Sei sulla pagina 1di 15

Ejemplos de uso de la Bioinformtica

1. Clasificacin de un hongo, comparando una secuencia suya con las de una base de datos para determinar si las hay similares 2. Visualizacin de estructuras moleculares en tres dimensiones 3. Introduccin al anlisis de secuencias

ula ientfica

01/04/2012

Introduccin a la Bioinformtica

Ejemplo 1: Identificacin de un hongo


Unos investigadores han detectado una infeccin fngica en un cultivo agrario. En caso de duda en la identificacin directa (crecimiento lento del hongo, caractersticas morfolgicas similares entre varias especies, etc.) se puede plantear la alternativa siguiente:
Secuenciar un fragmento del ADN del hongo Buscar en bases de datos moleculares intentando encontrar la misma secuencia o una lo ms similar posible (DB homology search)
01/04/2012 Introduccin a la Bioinformtica 2

ula ientfica

Ej. 1.1 Secuencia caracterstica


Obtenemos la secuencia siguiente gtttacgctctacaaccctttgtgaacatacc tacaactgttgcttcggcgggtagggtctccg cgaccctcccggcctcccgcctccgggcgggt cggcgcccgccggaggataaccaaactctgat ttaacgacgtttcttctgagtggtacaagcaa ataatcaaaacttttaacaaccggatctcttg gttctggcatcgatgaagaacgcagcgaaatg cgataagtaatgtgaat

ula ientfica

01/04/2012

Introduccin a la Bioinformtica

Ej. 1.2 Bsqueda de la secuencia en una base de datos


1. Va internet accedemos al EBI: European Bioinformatics Institute 2. Aqu escogemos la opcin Tools y
1. Seleccionamos Fasta3 2. Seleccionamos en DATABASES :
Nucleic ACIDS , FUNGI

3. Enganchamos la secuencia y hacemos la consulta

ula ientfica

3. Obtendremos un listado de especies ordenado de mayor a menor similitud


01/04/2012 Introduccin a la Bioinformtica 4

i) Vamos a la Web del EBI

ula ientfica
01/04/2012 Introduccin a la Bioinformtica 5

ii) Escogemos la opcin Tools

ula ientfica
01/04/2012 Introduccin a la Bioinformtica 6

iii) En Tools seleccionamos FASTA3

ula ientfica
01/04/2012 Introduccin a la Bioinformtica 7

iv) la opcin DATABASES NUCLEIC ACIDS, FUNGI

ula ientfica
01/04/2012 Introduccin a la Bioinformtica 8

v) Enganchamos la secuencia en el cuadro inferior y ejecutar (Run FASTA 3)

ula ientfica
01/04/2012 Introduccin a la Bioinformtica 9

v) Resultados de la bsqueda
FASTA searches a protein or DNA sequence data bank version 3.3t09 May 18, 2001 Please cite: W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448 @:1-: 241 nt vs EMBL Fungi library searching /ebi/services/idata/v225/fastadb/em_fun library

104701680 residues in 66478 sequences statistics extrapolated from 60000 to 61164 sequences Expectation_n fit: rho(ln(x))= -1.2290+/-0.000361; mu= 72.1313+/- 0.026 mean_var=907.6270+/-295.007, 0's: 68 Z-trim: 4246 B-trim: 15652 in 3/79 Lambda= 0.0426

FASTA (3.39 May 2001) function [optimized, +5/-4 matrix (5:-4)] ktup: 6 join: 48, opt: 33, gap-pen: -16/ -4, width: 16 Scan time: 3.180 The best scores are: opt bits E(61164) EM_FUN:CGL301988 AJ301988.1 Colletotrichum glo (1484) [f] 1184 88 5.7e-17 EM_FUN:AF090855 AF090855.1 Colletotrichum gloe ( 500) [f] 1205 88 7.3e-17 EM_FUN:CGL301986 AJ301986.1 Colletotrichum glo (1484) [f] 1166 87 1.2e-16 EM_FUN:CGL301908 AJ301908.1 Colletotrichum glo (2868) [f] 1148 87 1.3e-16 EM_FUN:CGL301909 AJ301909.1 Colletotrichum glo (2868) [f] 1148 87 1.3e-16 EM_FUN:CGL301907 AJ301907.1 Colletotrichum glo (2867) [f] 1148 87 1.3e-16 EM_FUN:CGL301919 AJ301919.1 Colletotrichum glo (1171) [f] 1166 87 1.6e-16 EM_FUN:CGL301977 AJ301977.1 Colletotrichum glo (1876) [f] 1148 86 2e-16 EM_FUN:CFR301912 AJ301912.1 Colletotrichum fra (2870) [f] 1137 86 2.1e-16

ula ientfica

01/04/2012

Introduccin a la Bioinformtica

10

Ejemplo 2: Visualizacin de estructuras moleculares


RASMOL es un programa para visualizar estructuras moleculares en tres dimensiones Haciendo click aqu podis acceder a una gua rpida del programa desde donde podris descargarlo, instalarlo y ejecutarlo con facilidad

ula ientfica

01/04/2012

Introduccin a la Bioinformtica

11

Ejemplo 3: Introduccin prctica al anlisis de secuencias


Haciendo click aqu se accede al Bioinformatics Web Practical del servicio de Bioinformtica de la Universidad de Manchester (UMBER) El objetivo de este tutorial es
Dar un vistazo a algunos recursos bioinformticos existentes en Internet Adquirir una primera idea sobre que es el anlisis de secuencias

ula ientfica

A continuacin podis ver algunas de las pantallas que aparecern


01/04/2012 Introduccin a la Bioinformtica 12

Enganchamos una secuencia al traductor

ula ientfica
01/04/2012 Introduccin a la Bioinformtica 13

Traduccin de la secuencia y bsqueda en OWL

ula ientfica
01/04/2012 Introduccin a la Bioinformtica 14

La secuencia ha sido identificada

ula ientfica
01/04/2012 Introduccin a la Bioinformtica 15