Most slide were adapted directly from various sources in the internet

Native

Hybrid
S E L E C T I V E breeding

8000-3000 BC. Egyptian domestication of animals

How are traits passed on from parents to children?

The study of how traits are inherited or how genetic information is passed from one generation to the next is called GENETICS Genetics also explains biological variation

How are traits passed on from parents to children?

1. Pre-Mendelian blending theory 2. Gene theory (which traces back to Mendel)

1. 19th Century Hypothesis

(before Mendel)

inheritance was the blending of characteristics

We look somewhat like our parents characteristics were merely added together: the next generation is a blend

How would the population look like after many generations?

Blending in Parakeet:
Yellow x Green = Blue?

Several shades!!!

Fact: There is tremendous diversity of life forms

About 8.8 million species; only a quarter has been discovered!!!

1. 19th Century Hypothesis

(before Mendel)

inheritance as the blending of characteristics was incorrect No one studied the problem systematically until Gregor Mendel (1822-1884)

Gregor Mendel (1822-1884)

A little known Austrian monk (flunked out of college twice but became a mathematician) Spent adult life in relative obscurity doing basic genetics research and teaching high school mathematics, physics, and Greek in Brno, Czech Republic Published his ideas in 1866; work largely went unrecognized until 1900, which was long after his death.

Why study Mendel

He was the first to demonstrate the principles of inheritance He used a systematic scheme based upon an understanding of mathematics and statistics before formal statistics was developed He applied his knowledge of mathematics with an excellent scientific method

2. Today: The gene theory

An alternative idea to blending is the gene idea. Parents pass on discrete individual heritable units called genes Genes are segments of DNA in a chromosome A gene has different forms/variations called alleles

What is a gene?
A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule (usually a protein)
DNA
GAATTCTAATCTCCCTCTC AACCCTACAGTCACCCATTT GGTATATTAAAGATGTGTTG TCTACTGTCTAGTATCC

Computer program

function sf(){document. f.q.focus()}

mRNA

Working copy

Protein

Specific function

Homologous chromosomes bear the two alleles for each characteristic

Alternative forms of a gene reside at the same locus on homologous chromosomes

DNA (deoxyribonucleic acid)

Protein

mRNA

Karyotyping is matching the paired chromosomes

Down syndrome karyotype (trisomy 21)

Mendels experiments

Mendels data

Mendel deduced the underlying principles of genetics from these patterns

1. Segregation 2. Dominance 3. Independent assortment

1. Mendels Law of Segregation

A normal (somatic) cell has two variants (alleles) for a Mendelian trait. A gamete (sperm, egg, pollen, ovule) contains one allele, randomly chosen from the two somatic alleles. E.g. if you have one allele for Sperm B b brown eyes (B) and one for blue eyes (b), somatic cells B BB Bb have Bb and each gamete Eggs will carry one of B or b chosen randomly. b Bb bb

Two types of cell division

Mitosis
All body cells 2 daughter cells Equal # of chromosome/s

Meiosis
Sex cells: egg/sperm 4 d-cells Half of the number

1. Mitosis: by all body cells

Cell cycle: G Growth S - Synthesis M - Mitosis

Homologoue = pair of the same type of chromatids Diploid = paired state Haploid = unpaired

2. Meiosis: in gametes (sperm or egg) only

Gametes are either egg or sperm Chiasma point of crossing over (recombination)

Meiosis in a Nutshell
Meiosis is a special type of cell division that occurs in sexually reproducing organisms. It reduces the chromosome number by half, enabling sexual recombination to occur.

It ensures that an organism has the same number of chromosomes in each generation.

Terminology
Haploid: containing one copy of each chromosome (n=23)

Sperm

B
Eggs

Diploid: containing two copies of each chromosome (2n=46)

B BB Bb b Bb bb

Punnett Square of a Monohybrid Cross

Terminology Genotype: the states of the two alleles at one or more locus associated with a trait Phenotype: the state of the observable trait Genotype
BB (homozygous) Bb (heterozygous) bb (homozygous)

Phenotype
Brown eyes Brown eyes Blue eyes

2. Mendels Law of Dominance

If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant Sperm B b b is recessive
B
Eggs

BB Bb

Bb bb

2. Law of Dominance...
If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive.
Sperm

B B
Eggs

b Bb bb

BB Bb

3. Mendels Law of Independent Assortment

Knowledge of which allele has been inherited at one locus gives no information on the allele that has been inherited at the other locus

S/s

Y/y

SY
25%

Sy
25%

sY
25%

sy
25%

3. Law of Independent Assortment.

Gametophytes (gameteproducing cells) S s Y y Recombination Red father Blue - mother

Segregation
S Y y y Recombinants s Y

Gametes

s S

Human eye colour

Simplified view of eye colour inheritance: biallelic Mendelian trait
- Brown dominant: BB, Bb
Sperm

B
BB Bb

b
Bb bb

Blue recessive:

bb

B
Eggs

Human eye colour

BB, Bb (Brown, dominant) Bb (blue, recessive)

B?

B?

B?

bb

bb

B? B?

What are the possible eye color/s of this child?

Non-Mendelian Inheritance: Incomplete Dominance

Some alleles for a gene are not completely dominant over the others. This results in partially masked phenotypes which are intermediate to the two extremes.

Non-Mendelian : Sex Linkage

All chromosomes are homologous except on sex chromosomes. Sex chromosomes are either X or Y. If an organism is XX, it is a female, if XY it is male. If a recessive allele exists on the X chromosome. It will not have a corresponding allele on the Y chromosome, and will therefore always be expressed

The 23rd pair of chromosome during fertilization

Possible combinations Sex: F F M M 1 female: 1 male

Human Sex Linkage

Hemophilia (X-linked):
Disorder of the blood where clotting does not occur properly due to a faulty protein. Occurs on the X chromosome, and is recessive.
Thus a vast majority of those affected are males.

First known person known to carry the disorder was Queen Victoria of England. Thus all those affected are related to European royalty.

Patterns of disease inheritance known for 1000s of years, e.g. haemophilia

Colour blindness is usually passed down from mother to son on the 23rd chromosome (X-linked)

Y-linked inheritance

baldness

hairy ear lobes

Non-Mendelian: Multiple Alleles

Phenotypes are controlled by more than 1 allele. Eg. Blood types are regulated by 3 separate genes.

ABO Blood typing

Humans have multiple types of surface antigens on RBC's The nature of these surface proteins determines a person's Blood Type. There are 3 alleles which determine blood type IA, IB, or IO. This is referred to as having multiple alleles Human blood types are designated as A, B or O.
Type A denotes having the A surface antigen, and is denoted by IA Type B denotes having the B surface antigen, and is denoted by IB Type O denotes having neither A or B surface antigen, and is denoted by IO

There are several blood type combinations possible

A , B, AB (Universal recipient) , O (Universal donor)

Non-Mendellian: Continuous Variation

Many traits may have a wide range of continuous values. Eg. Human height can vary considerably. There are not just "tall" or "short" humans

Non-Mendelian: mtDNA

Mitochondrial DNA point mutations are maternally inherited and can occur in rRNA or tRNA genes, or in genes coding for proteins of respiratory chain complexes.

Phenotypes associated with mtDNA mutations

Longevity Stroke Seizures Reduced sperm motility Common migraine Bipolar disorder Exercise intolerance, fatigability

Non-Mendellian:
Gene interaction:
Many biological pathways are governed by multiple enzymes, involving multiple steps. If any one of these steps are altered. The end product of the pathway may be disrupted.

Environmental effects:
Sometimes genes will not be fully expressed owing to external factors. Example: Human height may not be fully expressed if individuals experience poor nutrition.

Summary
Mendel deduced three simple laws of inheritance:
Segregation Dominance Random assortment

The majority of traits dont follow these rules but Mendels laws are nevertheless crucial to understanding almost all genetic inheritance

Levels of biological diversity:

Species diversity Ecosystem diversity Genetic diversity Molecular diversity

Watch
http://highered.mcgrawhill.com/sites/0072495855/student_view0/ch apter2/animation__mitosis_and_cytokinesis.h tml

Web sites to check

http://gslc.genetics.utah.edu/units/basics/t our/inheritance.swf
http://science.nhmccd.edu/biol/genetics.html

http://library.thinkquest.org/20465/games. html