Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
rekayasa protein
DNA denaturation:
Double strand-DNA separated into 2 single
strand DNA
In vitro : dsDNA heated 90-95oC will be
denatured.
Restriction endonuclease:
Enzim (endonuklease) yang dapat memotong untai DNA pada posisi
tertentu
Memotong ikatan fosfodiester pada diantara nukleotida pada kedua untai.
Tempat pemotongan tersebut (restriction site) : palindrom
Contoh :
..CUGUCUCCUCAGCAUCAUUCCAGGCACAGAAC
GCCAGAAAAUGGAAUGGUGCUG UUGAAUCAACAGGUUCU
T TACCACGACAACTTAGTTG
Agar dapat dilihat, probe dilabel dengan radioaktif atau enzim
Teknik mendeteksi asam nukleat tertentu dengan pelacak RNA atau
DNA disebut hibridisasi
Southern blot:
Sampel DNA dilarikan pada elekroforesis jel agarosa ---- blot ke
membran --- hibridisasi dengan pelacak berlabel ---- visualisasi
Northern blot:
Sampel DNA dilarikan pada elekroforesis jel agarosa ---- blot ke
membran --- hibridisasi dengan pelacak berlabel ---- visualisasi
Southern blot
Reverse hybridization with non-radioactive label
DNA sequencing
- Untuk mengetahui urutan nukleotida pada DNA
Metoda Sanger:
Fragmen DNA ----- denaturasi ---- ssDNA sebagai cetakan -----
+ 4 dNTP + ddATP/ ddTTP/ ddCTP/ ddGTP
Dideoksinukleotida tidak memiliki molekul O pada 3karbon dari ribose
---- pemanjangan rantai DNA terhenti bila rantai mengikat ddNTP ---
--- terbentuk DNA dengan gradasi ukuran dari 1 maksimal -----
elektroforesis ---- baca.
Automated DNA sequencing
Polymerase chain reaction
A molecular copy machine for DNA
Primer : Oligonukleotida sintetis yang dirancang untuk mengenali
bagian DNA yang akan diamplifikasi, dan memungkinkan terjadinya
polimerasi/ pemanjangan untai DNA.
Diperlukan suhu tinggi untuk denaturasi DNA
Digunakan enzim DNA polimerase yang tahan pada suhu 95oC (misal
enzim taq polymerase dari Thermus aquaticus)
PCR
Annealing/ priming
50-65oC, perlekatan primer pada DNA target
Elongation
68-72oC, reaksi polimerasi, pemanjangan rantai DNA
Polymerase chain reaction
Metoda untuk membuat DNA rekombinan
----- DNA cloning
Strategi :
1. Mengambil gen/ bagian gen yang diinginkan dari 1 organisme (donor)
- Memotong dengan restriction endonuclease
- dari RNA, menggunakan reverse transcriptase untuk
mendapatkan cDNA
- Amplifikasi dengan PCR
- Sintesis DNA
12/11/2017 33
http://www.bio.miami.edu/dana/250/25003_10.html
Sifat penting vektor untuk kloning gen, a.l.:
Punya ori (origin of replication)
Dapat menerima DNA insert, kecil, tidak mudah terdegradasi
Mempunyai restriction site yang dapat digunakan untuk insersi gen
yang akan diklon
Membawa gen marker, misal pembawa sifat resistensi antibiotika
---- untuk seleksi
heteroduplex
! Competent cell:
bacterial cell
capable of picking
up DNA
Transfection :
the introduction of foreign material into eukaryotic cells. Transfection
typically involves opening transient pores or 'holes' in the cell plasma
membrane, to allow the uptake of material.
Genetic material (such as supercoiled plasmid DNA or siRNA
constructs), or even proteins such as antibodies, may be transfected.
Transfection is frequently carried out by mixing a cationic lipid with
the material to produce liposomes, which fuse with the cell plasma
membrane and deposit their cargo inside.
The term transfection is most often used in reference to
mammalian cells.
The term transformation is more often used for the same process in
bacteria and, occasionally, plants.
Methods of transfection:
calcium phosphate precipitation, originally discovered by S.
Bacchetti and F. L. Graham in 1977.[1] HEPES-buffered saline
solution (HeBS) containing phosphate ions is combined with a
calcium chloride solution containing the DNA to be transfected.
When the two are combined, a fine precipitate of calcium
phosphate will form, binding the DNA to be transfected on its
surface. The suspension of the precipitate is then added to the
cells to be transfected (usually a cell culture grown in a
monolayer). By a process not entirely understood, the cells take up
some of the precipitate, and with it, the DNA.
electroporation
heat shock
Lipofectamine and Fugene.
gene gun, where the DNA is coupled to a nanoparticle of an
inert solid (commonly gold) which is then "shot" directly into
the target cell's nucleus BIOLISTICS
ELECTROPORATION
if host cell has cell walls, enzymes are used to dissolve
the walls, leaving only a protoplast (cell without walls)
Foreign DNA is introduced via ELECTROPORATION--
protoplasts are exposed to a short electrical pulse which
opens transient membrane channels through which DNA
can pass
transformed cells can then be cultured in media that
allows re-formation of cell walls and normal growth into a
whole organism (plants, fungi, some protists).
Animal cells lack cell walls, and so are easily
transformed via electroporation.
12/11/2017 42
http://www.bio.miami.edu/dana/250/25003_10.html
BIOLISTICS
BIOLISTICS is the process of bombarding cells with
microscopic projectiles (usually made of an inert
substance such as tungsten or gold) and coated with
DNA
These are shot at high velocity from a particle gun into
cells or tissue
This technique is promising for use in live organisms
It was invented by A Guy.
12/11/2017 43
http://www.bio.miami.edu/dana/250/25003_10.html
TRANSDUCTION
Viruses with affinity for certain cell types can also be
used as vectors if they are "loaded" with desired foreign
DNA and allowed to infect target host cells
12/11/2017 44
http://www.bio.miami.edu/dana/250/25003_10.html
MICROINJECTION
One greatly desired goal is the introduction of genes into
all cells of an animal affected with a genetic disorder, in
the hopes of allowing the faulty cells to transform and
substitute functional genes for faulty ones.
Transgenic animal with an entirely genetically altered
animal can be obtained via MICROINJECTION.
To generate a transgenic animal, foreign DNA must
be inserted into a zygote or very early embryo.
DNA is injected directly into the nucleus of the cell
with an extremely tiny pipette.
Once DNA transfer is accomplished, it is sometimes
(if the researcher is lucky!) incorporated into the host
cell chromosome
The transformed zygote/embryo can then be
implanted into a surrogate mother for growth and
development.
12/11/2017 45
http://www.bio.miami.edu/dana/250/25003_10.html
Introduction of DNA into mammalian cells
Seleksi klon yang mengandun
insert DNA yang dikehendaki
Contoh:
Untuk mengetahui perbedaan ekspresi gen pada
sel kanker dan sel normal.
Pada chip telah direkatkan sejumlah probe
oligonukleotida yang mengenali gen-gen yang
akan diteliti.
Isolasi mRNA
Dengan RT, dibuat cDNA, disertai label yang
berbeda untuk sel kanker (merah) dan sel normal
(hijau).
Campurkan cDNA, hibridisasikan pada chip
microarray yang telah disiapkan
Baca hasil
PROTEIN ENGINEERING
Budiman Bela
OUTLINE
Introduction
Protein Engineering Goals
Preliminary Requirements
Rational Mutagenesis and Protein Design
INTRODUCTION
PROTEIN ACTIVITY:
Improved catalysis with natural
substrate or cofactor
Improved catalysis with nonnatural
!
substrate or cofactor
! Increased catalysis in nonnatural
!
solvent
Improved ligand binding
PROTEIN ENGINEERING
GOALS
PROTEIN STABILITY:
Increased thermostability
Increased activity in alternative pH
Increased acitivity in different ionic strength
Improved protein folding
Decreased susceptibility to proteolysis
Pharmacokinetics
PROTEIN ENGINEERING
GOALS
EXPRESSION:
Improved expression levels in nonnatural
host
Targeted expression to different cellular
location
Added tags to detect protein expression
Altered posttranslational modification
PROTEIN ENGINEERING
GOALS
OTHER TRAITS:
Added tags to facilitate purification
Altered tendency for polymerization
Added tags to visualize localization
Engineered allosteric binding sites
Altered isoelectric point
Decreased immunogenicity
Addition of tag to facilitate purification:
Bottom up approach:
A library of different mutant proteins is
produced a method is then developed to
screen or select members of the library that
have an improved trait, the mutations that
caused the improvement are determined later
Rational Mutagenesis
1. Site Directed Mutagenesis
2. Other methods:
1. Use of restriction sites:
- insertions
- deletions
- significant rearrangements
2. Introduction of restriction site by site directed mutagenesis
(restriction sites
can be introduced without altering the associated protein
sequence) cut and paste of DNA sequences: fusion
proteins, swap domains of proteins, remove entire section of
proteins
Rational Mutagenesis
Example: Insulin
Human insulin is used for treatment of diabetes
Native insulin form dimers and hexamer :
enable stockpiling in the pacreas before it is
needed for release
Problem in the use of insulin in therapy :
purified insulin is injected subcutaneously only
active monomer form is desired
Formation of dimers and hexamers can slow down
absorption
Rational Mutagenesis
Example: Insulin
Problem solution:
Site-directed mutagenesis to introduce
repulsive charges and steric hindrances at
the dimer interface reduce the tendency
of human insulin to self-assemble
Insulin monomers is produced based on the
above work, that have an increased rate of
absorption resulting in preferable
postprandial plasma concentration profile
Terima kasih