Molecular evolution

Dr. Yougesh Kumar

dryougeshkumar@yahoo.co.in

Molecular evolution

The increasing available completely sequenced organisms and the importance of evolutionary processes that affect the species history, have stressed the interest in studying the molecular evolution events at the sequence level.

Plan Context selection pressure (definitions)

Genetic code and inherent properties of codons and amino-acids

Estimations of synonymous and nonsynomynous substitutions Codons volatility

Applications

Evolutionary processes include:

Ancestor

Expansion*
duplication HGT

Phylogeny*
genesis

species genome
loss

HGT

Exchange*

Deletion*

and selection

Gene tree - Species tree

Time

Duplication Duplication

B Species tree

Speciation Speciation

B Gene tree

Genomes 2 edition 2002.. T.A. Brown

Original version

Actual version

Hurles M (2004) Gene Duplication: The Genomic Trade in Spare Parts. PLoS Biol 2(7): e206.

Homolog - Paralog - Ortholog

O Homologs: A1, B1, A2, B2 Paralogs: A1 vs B1 and A2 vs B2

Orthologs: A1 vs A2 and B1 vs B2

A1A1

BB 11

A 22 A

BB 22 Sequence analysis a S1 S2 b

Species-1

Species-2

Molecular evolutionary analysis

Aim at understanding and modeling evolutionary events; Evolutionary modeling extrapolates from the divergence between sequences that are assumed homologous, the number of events which have occurred since the genes diverged; If rate of evolution is known, then a time since divergence can be estimated.

Molecular evolution
Applications:
Molecular evolution analysis has clarified: the evolutionary relationships between humans and other primates; the origins of AIDS;

the origin of modern humans and population migration;

speciation events;

genetic material exchange between species.

origin of some deseases (cancer, etc...) .....

Molecular evolution

GACGACCATAGACCAGCAT AG GACTACCATAGACTGCAAAG *** ******** * *** ** GACGACCATAGACCAGCAT AG GACTACCATAGACTGCAAAG

Two possible positions for the indel

*** ********* *** **

Molecular evolution
GACGACCATAGACCAGCA TAG GACTACCATAGACTGCAAAG

Mutations arise due to inheritable changes in genomic DNA sequence;

Mechanisms which govern changes at the protein level are most likely due to nucleotide substitution or insertions/deletions;

Changes may give rise to new genes which become fixed if they give the organism an advantage in selection;

Molecular evolution: Definitions

Purifying (negative) selection
A consequence of gene drift through random mutations, is that many mutations will have deleterious effects on fitness. Purifying selective force prevents accumulation of mutation at important functional sites, resulting in sequence conservation. -> Purifying selection is a natural selection against deleterious mutations. -> The term is used interchangeably with negative selection or selection constraints.

Neutral theory
Majority of evolution at the molecular level is caused by random genetic drift through mutations that are selectively neutral or nearly neutral. Describes cases in which selection (purifying or positive) is not strong enough to outweigh random events.

Neutral mutation is an ongoing process which gives rise to genetic polymorphisms; changes in environment can select for certain of these alleles.

Positive selection
Positive selection is a darwinian selection fixing advantageous mutations.
The term is used interchangeably with molecular adaptation and adaptive molecular evolution. Positive selection can be shown to play a role in some evolutionary events This is demonstrated at the molecular level if the rate of nonsynonymous mutation at a site is greater than the rate of synonymous mutation Most substitution rates are determined by either neutral evolution of purifying selection against deleterious mutations

Molecular evolution
We observe and try to decode the process of molecular evolution from the perspective of accumulated differences among related genes from one or diverse organisms.

The number of mutations that have occurred can only be estimated.

Real individual events are blurred by a long history of changes.

Nucleotide, amino-acid sequences

3 different DNA positions but -GGAGCCATATTAGATAGA- only one different amino acid position: -GGAGCAATTTTTGATAGA2 of the nucleotide substitutions Gly Ala Ile Phe asp Arg are therefore synonymous and one is non-synonymous. -> gene Gly Ala Ile Leu asp Arg
-> protein

DNA yields more phylogenetic information than proteins. The nucleotide sequences of a pair of homologous genes have a higher information content than the amino acid sequences of the corresponding proteins, because mutations that result in synonymous changes alter the DNA sequence but do not affect the amino acid sequence.

Kinds of nucleotide substitutions

Given 2 nucleotide sequences, we can ask how their similarities and differences arose from a common ancestor?
Single substitution Multiple substitution Coincidental substitution

A A C
1 change, 1 difference Parallel substitution

C A

T A A

C
2 change, 1 difference Back substitution

2 changes, 1 difference Convergent substitution

C A C
2 changes, no difference

T A T C

3 changes, no difference

2 changes, no difference

Substitution: Transition - transversion

Nucleotides are either purine or pyrimidines :
G (Guanine) and A (Adenine) are called purine; C (Cytosine) and T (Thymine) are called pyrimidines.

transition changes one purine for another or one pyrimidine for another. transversion changes a purine for a pyrimidine or vice versa.

transitions occur at least 2 times as frequently as transversions

Standard genetic code

The genetic code specifies how a combination of any of
the four bases (A,G,C,T) produces each of the 20 amino acids.

The triplets of bases are called codons and with four

bases, there are 64 possible codons: (43) possible codons that code for 20 amino acids (and stop signals).

Standard genetic code

F i r s t P o s i t i o n Seco nd p o sitio n | T | C | A | G | - --+-- ----- ----- --+-- --- ----- ----+ ----- ----- ----+ ----- ----- ----+ ---| T T P he ( F ) | TCT Ser ( S) | T AT T y r (Y) | TGT Cys ( C) | T T | T TC " | TCC " | TA C | TG C | C | TTA Leu ( L) | TCA " | TA A T er | TG A Ter | A T | TTG " | TCG " | TA G T er | TGG Trp ( W) | G h --+-- ----- ----- --+-- --- ----- ----+ ----- ----- ----+ ----- ----- ----+ -- i | CTT Leu ( L) | C CT P r o (P) | C AT H i s ( H) | CGT Arg ( R) | T r C | CTC " | CC C " | CA C " | CGC " | C d | CTA " | CC A " | CA A Gln ( Q) | CGA " | A | CTG " | CC G " | CA G " | CGG " | G P --+-- ----- ----- --+-- --- ----- ----+ ----- ----- ----+ ----- ----- ----+ -- o | ATT Ile ( I) | A CT T h r (T) | A AT A s n ( N) | AGT Ser ( S) | T s A | ATC " | AC C " | AA C " | AGC " | C i | ATA " | AC A " | AA A Lys ( K) | AGA Arg ( R) | A t | AT G M et ( M ) | A CG " | AAG " | AGG " | G i --+-- ----- ----- --+-- --- ----- ----+ ----- ----- ----+ ----- ----- ----+ -- o | G T V al ( V ) | G CT A la (A) | GAT A sp (D) | GGT G ly (G) | T n G | G TC " | GC C " | GAC " | GGC " | C | GT A " | G CA " | GAA G lu (E) | GGA " | A | GT G " | G CG " | GAG " | GGG " | G - --+-- ----- ----- --+-- --- ----- ----+ ----- ----- ----+ ----- ----- ----+ ---A R N D C Q E G H I L K M F P S T W Y V Ala Arg Asn Asp Cys Gln Glu Gly His Ile Leu Lys Met Phe Pro Ser Thr Trp Tyr Val Alanine Arginine Asparagine Aspartic acid Cysteine Glut ami ne Glut ami c acid Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine GCT GCC GCA G CG CGT CGC CGA C GG AGA AGG AAT AAC GAT GAC TGT TGC CAA CAG GAG GAA GGG GGA GGT GGC CAT CAC ATT ATC ATA TTA TTG CTT CTC CT A CTG AAA AAG ATG TTT TTC CCT CCC CCA CCG TCT TCC TCA TC G AGT AGC ACT ACC ACA ACG TGG TAT TAC GTT GTC GTA GTG

charg(basique), charg (acidique), hydrophil e, hydrophobe

Because there are only 20 amino acids, but 64 possible codons, the same amino
acid is often encoded by a number of different codons, which usually differ in the third base of the triplet. Because of this repetition the genetic code is said to be degenerate and codons which produce the same amino acid are called synonymous codons.

Important properties inherent to the standard genetic code

Synonymous vs nonsynonymous substitutions

Nondegenerate sites: are codon position where mutations always result in amino acid substitutions.
(exp. TTT (Phenylalanyne, CTT (leucine), ATT (Isoleucine), and GTT (Valine)). Twofold degenerate sites: are codon positions where 2 different nucleotides result in the translation of the same aa, but the 2 others code for a different aa.

(exp. GAT and GAC code for Aspartic acid (asp, D),
whereas GAA and GAG both code for Glutamic acid (glu, E)). Threefold degenerate site: are codon positions where changing 3 of the 4 nucleotides has no effect on the aa, while changing the fourth possible nucleotide results in a different aa.
There is only 1 threefold degenerate site: the 3rd position of an isoleucine codon. ATT, ATC, or ATA all encode isoleucine, but ATG encodes methionine.

Standard genetic code

Fourfold degenerate sites: are codon positions where changing a nucleotide in any of the 3 alternatives has no effect on the aa. exp. GGT, GGC, GGA, GGG(Glycine); CCT,CCC,CCA,CCG(Proline)
Three amino acids: Arginine, Leucine and Serine are encoded by 6 different codons:
R Arg Arginine L Leu Leucine S Ser Serine CGT CGC CGA C GG AGA AGG TTA TTG CTT CTC CT A CTG TCT TCC TCA TC G AGT AGC

Five amino-acids are encoded by 4 codons which differ only in the third position. These sites are called fourfold degenerate sites
A G P T V Ala Gly Pro Thr Val Alanine Glycine Proline Threonine Valine GCT GCC GCA G CG GGG GGA GGT GGC CCT CCC CCA CCG ACT ACC ACA ACG GTT GTC GTA GTG

Standard genetic code

Nine amino acids are encoded by a pair of codons which differ by a transition substitution at the third position. These sites are called twofold degenerate sites.
N D C Q E H K F Y Asn Asp Cys Gln Glu His Lys Phe Tyr Asparagine Aspartic acid Cysteine Glut ami ne Glut ami c acid Histidine Lysine Phenylalanine Tyrosine AAT AAC GAT GAC TGT TGC CAA CAG GAG GAA CAT CAC AAA AAG TTT TTC TAT TAC

Transition:

A/G; C/T

Isoleucine is encoded by three different codons

I Ile Isoleucine ATT ATC ATA

Methionine and Triptophan are encoded by single codon

M Met Methionine W Trp Tryptophan ATG TGG

Three stop codons: TAA, TAG and TGA

Standard Genetic Code

Nucleotide substitutions in protein coding genes can be divided into :

synonymous (or silent) substitutions i.e. nucleotide substitutions that do not result in amino acid changes.

non synonymous substitutions i.e. nucleotide substitutions that change amino acids.
nonsense mutations, mutations that result in stop codons.

exp: Gly: any changes in 3rd position of codon results in Gly; any changes in second position results in amino acid changes; and so is the first position.
G Gly Glycine GGG GGA GGT GGC

exp:

Glu GAG

AGC

Ser

Nonsynonymous/synonymous substitutions
Estimation of synonymous and nonsynonymous substitution rates is important in understanding the dynamics of molecular sequence evolution. As synonymous (silent) mutations are largely invisible to natural selection, while nonsynonymous (amino-acid replacing) mutations may be under strong selective pressure, comparison of the rates of fixation of those two types of mutations provides a powerful tool for understanding the mechanisms of DNA sequence evolution. For example, variable nonsynonymous/synonymous rate ratios among lineages may indicate adaptative evolution or relaxed selective constraints along certain lineages. Likewise, models of variable nonsynonymous/synonymous rate ratios among sites may provide important insights into functional constraints at different amino acid sites and may be used to detect sites under positive selection.

Codon usage
There are 64 (43) possible codons that code for 20 amino acids (and stop signals). If nucleotide substitution occurs at random at each nucleotide site, every nucleotide site is expected to have one of the 4 nucleotides, A, T, C and G, with equal probability. Therefore, if there is no selection and no mutation bias, one would expect that the codons encoding the same amino acid are on average in equal frequencies in protein coding regions of DNA.

In practice, the frequencies of different codons for the same amino acid are usually different, and some codons are used more often than others. This codon usage bias is often observed.
Codon usage bias is controlled by both mutation pressure and purifying selection.

Estimating synonymous and nonsynonymous differences

For a pair of homologous codons presenting only one nucleotide difference, the number of synonymous and nonsynonymous substitutions may be obtained by simple counting of silent versus non silent amino acid changes; For a pair of codons presenting more than one nucleotide difference, distinction between synonymous and nonsynonymous substitutions is not easy to calculate and statistical estimation methods are needed; For example, when there are 3 nucleotide differences between codons, there are 6 different possible pathways between these codons. In each path there are 3 mutational steps. More generally there can be many possible pathways between codons that differ at all three positions sites; each pathway has its own probability.

Estimating synonymous and nonsynonymous differences

Observed nucleotide differences between 2 homologous sequences are classified into 4 categories: synonymous transitions, synonymous transversions, nonsynonymous transitions and nonsynonymous transversions. When the 2 compared codons differ at one position, the classification is obvious.

When they differ at 2 or 3 positions, there will be 2 of 6 parsimonious pathways along which one codon could change into the other, and all of them should be considered.
Since different pathways may involve different numbers of synonymous and nonsynonymous changes, they should be weighted differently.

Example: 2 homologous sequences

Glu Val Phe

SEQ.1 GAA GTT TTT SEQ.2 GAC GTC GTA

Asp Val Val

Codon 1: GAA --> GAC ;1 nuc. diff., 1 nonsynonymous difference; Codon 2: GTT --> GTC ;1 nuc. diff., 1 synonymous difference;

Codon 3: counting is less straightforward:

1 GTT(V:Val) GTA(V:Val) TTT(F:Phe) 2 TTA(L:Leu)

Path 1 : implies 1 non-synonymous and 1 synonymous substitutions; Path 2 : implies 2 non synonymous substitutions;

Evolutionary Distance estimation between 2 sequences

The simplest problem is the estimation of the number of synonymous (dS) and nonsynonymous (dN) substitutions per site between 2 sequences: the number of synonymous (S) and nonsynonymous (N) sites in the sequences are counted; the number of synonymous and nonsynonymous differences between the 2 sequences are counted; a correction for multiple substitutions at the same site is applied to calculate the numbers of synonymous (dS) and nonsynonymous (dN) substitutions per site between the 2 sequences.

==> many estimation Methods

Evolutionary Distance estimation

In general the genetic code affords fewer opportunities for nonsynonymous changes than for synonymous changes. rate of synonymous >> rate of nonsynonymous substitutions.
Furthermore, the likelihood of either type of mutation is highly dependent on amino acid composition. For example: a protein containing a large number of leucines will contain many more opportunities for synonymous change than will a protein with a high number of lysines.
L Leu Leucine TTA TTG CTT CTC CT A CTG
4forld degeneratesite 2fold degenerate site

Several possible substitutions that will not change the aa Leucine

K Lys Lysine

AAA AAG

Only one possible mutation at 3rd position that will not change Lysine

Evolutionary Distance estimation

Fundamental for the study of protein evolution and useful for constructing phylogenetic trees and estimation of divergence time.

Estimating synonymous and nonsynonymous substitution rates

QuickTime et un dcompresseur TIFF (non compress) sont requis pour visio nner cette image.

Ziheng Yang & Rasmus Nielsen (2000) Estimating synonymous and nonsynonymous substitution rates under realistic evolutionary models. Mol Biol Evol. 17:32-43.

Purifying selection:
Most of the time selection eliminates deleterious mutations, keeping the protein as it is.

Positive selection:
In few instances we find that dN (also denoted Ka) is much greater than dS (also denoted Ks) (i.e. dN/dS >> 1 (Ka/Ks >>1 )). This is strong evidence that selection has acted to change the protein.
Positive selection was tested for by comparing the number of nonsynonymous substitutions per nonsynonymous site (dN) to the number of synonymous substitutions per synonymous site (dS). Because these numbers are normalized to the number of sites, if selection were neutral (i.e., as for a pseudogene) the dN/dS ratio would be equal to 1. An unequivocal sign of positive selection is a dN/dS ratio significantly exceeding 1, indicating a functional benefit to diversify the amino acid sequence.

dN/dS < 0.25 indicates purifying selection;

dN/dS = 1 suggests neutral evolution; dN/dS >> 1 indicates positive selection.

Negative (purifying) selection eliminates mutations i.e. inhibits protein evolution.

disadvantageous

(explains why dN < dS in most protein coding regions)

Positive selection is very important for evolution of new functions especially for duplicated genes.

(must occur early after duplication otherwise null mutations and will be fixed producing pseudogenes).
dN/dS (or Ka/Ks) measures selection pressure

Mutational saturation
Mutational saturation in DNA and protein sequences occurs when sites have undergone multiple mutations causing sequence dissimilarity (the observed differences) to no longer accurately reflect the true evolutionary distance i.e. the number of substitutions that have actually occurred since the divergence of two sequences. Correct estimation of the evolutionary distance is crucial. Generally: sequences where dS > 2 are excluded to avoid the saturation effect of nucleotide substitution.

YN00 - P13.4.C13.18.fa.paml ns = 13 ls = 29 Estimation by the method of: Yang & Nielsen (2000):
seq.
YALI0A08195g YALI0E25443g YALI0E25443g YALI0C21230g YALI0C21230g YALI0C21230g YALI0C21230g YALI0C21230g YALI0C21230g YALI0C21230g YALI0C21230g . YALI0C21230g YALI0D11638g YALI0E19140g YALI0E19140g

seq.
YALI0A17963g YALI0A17963g YALI0A08195g YALI0A17963g YALI0A08195g YALI0E25443g YALI0A02783g YALI0C21252g YALI0C21274g YALI0F09944g YALI0A13497g YALI0B06160g YALI0C21230g YALI0C21230g YALI0D11638g

S
15.1 17.3 17.6 24.1 24.5 24.9 24.6 25.4 25.3 24.3 28.2 27.1 27.3 25.2 22.4

N
71.9 69.7 69.4 62.9 62.5 62.1 62.4 61.6 61.7 62.7 58.8 59.9 59.7 61.8 64.6

t
0.37 1.8 1.00 5.35 6.58 4.76 4.71 6.64 6.54 7.51 7.13 7.34 8.04 7.67 4.12

kappa omega dN +- SE
1.31 1.31 1.31 1.31 1.31 1.31 1.31 1.31 1.31 1.31 1.31 1.31 1.31 1.31 1.31 0.20 0.05 0.06 0.75 0.57 1.27

dS +- SE

0.07 +- 0.03 0.36 +- 0.22 0.13 +- 0.05 2.55 +- 13.95 0.08 +- 0.03 1.35 +- 0.70 1.63 1.81 1.69 1.97 2.77 2.75 2.97 3.06 2.79 3.07 3.09 1.04 ++++++++++++1.06 1.43 0.57 0.81 2.27 2.21 2.93 3.38 2.37 3.40 3.46 0.29 2.19 3.19 1.33 0.55 0.86 0.79 1.29 0.95 1.68 1.83 1.25 2.33 ++++++++++++1.70 6.21 0.59 0.21 0.32 0.34 1.09 0.34 0.86 1.39 0.54 2.13

3.58 3.22 3.46

2.31

3.20
.. 1.66 1.68 2.48 0.45

-> yn00 similar results than ML (Yang & Nielsen (2000))

-> advantage : easy automation for large scale comparisons;

PAML: Phylogenetic Analysis by Maximum Likelihood (PAML)

http://abacus.gene.ucl.ac.uk/software/paml.html

Relative Rate Test

1 A 2 3 For determining the relative rate of substitution in species 1 and 2, we need and outgroup (species 3). The point in time when 1 and 2 diverged is marked A (common ancestor of 1 and 2).

The number of substitutions between any two species is assumed to be the sum of the number of substitutions along the branches of the tree connecting them: d13=dA1+dA3
d23=dA2+dA3 d12=dA1+dA2

d13, d23 and d12 are measures of the differences between 1 and 3, 2 and 3 and 1 and 2 respectively.
dA1=(d12+d13-d23)/2 dA2=(d12+d23-d13)/2 dA1 and dA2 should be the same (A common ancestor of 1 and 2).

Evolution of functionally important regions over time. Immediately after a speciation event, the two copies of the genomic region are 100% identical (see graph on left). Over time, regions under little or no selective pressure, such as introns, are saturated with mutations, whereas regions under negative selection, such as most exons, retain a higher percent identity (see graph on right). Many sequences involved in regulating gene expression also maintain a higher percent identity than do sequences with no function.

COMPARATIVE GENOMICS

Webb Miller, Kateryna D. Makova, Anton Nekrutenko, and Ross C. Hardison Annual Review of Genomics and Human Genetics

Vol. 5: 15-56 (2004)

Reference
Yang & Nielsen, Esimating Synonymous and Nonsynonymous Substitution Rates Under Realistic Evolutionary Models Mol. Biol. Evol. 2000, 17:32-43

=>Other estimation Models

Evolutionary Distance estimation between 2 sequences

Under certain conditions, however, nonsynonymous substitution may be accelerated by positive Darwinian selection. It is therefore interesting to examine the number of synonymous differences per synonymous site and the number of nonsynonymous differences per nonsynonymous site.

p-distance: ps = Sd/S pn = Nd/N

proportion of synonymous differences ;

var(ps) = ps(1-ps)/S.

proportion of non synonymous differences;

var(pn) = pn(1-pn)/S.

Sd and Nd are respectively the total number of synonymous and non synonymous differences calculated over all codons. S and N are the numbers of synonymous and nonsynonymous substitutions. S+N=n total number of nucleotides and N >> S. ps is often denoted Ks and pn is denoted Ka.

Substitutions between protein sequences p = nd/n V(p)=p(1-p)/n

nd and n are the number of amino acid differences and the total number of amino acids compared. However, refining estimates of the number of substitutions that have occurred between the amino acid sequences of 2 or more proteins is generally more difficult than the equivalent task for coding sequences (see paths above). One solution is to weight each amino acid substitution differently by using empirical data from a variety of different protein comparisons to generate a matrix as the PAM matrix for example.

Number of synonymous (ds) and non synonymous (dn) substitutions per site
1) Jukes and Cantor, one-parameter method denoted 1-p : This model assumes that the rate of nucleotide substitution is the same for all pairs of the four nucleotides A, T, C and G (generally not true!). d = -(3/4)*Ln(1-(4/3)*p) where p is either ps or pn. 2) Kimura's 2-parameter, denoted 2-p : The rate of transitional nucleotide substitution is often higher than that of transversional substitution. d = -(1/2)*Ln(1 -2*P -Q) -(1/4)*Log(1 -2*Q) P is the proportion of transitional differences, Q is the proportion of transversional differences P and Q are respectively calculated over synonymous and non synonymous differences.

Jukes-Cantor model : A T C G A l l l T l l l C l l l G l l l Tajima-Nei model : A T C A g T g C G g G d d d -

Other distance models

l is the rate of substitution.

, , g and d are the rates of substitution.

Kimura 2-parameters model : A T C G A T and are the rates of transitional C G and transvertional substitutions Tamura model : A T A (1-q T (1-q) C (1-q) (1-q G (1-q (1-q Hasegaw a et al . A A T gA C gA G gA C q q q G q q q G gG gG gG -

and are the rates of transitional and transvertional substitutions and q is the G+C content.

model : T C gT gC gC gT gT gC

and are the rates of transitional and transvertional substitutions and gi the nucleotide frequencies (i=A,T,C,G).

Tamura-Nei model : A T A gT T gA C gA gT2 G gA1 gT

C gC gC2 gC

G gG1 gG gG -

1 and 2 are the rates of transitional su bstitutions

betw een purines and betw een pyrimidines; is the rate of transvertional substitutions; and gi the nucleotide frequencies (i=A,T ,C,G).

 Example: yn00 in PAML.

Protein sequences in a family and corresponding DNA sequences

Procedure
1. Alignment of a family protein sequences using clustalW
2. Alignment of corresponding DNA sequences using as template their corresponding amino acid alignment obtained in step 1 3. Format the DNA alignment in yn00 format 4. Perform yn00 program (PAML package) on the obtained DNA alignment 5. Clean the yn00 output to get YN (Yang & Nielsen) estimates in a file. Estimations with large standard errors were eliminated 6. From YN estimates extract gene pairs with w = dN/dS >= 3 and gene pairs with w<= 0.3, respectively. 7. Genes with w>=3 are considered as candidate genes on which positive selection may operate. Whereas genes with w<=0.3 are candidates for purifying (negative) selection

 Most of the genes are under purifying selection Only few genes might be under positive selection
m std n 0.90 0.6 2.96 1.3 0.34 0.32 3.6 0.57 min 5085 5085 5085 10 0.0 0.0 0.0 3.0 Max 4.98 6.84 4.45 4.45

dN dS w=d N/dS w=d N/dS >=3

 Codon volatility

A new concept: codons volatility

(Plotkin et al. 2004. nature 428. p.942-945).

New method recently introduced, the utility of which is still under debate; has interresting consequences on the study of codon variability;

Detecting Selection
If a protein coding region of a nucleotide sequence has undergone an excess number of amino-acid substitutions, then the region will on average contain an overabundance of volatile codons, compared with the genome as a whole. Using the concept of codon volatility, we can scan an entire genome to find genes that show significantly more, or less, pressure for amino-acid substitutions than the genome as a whole. If a gene contains many residues under pressure for aa replacements, then the resulting codons in that gene will on average exhibit elevated volatility.

If a gene is under purifying selection not to change its aa, then the resulting sequence will on average exhibit lower volatility.
Plotkin et al. Nature 428; 942-945

Codons volatility
2 1 8 7 5 6 4 1 8 5 6 3 2 3

The codon CGA encoding arginine (R), has 8 potential ancestor codons (i.e. non stop codon) that differ from CGA by one substitution.

Volatility of a codon is defined as the proportion of nonsynonymous codons over the total neighbour sense codons obtained by a single substitution.
The volatility of CGA = 4/8. The volatility of AGA also encodes an arginine = 6/8.
Plotkin et al. 2004. Nature 428. p.942-945

Codons volatility
22 codons have at least one synonymous with a different volatility;

Volatility of a codon c:
v(c) = 1/n {D[aacid(c) - aacid(ci)];i=1,n}; n is the number of neighbors (other than non-stop codons) that can mutate by a single substitution. D is the Hamming distance = 0 if the 2 aa are identical; =1 otherwise.

Volatility of a gene G:
v(G) = {v(ck);k=1,l}; l is the number of codons in the gene G.

Codons volatility
Volatility is used to quantify the probability that the most recent substitution of a site caused an amino-acid change. Each genes observed volatility is compared with a bootstrap distribution of alternative synonymous sequences, drawn

according to the background codon usage in the genome,

and its significance statistically assessed. Randomization procedure controls for the genes length and amino-acid composition. The volatility of a gene G is defined as the sum of the volatility of its codons.

Codons volatility
Volatility p-value of G: The observed v(G) is compared with a bootstrap distribution of 106 synonymous versions of the gene G. In each randomization sample, a nucleotide sequence G is constructed so that it has the same translation as G but whose codons are drawn randomly according to the relative frequencies of synonymous codons in the whole genome. p-value for G = proportion of randomized samples; so that v(G) > v(G).

1-p is a p-value that tests whether a gene is significantly less volatile than the genome as a whole.

Detecting Selection
A p-value near zero indicates significantly elevated volatility, whereas a p-value near one indicates significantly depressed volatility. The probability that a sites most recent substitution caused a non-synonymous change is:

- greater for a site under positive selection;

- smaller for a site under negative (purifying) selection.

http://www.cgr.harvard.edu/volatility

1) Paul M. Sharp Gene "volatility" is Most Unlikely to Reveal Adaptation MBE Advance Access published on December 22, 2004. doi:10.1093/molbev/msi073 2) Tal Dagan and Dan Graur The Comparative Method Rules! Codon Volatility Cannot Detect Positive Darwinian Selection Using a Single Genome Sequence MBE Advance Access published on November 3, 2004. doi:10.1093/molbev/msi033 3) Robert Friedman and Austin L. Hughes Codon Volatility as an Indicator of Positive Selection: Data from Eukaryotic Genome Comparisons MBE Advance Access originally published on November 3, 2004. This version published November 8, 2004. doi:10.1093/molbev/msi038 4) Hahn MW, Mezey JG, Begun DJ, Gillespie JH, Kern AD, Langley CH, Moyle LC. Evolutionary genomics: Codon bias and selection on single genomes. Nature. 2005 Jan 20;433(7023):E5-6.

-> Volatility is not adequate for predicting selection;

-> Extreme volatility classes have interesting properties, in terms of aa 5) Nielsen R, Hubisz MJ. composition or codon bias; Evolutionary genomics: Detecting selection needs comparative data.
Nature. 2005 Jan 20;433(7023):E6. 6) Chen Y, Emerson JJ, Martin TM Evolutionary genomics: Codon volatility does not detect selection. Nature. 2005 Jan 20;433(7023):E6-7. 7) Zhang J, 2005. On the evolution of codon volatility Genetics 169: 495-501.

-> Volatility may be another measure of codon bias;

-> Authors : some genes are under more positive, or less negative, 8) Plotkin JB, Dushoff J, Fraser HB. selection than others. Evolutionary genomics: Codon volatility does not detect selection (reply).
Nature. 2005 Jan 20;433(7023):E7-8.
9) Plotkin JB, Dushoff J, Desai MM and Fraser HB Synonymous codon and selection on proteins

Codon Volatility (simple substitution model): Codons and volatility under simple substitution model

aa A A A A R R R R R R N N D D C C Q Q E E G G G G H H I I I L L L L L L K K M F F P P P P S S S S S

GCT GCC GCA GCG CGT CGC CGA CGG AGA AGG AAT AAC GAT GAC TGT TGC CAA CAG GAA GAG GGT GGC GGA GGG CAT CAC ATT ATC ATA TTA TTG CTT CTC CTA CTG AAA AAG ATG TTT TTC CCT CCC CCA CCG TCT TCC TCA TCG AGT

3 3 3 3 3 3 4 4 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1

D 1 1

1 1 1 1 1 1

G 1 1 1 1 1 1 1 1 1 1

1 1

1 1 1 1 1 1 1 2 2 1

P 1 1 1 1 1 1 1 1

S 1 1 1 1 1 1

T 1 1 1 1

V 1 1 1 1

1 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1

1 1

1 1 1 1 1 1 1 1 1 1 1 1

2 2

1 1 1 1

1 1 1 1

1 1

1 1

1 1 2 2 1 1 1 1 1 1 1 1

2 2

1 1

1 1 2 2 1 1

2 2 1 1

1 1 1 1

1 1 1 1 1 1 1 1 2 2

1 1 3 3 3 3 1 1 2 2 2 1 1 1 1 1 1 1 3 1 1 1 1 2 3 3 1 1 1 1 1 1 1 1 2 2 2 3 3 4 4

1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 3 3 3 1 1 1 1 1 1 1 1 1 1 3 3 3 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

1 1 1 1 1 1

1 1 1 1 1 1 1

2 2 1 1

1 1 1 1

1 1 1 1 1

1 1 1 1 1 1 1 1 1

1 1

1 1 1

1 1 1 1 1 1 1 1

1 1 1 1 1 1

1 1

1 1 1 1

1 1 1

taa 9 9 9 9 9 9 8 9 8 9 9 9 9 9 8 8 8 8 8 8 9 9 8 9 9 9 9 9 9 7 8 9 9 9 9 8 8 9 9 9 9 9 9 9 9 9 7 8 9

daa 6 6 6 6 6 6 4 5 6 7 8 8 8 8 7 7 7 7 7 7 6 6 5 6 8 8 7 7 7 5 6 6 6 5 5 7 7 9 8 8 6 6 6 6 6 6 4 5 8

Vol 0 . 67 0 . 67 0 . 67 0 . 67 0 . 67 0 . 67 0.5 0 . 56 0 . 75 0 . 78 0 . 89 0 . 89 0 . 89 0 . 89 0 . 88 0 . 88 0 . 88 0 . 88 0 . 88 0 . 88 0 . 67 0 . 67 0 . 63 0 . 67 0 . 89 0 . 89 0 . 78 0 . 78 0 . 78 0 . 71 0 . 75 0 . 67 0 . 67 0 . 56 0 . 56 0 . 88 0 . 88 1. 0 . 89 0 . 89 0 . 67 0 . 67 0 . 67 0 . 67 0 . 67 0 . 67 0 . 57 0 . 63 0 . 89

G+C 2 3 2 3 2 3 2 3 1 2 0 1 1 2 1 2 1 2 1 2 2 3 2 3 1 2 0 1 0 0 1 1 2 1 2 0 1 1 0 1 2 3 2 3 1 2 1 2 1

A+T 1 0 1 0 1 0 1 0 2 1 3 2 2 1 2 1 2 1 2 1 1 0 1 0 2 1 3 2 3 3 2 2 1 2 1 3 2 2 3 2 1 0 1 0 2 1 2 1 2

S T T T T W Y Y V V V V Tot

AGC ACT ACC ACA ACG TGG TAT TAC GTT GTC GTA GTG

3 1 1 1 1

1 1 1

1 1 2 1 1 1 1 1 1

1 1 1 1 1 1 1

1 1

1 1 1 1 1

1 1 1 1

2 1 1

1 2 2 1 1 1 1 1

1 3 3 3 3 1 1 3 3 3 3 36

1 1 1 1 36

54 18 18 18

1 1 1 1 1 1 18 18 36

1 1 2 2 18 27 54

1 1 1

1 18 9

9 9 9 9 9 7 7 7 9 9 9 9

8 6 6 6 6 7 6 6 6 6 6 6

0 . 89 0 . 67 0 . 67 0 . 67 0 . 67 1. 0 . 86 0 . 86 0 . 67 0 . 67 0 . 67 0 . 67

2 1 2 1 2 2 0 1 1 2 1 2

1 2 1 2 1 1 3 2 2 1 2 1

18 36

54 36 9

18

Volatility
0.4 0.5 0.6 0.7 0.8 0.9 1

Arg Gly 12 distinct volatility values

Codons Volatility: Standard Genetic Code

Leu
AA_Codons

Ser

only 4 aa contain synonymous codons (22) of different volatilities

RCGA RCGG LCTA LCTG STCA GGGA STCG AGCT AGCC AGCA AGCG RCGT RCGC GGGT GGGC GGGG LCTT LCTC PCCT PCCC PCCA PCCG STCT STCC TACT TACC TACA TACG VGTT VGTC VGTA VGTG LTTA LTTG RAGA RAGG IATT IATC IATA YTAT YTAC CTGT CTGC QCAA QCAG EGAA EGAG KAAA KAAG HCAT HCAC NAAT NAAC DGAT DGAC FTTT FTTC SAGT SAGC MATG WTGG

Vol 0.5 0.56 0.57 0.63 0.67 0.71 0.75 0.78 0.86 0.88 0.89 1.

1 1 1 6

2 1 1 2 12 1 3 3 1

3 1 7

1 2 1 1 2 2 1 1 4 5 1

Spearman r = 0.4312 p < 0.0005

Vol 0.5 0.56 0.57 0.63 0.67 0.71 0.75 0.78 0.86 0.88 0.89 1.

0 1 7

1 1 1 2 12 1 3 3 1

2 1 1 6

1 2 1 1 4 5 1 3 1 1 2

Spearman r = 0.4283 p < 0.0006

QuickTime et un dcompresseur TIFF (non compress) sont requis pour visionner cette image.

Qui ckTi m e e t u n d com press e ur T IFF ( n on c o mp re s s) s on t requi s p ou r vis i o nn er c e tte i m age.

References:
Ziheng Yang and Rasmus Nielsen (2000) Estimating synonymous and nonsynonymous substitution rates under realistic evolutionary models. Mol Biol Evol. 17:32-43.

Yang Z. and Bielawski J.P. (2000)

Statistical methods for detecting molecular adaptation Trends Ecol Evol. 15:496-503. Phylogenetic Analysis by Maximum Likelihood (PAML) http://abacus.gene.ucl.ac.uk/software/paml.html Plotkin JB, Dushoff J, Fraser HB (2004) Detecting selection using a single genome sequence of M. tuberculosis and P. falciparum. Nature 428:942-5. Molecular Evolution; A phylogenetic Approach Page, RDM and Holmes, EC (Blackwell Science, 2004)

Sharp, PM & Li WH (1987). NAR 15:p.1281-1295.

References
Phylogeny programs : http://evolution.genetics.washington.edu/phylip/sftware.html

MEGA: http://www.megasoftware.net/
PAML: http://abacus.gene.ucl.ac.uk/software/paml.html

Books:
Fundamental concepts of Bioinformatics. Dan E. Krane and Michael L. Raymer Genomes 2 edition. T.A. Brown Molecular Evolution; A phylogenetic Approach Page, RDM and Holmes, EC
Blackwell Science