Lecture Notes For Chapter 2: by Tan, Steinbach, Kumar

Data Mining: Data
Lecture Notes for Chapter 2
Introduction to Data Mining

by
Tan, Steinbach, Kumar
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

What is Data?
l Collection of data objects and Attributes

their attributes
l An attribute is a property or Tid Refund Marital Taxable

Status Income Cheat
characteristic of an object
1 Yes Single 125K No
– Examples: eye color of a
2 No Married 100K No
person, temperature, etc.
3 No Single 70K No
– Attribute is also known as
4 Yes Married 120K No
variable, field, characteristic, or
5 No Divorced 95K Yes
feature Objects
6 No Married 60K No
l A collection of attributes
7 Yes Divorced 220K No
describe an object
8 No Single 85K Yes
– Object is also known as record,
9 No Married 75K No
point, case, sample, entity, or
10 No Single 90K Yes
instance 10

Attribute Values
l Attribute values are numbers or symbols assigned

to an attribute
l Distinction between attributes and attribute values

– Same attribute can be mapped to different attribute
values ?????
 Example: height can be measured in feet or meters
– Different attributes can be mapped to the same set of

values
 Example: Attribute values for ID and age are integers
 But properties of attribute values can be different
– ID has no limit but age has a maximum and minimum value

Types of Attributes
 There are different types of attributes or type of a

measurement scale.
– Nominal
 Examples: ID numbers, eye color, zip codes
– Ordinal
 Examples: rankings (e.g., taste of potato chips on a scale
from 1-10), grades, height in {tall, medium, short}
– Interval
 Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
 Examples: temperature in Kelvin, length, time, counts

Types of Attributes
 There are different types of attributes

Properties of Attribute Values
l The type of an attribute depends on which of the

following properties it possesses:
– Distinctness: = 
– Order: < >
– Addition: + -
– Multiplication: */
– Nominal attribute: distinctness

– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & addition
– Ratio attribute: all 4 properties

Properties of Attribute Values
The Different Types of Attributes

 A useful (and simple) way to specify the type of an
attribute is to identify the properties of numbers that
correspond to underlying properties of the attribute. For
example, an attribute such as length has many of the
properties of numbers.
 It makes sense to compare and order objects by length,
as well as to talk about the differences and ratios of
length.
 The following properties (operations) of numbers are
typically used to describe attributes.
1. Distinctness = and =
2. Order <, ≤, >, and ≥
3. Addition + and −
Attribute Description Examples Operations
Type
Nominal The values of a nominal attribute are zip codes, employee mode, entropy,
just different names, i.e., nominal ID numbers, eye color, contingency
attributes provide only enough sex: {male, female} correlation, 2 test
information to distinguish one object
from another. (=, )
Ordinal The values of an ordinal attribute hardness of minerals, median, percentiles,

provide enough information to order {good, better, best}, rank correlation,
objects. (<, >) grades, street numbers run tests, sign tests
Interval For interval attributes, the calendar dates, mean, standard

differences between values are temperature in Celsius deviation, Pearson's
meaningful, i.e., a unit of or Fahrenheit correlation, t and F
measurement exists. tests
(+, - )
Ratio For ratio variables, both differences temperature in Kelvin, geometric mean,
and ratios are meaningful. (*, /) monetary quantities, harmonic mean,
counts, age, mass, percent variation
length, electrical
current
Attribute Transformation Comments
Level
Nominal Any permutation of values If all employee ID numbers

were reassigned, would it
make any difference?
Ordinal An order preserving change of An attribute encompassing

values, i.e., the notion of good, better
new_value = f(old_value) best can be represented
where f is a monotonic function. equally well by the values
{1, 2, 3} or by { 0.5, 1,
10}.
Interval new_value =a * old_value + b Thus, the Fahrenheit and
where a and b are constants Celsius temperature scales
differ in terms of where
their zero value is and the
size of a unit (degree).
Ratio new_value = a * old_value Length can be measured in

meters or feet.
Discrete and Continuous Attributes
l Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a collection of
documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete attributes
l Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and represented
using a finite number of digits.
– Continuous attributes are typically represented as floating-point
variables.

2.1.2 Types of data sets
some of the most common types. For convenience, we
have grouped the types of data sets into three groups:
record data, graphbased data, and ordered data. These
categories do not cover all possibilities
Record
– Data Matrix
– Document Data
– Transaction Data
Graph
– World Wide Web
– Molecular Structures
Ordered
– Spatial Data
– Temporal Data
– Sequential
© Tan,Steinbach, Kumar Data Introduction to Data Mining 4/18/2004
Important Characteristics of Structured Data
Before providing details of specific kinds of data sets, we discuss three characteristics
that apply to many data sets and have a significant impact on the data mining
techniques.
Dimensionality
– The more dimensions (attributes) there are the harder dealing with the
dataset becomes. [called Curse of Dimensionality]
Sparsity
– Sometimes only the presence of a value for an attribute is what is
important [e.g. Document Data].
– Sparse datasets have more zeroes than non-zero values, whereas
dense datasets have only few zero values.
– Sparsity affects the choice of the data mining method.
Resolution
– Very high resolution: Difficult to see patterns due to many unnecessary
details.
– Very low resolution: Patterns may not be present in the dataset!
– E.g.: Record air pressure every second? Every minute? Every day?

Record Data
l data mining work assumes that the Data set that

consists of a collection of records(data objects),,
each of which consists of a fixed set of attributes
Tid Refund Marital Taxable

Status Income Cheat
1 Yes Single 125K No

2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
© Tan,Steinbach, Kumar 10 No Single to Data
Introduction 90K MiningYes 4/18/2004
10
Record Data
 For the most basic form of record data, there is

no explicit relationship among records or data
fields, and every record (object) has the same set
of attributes. Record data is usually stored either
in flat files or in relational databases. Relational
databases are certainly more than a collection of
records, but data mining often does not use any
of the additional information available in a
relational database. Rather, the database serves
as a convenient place to find records.

Data Matrix
 If data objects have the same fixed set of numeric attributes, then the
data objects can be thought of as points (vectors) in a multi-dimensional
space, where each dimension represents a distinct attribute.
 Such data set can be represented by an m by n matrix, where there are
m rows, one for each object, and n columns, one for each attribute
 This matrix is called a data matrix or a pattern matrix. A data matrix is
a variation of record data, but because it consists of numeric attributes,
standard matrix operation can be applied to transform and manipulate
the data. Therefore, the data matrix is the standard data format for most
statistical data.
Projection Projection Distance Load Thickness

of x Load of y load
10.23 5.27 15.22 2.7 1.2

12.65 6.25 16.22 2.2 1.1
Document Data
l Each document becomes a `term' vector,

– each term is a component (attribute) of the vector,
– the value of each component is the number of times
the corresponding term occurs in the document.
timeout
season
coach
game
score
team
ball
lost
pla
wi
n
y
Document 1 3 0 5 0 2 6 0 2 0 2
Document 2 0 7 0 2 1 0 0 3 0 0
Document 3 0 1 0 0 1 2 2 0 3 0

Transaction Data
l A special type of record data, where

– each record (transaction) involves a set of items.
– For example:
consider a grocery store. The set of products purchased by a
customer during one shopping trip constitute a transaction,
while the individual products that were purchased are the items.
The set of symptoms (items) experienced by a patient.

Transaction Data
TI Items PI Symptoms
D D
1 Biscuits, Milk, Bread 1 Fever, Headache
2 Milk, Bread, Diapers 2 Stomachache,
Diarrhea
3 Cucumber
3 Fever, Nausea
4 Water, Orange, Milk
4 Fever, HBP
5 Bread, Tomatoes
5 Fatigue, Fever, Cough

Graph-based Data
 A graph can sometimes be a convenient and powerful
representation for data.
 We consider two specific cases: (1) the graph captures
relationships among data objects and (2) the data objects
themselves are represented as graphs.
 Examples: Generic graph and HTML Links
2 <a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
5 1 <a href="papers/papers.html#aaaa">
Graph Partitioning </a>
2 <li>
<a href="papers/papers.html#aaaa">
Parallel Solution of Sparse Linear System of Equations </a>
5 <li>
<a href="papers/papers.html#ffff">
N-Body Computation and Dense Linear System Solvers

Chemical Data
l Benzene Molecule: C6H6

Ordered Data
l Sequences of transactions
Items/Events
An element of
the sequence
Ordered Data
l Genomic sequence data
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG

Ordered Data
l Spatio-Temporal Data
Average Monthly
Temperature of
land and ocean

Data Quality
l What kinds of data quality problems?

l How can we detect problems with the data?
l What can we do about these problems?
l Examples of data quality problems:

– Noise and outliers
– missing values
– duplicate data

Noise
 Noise refers to modification of original values

– Examples: distortion of a person’s voice when talking
on a poor phone and “snow” on television screen
Two Sine Waves Two Sine Waves + Noise

Outliers
l Outliers are data objects with characteristics that

are considerably different than most of the other
data objects in the data set

Missing Values
l Reasons for missing values

– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)
l Handling missing values

– Eliminate Data Objects
– Estimate Missing Values
– Ignore the Missing Value During Analysis
– Replace with all possible values (weighted by their
probabilities)

Duplicate Data
l Data set may include data objects that are

duplicates, or almost duplicates of one another
– Major issue when merging data from heterogeous
sources
l Examples:
– Same person with multiple email addresses
l Data cleaning
– Process of dealing with duplicate data issues
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 28

Data Preprocessing
l Aggregation
l Sampling
l Dimensionality Reduction
l Feature subset selection
l Feature creation
l Discretization and Binarization
l Attribute Transformation

Aggregation
 Combining two or more attributes (or objects) into

a single attribute (or object)
 Purpose
– Data reduction
 Reduce the number of attributes or objects
– Change of scale
 Cities aggregated into regions, states, countries, etc
– More “stable” data
 Aggregated data tends to have less variability

Aggregation
Variation of Precipitation in Australia
Standard Deviation of Average Standard Deviation of Average

Monthly Precipitation Yearly Precipitation

Sampling
l Sampling is the main technique employed for data selection.
– It is often used for both the preliminary investigation of the data
and the final data analysis.
l Statisticians sample because obtaining the entire set of data

of interest is too expensive or time consuming.
l Sampling is used in data mining because processing the

entire set of data of interest is too expensive or time
consuming.

Sampling …
l The key principle for effective sampling is the

following:
– using a sample will work almost as well as using the
entire data sets, if the sample is representative
– A sample is representative if it has approximately the

same property (of interest) as the original set of data

Types of Sampling
l Simple Random Sampling

– There is an equal probability of selecting any particular item
l Sampling without replacement

– As each item is selected, it is removed from the population
l Sampling with replacement

– Objects are not removed from the population as they are
selected for the sample.
 In sampling with replacement, the same object can be picked up
more than once
l Stratified sampling
– Split the data into several partitions; then draw random samples
from each partition
Sample Size
8000 points 2000 Points 500 Points

Sample Size
l What sample size is necessary to get at least one
object from each of 10 groups.

Curse of Dimensionality
l When dimensionality
increases, data becomes
increasingly sparse in the
space that it occupies
l Definitions of density and

distance between points,
which is critical for
clustering and outlier
detection, become less
meaningful • Randomly generate 500 points
• Compute difference between max and min
distance between any pair of points

Dimensionality Reduction
l Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by data
mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce
noise
l Techniques
– Principle Component Analysis
– Singular Value Decomposition
– Others: supervised and non-linear techniques

Dimensionality Reduction: PCA
Dimensions = 206
Dimensions
Dimensions==160
120
10
40
80

Feature Subset Selection
l Another way to reduce dimensionality of data
l Redundant features
– duplicate much or all of the information contained in
one or more other attributes
– Example: purchase price of a product and the amount
of sales tax paid
l Irrelevant features
– contain no information that is useful for the data
mining task at hand
– Example: students' ID is often irrelevant to the task of
predicting students' GPA
Feature Creation
l Create new attributes that can capture the

important information in a data set much more
efficiently than the original attributes
l Three general methodologies:

– Feature Extraction
 domain-specific
– Mapping Data to New Space
– Feature Construction
 combining features

Similarity and Dissimilarity
l Similarity
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
l Dissimilarity
– Numerical measure of how different are two data
objects
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
l Proximity refers to a similarity or dissimilarity
Similarity/Dissimilarity for Simple Attributes
p and q are the attribute values for two data objects.

Euclidean Distance
l Euclidean Distance
n
dist   ( pk  qk ) 2
k 1
Where n is the number of dimensions (attributes) and pk and qk

are, respectively, the kth attributes (components) or data
objects p and q.
l Standardization is necessary, if scales differ.

Euclidean Distance
p1
point x y
2
p1 0 2
p3 p4
1
p2 2 0
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6
p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Distance Matrix

Common Properties of a Distance
l Distances, such as the Euclidean distance,

have some well known properties.
1. d(p, q)  0 for all p and q and d(p, q) = 0 only if
p = q. (Positive definiteness)
2. d(p, q) = d(q, p) for all p and q. (Symmetry)
3. d(p, r)  d(p, q) + d(q, r) for all points p, q, and r.
(Triangle Inequality)
where d(p, q) is the distance (dissimilarity) between
points (data objects), p and q.
l A distance that satisfies these properties is a

metric

Common Properties of a Similarity
l Similarities, also have some well known

properties.
1. s(p, q) = 1 (or maximum similarity) only if p = q.
2. s(p, q) = s(q, p) for all p and q. (Symmetry)
where s(p, q) is the similarity between points (data

objects), p and q.

Correlation
l Correlation measures the linear relationship

between objects
l To compute correlation, we standardize data
objects, p and q, and then take their dot product
pk  ( pk  mean( p)) / std ( p)

qk  (qk  mean(q)) / std (q)
correlation( p, q)  p  q
Visually Evaluating Correlation
Scatter plots
showing the
similarity from
–1 to 1.

Density
l Density-based clustering require a notion of

density
l Examples:
– Euclidean density
 Euclidean density = number of points per unit volume
– Probability density
– Graph-based density

Euclidean Density – Cell-based
l Simplest approach is to divide region into a

number of rectangular cells of equal volume and
define density as # of points the cell contains

Euclidean Density – Center-based
l Euclidean density is the number of points within a

specified radius of the point

Lecture Notes For Chapter 2: by Tan, Steinbach, Kumar

Caricato da

Informazioni sul documento

Titolo originale

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

Lecture Notes For Chapter 2: by Tan, Steinbach, Kumar

Caricato da

Copyright:

Formati disponibili

Data Mining: Data

Lecture Notes for Chapter 2

Introduction to Data Mining

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

l Collection of data objects and Attributes

l An attribute is a property or Tid Refund Marital Taxable

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

l Attribute values are numbers or symbols assigned

l Distinction between attributes and attribute values

– Different attributes can be mapped to the same set of

– ID has no limit but age has a maximum and minimum value

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

 There are different types of attributes or type of a

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

 There are different types of attributes

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

l The type of an attribute depends on which of the

– Nominal attribute: distinctness

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

The Different Types of Attributes

Ordinal The values of an ordinal attribute hardness of minerals, median, percentiles,

Interval For interval attributes, the calendar dates, mean, standard

Nominal Any permutation of values If all employee ID numbers

Ordinal An order preserving change of An attribute encompassing

Ratio new_value = a * old_value Length can be measured in

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

l data mining work assumes that the Data set that

Tid Refund Marital Taxable

1 Yes Single 125K No

 For the most basic form of record data, there is

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

Projection Projection Distance Load Thickness

10.23 5.27 15.22 2.7 1.2

l Each document becomes a `term' vector,

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

l A special type of record data, where

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

l Benzene Molecule: C6H6

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

l Genomic sequence data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

l What kinds of data quality problems?

l Examples of data quality problems:

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

 Noise refers to modification of original values

Two Sine Waves Two Sine Waves + Noise

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

l Outliers are data objects with characteristics that

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

l Reasons for missing values

l Handling missing values

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

l Data set may include data objects that are

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 28

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

 Combining two or more attributes (or objects) into

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004

Variation of Precipitation in Australia

Standard Deviation of Average Standard Deviation of Average