Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
rekayasa protein
DNA denaturation:
Double strand-DNA separated into 2 single
strand DNA
In vitro : dsDNA heated 90-95oC will be
denatured.
Restriction endonuclease:
Enzim (endonuklease) yang dapat memotong untai DNA pada posisi
tertentu
Memotong ikatan fosfodiester pada diantara nukleotida pada kedua untai.
Tempat pemotongan tersebut (restriction site) : palindrom
Contoh :
..CUGUCUCCUCAGCAUCAUUCCAGGCACAGAAC
GCCAGAAAAUGGAAUGGUGCUG UUGAAUCAACAGGUUCU
T TACCACGACAACTTAGTTG
Agar dapat dilihat, probe dilabel dengan radioaktif atau enzim
Teknik mendeteksi asam nukleat tertentu dengan pelacak RNA atau
DNA disebut hibridisasi
Southern blot:
Sampel DNA dilarikan pada elekroforesis jel agarosa ---- blot ke
membran --- hibridisasi dengan pelacak berlabel ---- visualisasi
Northern blot:
Sampel DNA dilarikan pada elekroforesis jel agarosa ---- blot ke
membran --- hibridisasi dengan pelacak berlabel ---- visualisasi
Southern blot
Reverse hybridization with non-radioactive label
DNA sequencing
- Untuk mengetahui urutan nukleotida pada DNA
Metoda Sanger:
Fragmen DNA ----- denaturasi ---- ssDNA sebagai cetakan
----- + 4 dNTP + ddATP/ ddTTP/ ddCTP/ ddGTP
Dideoksinukleotida tidak memiliki molekul O pada 3karbon
dari ribose ---- pemanjangan rantai DNA terhenti bila
rantai mengikat ddNTP ------ terbentuk DNA dengan
gradasi ukuran dari 1 maksimal ----- elektroforesis ----
baca.
Automated DNA sequencing
Polymerase chain reaction
A molecular copy machine for DNA
Primer : Oligonukleotida sintetis yang dirancang untuk mengenali
bagian DNA yang akan diamplifikasi, dan memungkinkan terjadinya
polimerasi/ pemanjangan untai DNA.
Diperlukan suhu tinggi untuk denaturasi DNA
Digunakan enzim DNA polimerase yang tahan pada suhu 95oC (misal
enzim taq polymerase dari Thermus aquaticus)
PCR
Annealing/ priming
50-65oC, perlekatan primer pada DNA target
Elongation
68-72oC, reaksi polimerasi, pemanjangan rantai DNA
Polymerase chain reaction
Metoda untuk membuat DNA rekombinan
----- DNA cloning
Strategi :
1. Mengambil gen/ bagian gen yang diinginkan dari 1 organisme (donor)
- Memotong dengan restriction endonuclease
- dari RNA, menggunakan reverse transcriptase untuk
mendapatkan cDNA
- Amplifikasi dengan PCR
- Sintesis DNA
11/14/2017 31
http://www.bio.miami.edu/dana/250/25003_10.html
Some of the Goals of the DNA Technologist:
1. Isolation of a particular gene, part of a
gene or region of a genome
2. Production of a desired RNA or protein
molecule in large quantities
3. Increased production efficiency for
commercially made enzymes and drugs
4. Modification of existing organisms so that
they express a particularly desirable trait
not previously encoded in the genome.
5. Correction of genetic defects in complex
organisms, including humans.
11/14/2017 32
http://www.bio.miami.edu/dana/250/25003_10.html
Sifat penting vektor untuk kloning gen, a.l.:
Punya ori (origin of replication)
Dapat menerima DNA insert, kecil, tidak mudah terdegradasi
Mempunyai restriction site yang dapat digunakan untuk insersi gen
yang akan diklon
Membawa gen marker, misal pembawa sifat resistensi antibiotika
---- untuk seleksi
a.l.:
retroviruses
adenoviruses
adeno-associated viruses (AAV)
herpes simplex virus
rhinoviruses
Human Immunodeficiency Virus (HIV)
plasmids of various types (misal : plasmid pBR322,
pUC
faga lambda
cosmid (hibrid plasmid dan faga lambda)
Introduksi klon gen ke sel hospes
heteroduplex
! Competent cell:
bacterial cell
capable of picking
up DNA
Introducing recombinant plasmid to
cells host
Transformation ---> introduce naked DNA to cell host
http://www.odec.ca
Introducing recombinant plasmid to cells host (continued)
Transfection
- The introduction of foreign material into eukaryotic cells.
- Transfection typically involves opening transient pores
or 'holes' in the cell plasma membrane, to allow the
uptake of material.
- Transfection is frequently carried out by mixing a
cationic lipid with the material to produce liposomes,
which fuse with the cell plasma membrane and deposit
their cargo inside.
- The term transfection is most often used in reference
to mammalian cells.
Introducing recombinant plasmid to cells host (continued)
http://www.microscopyu.com
11/14/2017 42
http://www.bio.miami.edu/dana/250/25003_10.html
Introducing recombinant plasmid to cells host (continued)
Electroporation machine Electroporation cuvette
http://medicalexpo.com
http://www.btxonline.com/ecm-630-exponential-decay-wave-electroporation-system/
http://gmcrops.yolasite.com/methods-of-genetic-engineering
TRANSDUCTION
Viruses with affinity for certain cell types can also be
used as vectors if they are "loaded" with desired foreign
DNA and allowed to infect target host cells
11/14/2017 44
http://www.bio.miami.edu/dana/250/25003_10.html
Seleksi klon yang
mengandung
insert DNA yang
dikehendaki
-Innate immunity
-Adaptive immunity (acquired immunity)
Innate Immunity
http://classes.midlandstech.edu
Ideally, immunizing agents characters:
Inactive virus
Live attenuated vaccine
Recombinant vaccine
DNA vaccine
Figure 14-24
Live attenuated vaccine
Figure 14-25
Recombinant vaccine
INFLUENZA VIRUS
Family : Orthomyxoviridae
Genus : Influenza
Species :
Influenzavirus A : influenzavirus type A strains of human and
animals
Influenzavirus B : influenzavirus type B strains of human
Influenzavirus C : influenzavirus type C strains of human and
swine
Genetically engineered Live and killed influenza vaccines
- In development
- Contain 6 genes from attenuated virus and 2
modified or unmodified genes (HA & NA)
from circulating virus
- Can be prepared relatively quick for new
emerging influenza virus
- Risk for re-assortment of the vaccine virus
with circulating influenza virus --- novel
subtype that could spread in the human
population
http://triplehelixblog.com/2011/01/medical-innovation-future-promise-of-dna-vaccines/
Examples: Some current dengue vaccine
candidates
Approach Vaccine developer DENV genes/antigen
Live, attenuated, PDK cells Mahidol/ Sanofi Pasteur All 10 DENV genes
Live, attenuatd, FRhL cells WRAIR/ GSK Biologicals All 10 DENV genes
Live, rationally attenuated, 3 US NIAID, John Hopkins All 10 DENV genes
deletion University
Live, 3 deletion, DEN/DEN US NIAID, John Hopkins 8 DENV4, 2 chimeric
chimeric University
Live, rationally mutated, 3 point US FDA All 10 DENV genes
mutations
Live, attenuated DENV vector, InViragen/ Shanta 8 DENV2, 2 chimeric
DEN/DEN chimeric
Live, attenuated YF17D vector, Acambis, Sanofi Pasteur 8 YF genes, 2 chimeric
YFh/DEN chimeric DENV genes
(Guirakhoo,2004)
Vaccine-related issues that must be
addressed
Safety, immunogenicity and efficacy of the final
vaccine product
Genetic stability of live attenuated vaccines
Environmental safety of genetically modified
viruses
Consensus among national regulatory
authorities and WHO on the regulatory issues
that define the manufacture, clinical testing and
licensure of live DENV vaccines
(WHO, 2010)
Factors to be considered in an
environmental risk assessment for the
recombinant GMO DENV vaccines
Include
i) genetic stability of the viruses (reversion to virulence)
ii) potential for transmission from vaccinated person
iii) the potential for recombination between the vaccine
virus and other flaviviruses, which may be present in
mosquitoes
iv) the immune status of population to be vaccinated
(WHO, 2010)
THANK YOU