Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
Cosmids are plasmid vectors that contain one or two cos sites.
(The cos site and the length between 2 cos sites is the only requirement for DNA to be
packaged into a phage particle).
How do we clone DNA into a cosmid vector ?
1. We use a polylinker.
2. We package this DNA into phage particles like phage DNA.
3. We propagate the cosmid as a plasmid (a plasmid with a selecor gene).
4. We purify the cosmids as if they were plasmids.
------------------------------Un csmido es un plsmido en el cual se han clonado las secuencias cos necesarias para
la encapsulacin de partculas de fago lambda. Un csmido presenta las 5 caractersticas siguientes:
1.
2.
3.
4.
5.
from:
http://www.bi.umist.ac.uk/users/mjfssps/2GEN/Cosmid2.htm
T3 Promoter
T7 Promoter
Not I
EcoR I
gaattcgcggccgcaattaaccctcactaaagggatccctatagtgagtcgtattatgcggccgcgaattc
fosmide
Fosmids are similar to cosmid vectors in that they contain cohesiveend sites (cos)
for bacteriophage packaging of cloned DNA inserts 35-45 kb in size.
However, like BACs,fosmids are derived from geneticelements of the single copy
fertility(F) factor of E. coli, which enables fosmids to maintain genomic DNA inserts with
much higher stability than cosmids.
Artificial chromosomes
Rice has a genome size of 430 Mb
which is the smallest among the major cereal crops such as maize,
barley and wheat. It is also considered to be a model cereal because of its synteny
with other cereal genomes.
In Japan, the Rice Genome Research Program (RGP) was launched in 1991 to characterize
the genomic structure of rice which is fundamental in understanding its function as well. During the
first 7 years of RGP, we analyzed about 29000 cDNA clones of Oryza sativa ssp.
japonica variety, Nipponbare and constructed a 2275-marker genetic map from a cross between
the japonica variety, Nipponbare and the indica variety, Kasalath. A comprehensive analysis of the
structure and organization of the complex genome of rice requires techniques that permit
cloning and handling of large DNA fragments. Essentially, two host systems namely,
Saccharomyces cerevisiae and Escherichia coli have been developed for this purpose.
YACs, PACs and BACs
YACs:
Extremely large DNA molecules (up to more than 1 Mb) can be introduced and
propagated in the form of yeast artificial chromosomes (YACs) in S. cerevisiae.
This library was then used for the construction of a YAC-based physical map using DNA
markers on the genetic map (Kurata et al. 1997, Saji et al. 1999) covering about 70 % of
rice genome. Although the YAC system has been used for other genomes as well, several
limitations such as the frequent occurrence of chimeric clones (Green et al. 1991),
instability of cloned fragments (Neil et al. 1990) and the relatively laborious procedures
required for the purification of the cloned DNA, fostered the establishment of the E. coli
cloning systems (Monaco and Larin 1994). Accordingly, the strong efforts devoted
toward the detailed analysis of the Oryza sativa genome, particularly toward its entire
sequencing project started from 1998 (Sasaki 1998), created a strong demand for
high-quality PAC or BAC libraries. Two Oryza sativa BAC libraries from indica variety,
IR-BB21 (Guo et al. 1995) and japonica variety, Shimokita (Nakamura et al. 1997) have
been established for gene cloning experiments. Based on the insert size and number of
PAC 1
Construction and Characterization of Rice Genomic Libraries: PAC ...
The PAC library has a coverage of about 16 genome equivalents and consists of 69276
recombinant clones carrying inserts (generated by partial Sau 3AI digestion) with an average
size of about 112 kb in a PAC vector, pCYPAC2.
Hybridization with organellar DNA revealed the presence of 11.8 % clones with chloroplast DNA
and 0.9 % clones with mitochondrial DNA.
On the other hand, the BAC library has a coverage of about 14 genome equivalents
and consists of 47194 recombinant clones carrying inserts (generated by partial MboI digestion)
of an average size of about 133 kb in a BAC vector, pBeloBAC11.
Hybridization with organellar DNA revealed the presence of 2.5 % clones with chloroplast DNA
and 0.6 % clones with mitochondrial DNA.
With extensive genome coverage, these libraries provide excellent resources for genome analysis
such as genetic mapping, map-based gene cloning, and genome sequencing of the two major
subspecies of rice.
PAC 2
PACs drawn as light grey horizontal bars between CAT and PAX6 are from the PAC contig
described previously in Niederfuhr et al. (1998). Square boxes at the ends of most clones allude
to the SP6 (empty box) and the T7 ends (filled box) that have been used for hybridization analysis.
Every PAC clone crossing a presumed verticalline through these boxes had shown a positive
hybridization signal with the respective end probe and was thus proven to overlap.
At the PAX6 locus several cosmid clones are shown that have been sequenced previously by the Sanger
Centre (GenBank accession nos. Z83301, Z83306-83309, Z86001, and Z95332).
The horizontal line on top of the contig represents the integrated map of 11p1314.1
with known markers and NotI restriction sites that are indicated by tick marks.
Genes are highlighted by shaded boxes and the newlyintegrated EST clones are written at a 45 angle.
The positions of RAG1/2 and TRAF6 as well as of the three EST clones 60587, 125727, and 41188,
have been determined byhybridization to YAC clones located at the centromeric border of 11p13.
BAC
An exercise:
Construction and characterization of a bacterial artificial chromosome library
of Arabidopsis thaliana.
Sangdun Choi, Robert A. Creelman, John E. Mullet, Rod A. Wing*
Crop Biotechnology Center. Texas A&M University, College Station, TX 77843
*author for correspondence (email address): rodwing@tam2000.tamu.edu
http://weedsworld.arabidopsis.org.uk/Vol2/choi.html
Abstract
We constructed an ordered 3,948 clone Arabidopsis BAC library.
The library has a combined average insert size of 100 kb (n=54).
Assuming a haploid genome size of 100,000 kb, the BAC library contains 3.95 haploid genome equivalents
with a 98% probability of isolating a specific genomic region.
The library was screened with five Arabidopsis cDNA probes and one tomato probe and
all probes hybridized to at least one (in most cases three) BAC clones in the library.
Introduction
The technique of chromosome walking provides a means of cloning any gene identified
by mutational analysis. Arabidopsis thaliana is the best plant system to utilize this technique because
of its small genome size, low repetitive DNA content, availability of a dense genetic map
and existence of a large number of mapped probes.
In order to facilitate chromosome walking, libraries of the Arabidopsis genome have been constructed
using yeast artificial chromosome (YAC) vectors (summarized in Gibson and Somerville, 1992).
The primary advantage of YACs is the potential for cloning large insert sizes
(ranging from 100 to 150 kb for A. thaliana "abi1", "U", and "EW" libraries)
Despite the successes of the YAC vector cloning system, many problems exist which include chimerism
and tedious steps in the manipulation and isolation of YAC insert DNA.
Utilizing an F factor derived cloning system,
bacterial artificial chromosome (BAC) vectors have been used to clone human DNA with inserts as
large as 300 kb and plant, DNA with inserts averaging 157 and 140 kb, respectively.
BACs are maintained as single copy plasmids in E. coli and exclude other BAC plasmids from replicating
in the same host cell. Advantages of BACs over YACs include lower levels of chimerism
and ease of library generation and insert manipulation.
Techniques also exist to isolate the proximal ends of fragments inserted into the BAC vector.
In this report, we describe the construction and characterization of an A. thaliana BAC library.
Size selection of a HindIII partial digest was carried out in a 1% low melting point
agarose gel at 4.0 V/cm with a 5 second pulse for 10 h at 11 C
The Hind III digest were ligated to dephosphorylated pBeloBAC11 (after this BAC was open by Hind III)
pBeloBAC11 represents the second generation BAC cloning vectors. It introduces the LacZ gene to facilitate
recombinant identification with blue and colorless (white) phenotypes. The T7 and SP6 promoters facilitate the
Generatiion of RNA probes for chromosome walking and DNA sequencing.
The G + C rich restriction sites (Not I, Eag I, Xma I, Sma I, Bgl I, and Sfi I) can be used to excise the inserts of
BAC clones. There are two selective markers for cloning purposes: LacZ gene for recombinant selection and
CMR (chloramphenicol) for transformant selection. The F factor codes for genes that regulate its own
replication and controls its copy number. The genes oriS and repE mediate the unidirectional replication
of the F factor, and the parA and parB maintain copy number at a level of one or two per cell.
Transformed cells were resuspended in SOC, incubated at 37 C for one h, and plated onto LB agar
containing 12.5 mg/ml chloramphenicol, 0.5 mM IPTG and 40 mg/ml X-Gal (screening).
White colonies were transferred to microtiter plates containing LB freezing buffer (Woo et al., 1994),
incubated at 37C for 24 h and then stored at -80 C.
Recombinant BAC DNA Isolation, Restriction, and CHEF Analysis
BACs containing A. thaliana DNA were isolated from 5 ml overnight cultures
(LB plus 12.5 mg/ml chloramphenicol) using standard alkaline lysis procedures and resuspended in
TE. BAC DNA was digested with NotI to free the genomic DNA from the 7.4 kb vector.
The digested DNA was separated by electrophoresis in a 1% agarose gel in 0.5x TBE at 11 C using a
Bio-Rad CHEF Mapper set at 6 v/cm with a linear pulse time ramping from 5 to 15 s for 16 h.