collectively strong
 DNA is the genetic material found in all living
organisms, ranging from single-celled bacteria to
multicellular mammals.
 Discovered by James Watson and Francis Crick
 A chromosome may contain tens of thousands
of genes. Many genes contain the information to
make protein products; other genes code for
RNA products. DNA controls all of the cellular
activities by turning the genes "on" or "off. "
DNA is made up of two strands of
Polynucleotide
 Molecular Logic of Life
Transcription Translation
Replication DNA RNA Protein

REPLICATION – process by which DNA molecules

produce identical copies of themselves
TRANSCRIPTION – the synthesis of RNA
TRANSLATION – protein synthesis
How DNA works?
 DNA stores genetic information in segments
called genes
 The DNA code is in Triplet Codons (short
sequences of 3 nucleotides each)
 Certain codons are translated by the cell into
certain Amino acids.
 Thus, the sequence of nucleotides in DNA
indicate a sequence of Amino acids in a protein.
RNA
 mostly involved in protein synthesis.
 Three kinds of RNA:
1. Messenger RNA (mRNA) – carries genetic
messages from DNA to ribosomes, which are small
granular particles in the cytoplasm where protein
synthesis occurs.
2. Ribosomal RNA (rRNA) – forms a complex with
proteins. This provides the physical make-up of the
ribosomes
3. Transfer RNA (tRNA) – transports amino acids to
ribosomes where they are joined together to form
proteins.
Facts about RNA
 About 5% of the weight of a human cell is RNA. Only about
1% of a cell consists of DNA.
 RNA is found in both the nucleus and cytoplasm of
humans cells. DNA is only found in the cell nucleus.
 RNA is the genetic material for some organisms which don't
have DNA. Some viruses contain DNA; many only contain
RNA.
 RNA is used in some cancer gene therapies to reduce the
expression of cancer-causing genes.
 RNA technology is used to suppress expression of fruit
ripening genes so that fruits can remain on the vine longer,
extending their season and availability for marketing
Example of Transcription

CT A A T G G T T A DNA coding strand

G AT T A C C A A T DNA template strand
C UAA U G G U U A Transcribed mRNA
Genetic Disorders
 Albinism
 Cri du chat
 Hemophilia
 Sickle cell disease (blood disorder)
 Huntington’s disease (death of brain cells)
 Trisomy 21
 Turner’s syndrome
Seatwork:
1. What constitutes the backbone structure of nucleic acid chains?
2. Give the base sequence of the complementary DNA strand of
the DNA chain with the following base sequence: ACGTAG.
3. From what DNA base sequence was the following mRNA
sequence transcribed?
UUCGCAG
4. A strand of DNA contains the following sequence of bases:
GTACGTGCCATGCGTTACCGTAAGCTAT
If the strand of RNA makes a copy of this DNA strand, what
will be the sequence in RNA strand?
5. A strand of DNA contains the following sequence of bases:
ATCCGGCAATCATGTCAGTCAGTTCAATG
What is the sequence of its complementary strand?