Contribution of Taxane Biosynthetic Pathway Gene Expression To Observed Variability in Paclitaxel Accumulation in Taxus Suspension Cultures

Contribution of taxane biosynthetic pathway gene expression to observe...
http://onlinelibrary.wiley.com/doi/10.1002/biot.201100183/full
maintenance Show messages
Research Article You have full text access to this content
Contribution of taxane biosynthetic pathway gene expression to observed variability in paclitaxel accumulation in Taxus suspension cultures
1. 2. 3. 4. 5. Rohan A. Patil1, Martin E. Kolewe1, Jennifer Normanly2, Elsbeth L. Walker3, Dr. Susan C. Roberts1,*
Article first published online: 10 JAN 2012 DOI: 10.1002/biot.201100183 Copyright 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim Issue
Biotechnology Journal
Special Issue: Frontiers in Biochemical Engineering Volume 7, Issue 3, (/doi/10.1002/biot.v7.3/issuetoc) pages 418427, March 2012 Additional Information How to Cite Patil, R. A., Kolewe, M. E., Normanly, J., Walker, E. L. and Roberts, S. C. (2012), Contribution of taxane biosynthetic pathway gene expression to observed variability in paclitaxel accumulation in Taxus suspension cultures. Biotechnology Journal, 7: 418427. doi: 10.1002/biot.201100183
1 de 21
20/03/2012 16:37
maintenance Author Information Show messages 1 Department of Chemical Engineering, University of Massachusetts, Amherst, MA, USA
2
Department of Biochemistry and Molecular Biology, University of Massachusetts, Amherst, MA, USA
3
Department of Biology, University of Massachusetts, Amherst, MA, USA
Email: Dr. Susan C. Roberts (sroberts@ecs.umass.edu)

*
Department of Chemical Engineering, University of Massachusetts, 686 North Pleasant Street, Amherst, MA 01003, USA Publication History 1. 2. 3. 4. 5. 6. Issue published online: 2 MAR 2012 Article first published online: 10 JAN 2012 Accepted manuscript online: 18 NOV 2011 02:40AM EST Manuscript Accepted: 14 NOV 2011 Manuscript Revised: 25 OCT 2011 Manuscript Received: 15 AUG 2011
Funded by NIH. Grant Number: (GM070852) NSF. Grant Number: (CBET-0730779) National Research Service Award T32 GM08515 from the NIH NSF-sponsored Institute for Cellular Engineering IGERT Program . Grant Number: (DGE-0654128) Abstract (/doi/10.1002/biot.201100183/abstract) Article References (/doi/10.1002/biot.201100183/references) Cited By (/doi/10.1002/biot.201100183/citedby) Get PDF (355K) (/doi/10.1002/biot.201100183/pdf)
Keywords:
Gene expression; Paclitaxel; Plant biotechnology; Production variability; Taxus
Abstract
1. 2. 3. 4. 5. 6.
2 de 21
Top of page Abstract 1 Introduction 2 Materials and methods 3 Results and discussion 4 Concluding remarks
20/03/2012 16:37
7. Acknowledgements Show messages 8. REFERENCES

Variability in product accumulation is one of the major obstacles limiting the widespread commercialization of plant cell culture technology to supply natural product pharmaceuticals. Despite extensive process engineering efforts, which have led to increased yields, plant cells exhibit variability in productivity that is poorly understood. Elicitation of Taxus cultures with methyl jasmonate (MeJA) induces paclitaxel accumulation, but to varying extents in different cultures. In the current study, cultures with different aggregation profiles were established to create predictable differences in paclitaxel accumulation upon MeJA elicitation. Expression of known paclitaxel biosynthetic genes in MeJA-elicited cultures exhibiting both substantial (15-fold) and moderate (2-fold) differences in paclitaxel accumulation was analyzed using quantitative reverse transcriptase PCR. Each population exhibited the characteristic large increase in paclitaxel pathway gene expression following MeJA elicitation; however, differences in expression between populations were minor, and only observed for the cultures with the 15-fold variation in paclitaxel content. These data suggest that although upregulation of biosynthetic pathway gene expression contributes to observed increases in paclitaxel synthesis upon elicitation with MeJA, there are additional factors that need to be uncovered before paclitaxel productivity can be fully optimized. cDNA, complementary DNA; DW, dry weight; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; MeJA, methyl jasmonate; qRT-PCR, quantitative reverse transcriptase PCR; REST, relative expression software tool; UPLC, ultra-performance liquid chromatography
maintenance
1 Introduction
1. 2. 3. 4. 5. 6. 7. 8. Top of page Abstract 1 Introduction 2 Materials and methods 3 Results and discussion 4 Concluding remarks Acknowledgements REFERENCES
Natural products represent many of the most effective drugs currently available for the treatment of a variety of diseases, and are particularly useful as anti-cancer and anti-infectious agents [1]. Paclitaxel (Taxol), a taxane diterpenoid produced by Taxus genus is a potent chemotherapeutic widely used in the treatment of breast, ovarian, and non-small cell lung cancers as well as AIDS-related Kaposi's sarcoma [2]. Paclitaxel is also being investigated for use in the treatment of neurological disorders, additional cancers, and in post-surgery heart patients [3]. Large scale commercial synthesis of plant natural products via cell culture has proven to be challenging due to low yields and instability in productivities [4, 5]. Despite these limitations, plant cell culture has emerged as a sustainable source for paclitaxel supply,
3 de 21
20/03/2012 16:37
maintenance being commercially produced by Phyton Biotech Inc. and Samyang Genex Corp. using large scale fermentation. Show messagesThe successes of large scale industrial plant cell culture in the US and world-wide with paclitaxel [69] and several other plant-derived compounds such as ginseng [10], shikonin [11], and berberine [12], have clearly demonstrated both the feasibility of this technology, and broad applicability across a range of plant species and products. The primary difficulties associated with establishment of plant cell culture bioprocesses are the low and variable yields in secondary metabolite accumulation [13]. To overcome low yields, a variety of traditional optimization strategies have been effective, including elicitation with MeJA [8, 14, 15]. By combining media and process optimization strategies with MeJA elicitation, paclitaxel accumulation of 110120 mg/L have been reported in academic laboratories [8, 16] and up to 295 mg/L [17] and 900 mg/L [18] have been achieved in industrial environments. Along with high product yields, development of cell lines and processes with a high degree of biochemical and physiological stability is critical for the ultimate success of this technology platform [5, 19]. Variability in product accumulation has been observed in suspension cultures that are maintained over long periods of time [20, 21], including paclitaxel accumulation in Taxus cultures [22, 23]. Though production instabilities have been attributed to epigenetic and/or genetic causes [24, 25], few molecular studies have been performed [26, 27] to gain a mechanistic understanding of paclitaxel accumulation variability in Taxus cell cultures, and hence no rational engineering strategies have emerged to control or leverage favorable variability to optimize performance. Understanding regulation of gene expression is critical to the design of targeted metabolic engineering approaches. To probe regulation of paclitaxel accumulation, expression patterns of known paclitaxel biosynthetic pathway genes can be quantified. Paclitaxel biosynthesis consists of 19 putative enzymatic steps [28] and has only been partially elucidated (see [27] for paclitaxel biosynthetic pathway). Regulation of paclitaxel/taxane biosynthetic pathway genes has been examined through RNA gel blot analysis and semi-qRT-PCR in MeJA-elicited Taxus cuspidata suspension cultures [27]. Similar studies using qRT-PCR have been reported for T. chinensis suspension cultures where the elicitation strategy focused on increasing Taxuyunnanine C, a 14-hydroxy taxoid, generated through an early branch of the paclitaxel biosynthetic pathway [29]. For the majority of known pathway steps, mRNA abundance increased following elicitation, indicating substantial regulation of the pathway at the level of mRNA. However, these studies focused on comparison of cultures with and without elicitation. Variability in paclitaxel accumulation is often observed amongst cultures elicited with MeJA [23]. Therefore, to link variability fully to gene expression, comparison of multiple culture states with different biosynthetic capabilities is necessary. Plant cells in suspension culture remain connected to each other after cell division, resulting in the formation of cellular aggregates of various sizes. In Taxus suspension cultures, aggregates ranging from less than 100 m to well over 2 mm have been observed [30]. Cells within these aggregates are subject to different microenvironments, leading to cell-cell differences in morphology [31] and metabolism [32]. Recently, we have developed an approach to assess the effect of aggregate size as a process variable on paclitaxel accumulation, and have demonstrated that cultures with smaller aggregates accumulate significantly more paclitaxel upon elicitation with MeJA than cultures with larger aggregates [33]. Using this approach, it is possible to predictably and rapidly obtain cultures with different biosynthetic
4 de 21
20/03/2012 16:37
maintenance capabilities upon MeJA elicitation. Show messages In this paper, we use this approach to quantify expression of paclitaxel biosynthetic pathway genes in cultures with varying levels of paclitaxel accumulation, to clarify the underlying causes of production variability that have been observed at the process scale. Using qRT-PCR, we first compared expression profiles in cultures elicited with MeJA that produce detectable levels of paclitaxel and unelicited cultures that do not produce detectable levels of paclitaxel, to elucidate the on/off state of paclitaxel accumulation. Next, we established cultures with small and large aggregate distributions [33] that exhibit variable paclitaxel accumulation patterns upon elicitation with MeJA, to enable comparison of gene expression between cultures in which taxane accumulation is positive but significantly different. Using this method we were able to examine cultures that had 15- and 2-fold differences in paclitaxel accumulation after MeJA elicitation, respectively. This is the first study to compare gene expression in cultures with variable levels of paclitaxel accumulation, providing valuable information regarding the regulation of paclitaxel synthesis.
2 Materials and methods

2.1 Cell culture maintenance, elicitation, and biomass measurements

The T. cuspidata P93AF cell line was provided by the United States Plant Soil and Nutrition Laboratory (Ithaca, NY, USA) and was used in all experiments. All chemicals were obtained from Sigma-Aldrich Co. (St. Louis, MO, USA), unless otherwise noted. Cell cultures were maintained, as described previously [33]. For elicitation, 200 M MeJA was added on day 7 post-transfer during the mid-exponential phase of growth, as described previously [34]. A Multisizer 3 Coulter counter equipped with a 2000 m aperture (Beckman Coulter, Brea, CA, USA) was used to measure culture aggregate size distributions, as described previously [30]. As the total aggregate volume was previously shown to correlate directly with biomass [30], this measurement was also used to determine dry weight (DW), and all DW data presented here were based on this correlation. For analysis, 2 2 mL samples of well-mixed culture broth from each flask were taken at each time point.
5 de 21
20/03/2012 16:37
Show messages
2.2 Initiation of cultures with different aggregate size distributions and sampling for growth, RNA, and metabolite analyses
Three 14-day old suspension flasks were combined into one culture and its aggregate size distribution and mean aggregate size were determined using the Multisizer 3 Coulter counter. This culture was aseptically separated into two cultures (one small aggregate culture and one large aggregate culture) using a filter corresponding to its mean aggregate size, based on correlations developed in previous work [30]. Three biological replicates each of small aggregate culture and large aggregate culture were initiated and maintained as 200 mL cultures in 500 mL shake flasks, as described previously [33]. Measurements for biomass were taken on the day of inoculation (day zero) and on the day of elicitation with MeJA (day seven). Prior to MeJA elicitation and 15 h post-elicitation, samples for total RNA extraction were collected. Cell suspensions (34 mL of well mixed cultures) were filtered through Miracloth (Calbiochem, La Jolla, CA, USA) to yield 500 mg fresh cell weight, thoroughly ground in liquid nitrogen and stored at 80C in polypropylene tubes prior to RNA analysis (see below: section 2.4.1). Following MeJA elicitation, 1 mL samples of well mixed culture broth containing both cells and media were taken every 23 days with a cut pipette tip and stored at 80C prior to metabolite analysis (see section 2.3).
maintenance
2.3 Metabolite analysis

Taxanes were identified and quantified using a Waters (Milford, MA, USA) Alliance 2690 HPLC with a 996 photodiode detector [34] or a Waters Acquity ultra-performance liquid chromatography (UPLC) H-Class system. Separation on the HPLC was accomplished on a Taxsil (Varian, Inc., Torrance, CA, USA) column (particle size 5 m, 250 mm 4.6 mm). The UPLC separation was performed using Acquity (Waters, Milford, MA, USA) BEH C 18 column (particle size 1.7 m, 50 mm 2.1 mm). Samples were prepared for taxane analysis, as described elsewhere [34], and analyzed on either the HPLC or UPLC system. Baccatin III and paclitaxel authentic standards were used to generate standard curves for quantification of taxane content.
2.4 Gene expression analysis

2.4.1 RNA isolation and reverse transcription Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA) following the manufacturer's instructions. Genomic DNA was eliminated by treating each sample with Ambion's Turbo DNA-free DNase I (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions. The concentration of total RNA was estimated using a Nanodrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). RNA quality was further assessed by denaturing gel electrophoresis. One microgram of total RNA was subjected to reverse transcription using the Affinity Script complementary DNA (cDNA) synthesis kit (Agilent Technologies, Santa Clara, CA, USA) with oligo dTs as primers. Reactions were performed according to the manufacturer's protocol in a total volume
6 de 21
20/03/2012 16:37
maintenance of 40 L. For use as templates for qRT-PCR, cDNA samples were diluted five-fold in sterile water. Show messages 2.4.2 Primer design Primer pairs for qRT-PCR amplification were designed based on selected sequences using Primer3 software (http://frodo.wi.mit.edu/primer3/) with the following criteria: melting temperature of 63 3C, primer sequences of length between 20 and 25 bp, and GC content of 4060%. Amplicon lengths were optimized to 100250 bp to ensure maximal polymerization efficiency for qRT-PCR. Specificity of the primer pairs was evaluated by melting-curve analysis (Mx3000P real-time PCR instrument software, version 2.0) after 40 amplification cycles. Table 1 lists the primers used in this study.
Table 1. Sequences for forward and reverse primers of the paclitaxel biosynthetic pathway genes used in qRT-PCR. Genbank accession U48796 Primer pair (5-forward3/5-reverse-3) TGCAGCGCTGAAGATGAACG AGTGCCAGTGCTGCTGCTCA T5H AY289209 GCAACAGCCACGCAGGATCT TTGGCGAAGTGGTGGTGTCA DBBT JF735996 CATGGCGGACAACGACCTTT CCCACAACAAATCCCCCACA DBAT AF193765 CCTGCAGCTCTCCACCCTTG CGCCCTGCAAAAGGGGAATA PAM AY582743 GAGGTCATGGAAGCGCTGGA CAATGTAGGCGAGCGGGATG BAPT AY082804 GCCTTCGCCCAAAACAATCC ACACCCTGCCCTGTGCACTC DBTNBT AF466397 GGAGTGCACAGGGGATGGTG GGCAATGCCCCCACATGTAA GAPDH L26922 TTCCCTGGGGTGAGGTTGGT GCCAAAGGAGCCAGGCAGTT Actin JF735995 GCGTGAAATTGTCCGCGATG 148 229 190 228 109 162 159 136 Product size (bp) 181
Gene TASY
7 de 21
20/03/2012 16:37
maintenance
Genbank Show messages accession Gene
Primer pair (5-forward3/5-reverse-3) CCGTTCTGCACCAATCGTGA
Product size (bp)
2.4.3 Quantitative real time RT-PCR (qRT-PCR) qRT-PCR reactions were performed in a 96-well plate with a Mx3000P real-time PCR system (Stratagene, La Jolla, CA, USA), using SYBR Green to monitor dsDNA synthesis. A 25-L PCR reaction was prepared containing 12.5 L of Brilliant 2 SYBR green master mix (Agilent Technologies, Santa Clara, CA, USA), 2 L of template cDNA (or water for no template control), 100 nM of each primer, and 50 nM of diluted ROX dye (to compensate for non-PCR related variations in fluorescence, Agilent Technologies). The SYBR Green fluorescence data were collected with the following thermocycler conditions: initial denaturation at 95C for 10 min followed by 40 cycles at 95C for 30 s, 60C for 1 min, and 72C for 1 min. Melting-curve analysis was performed at the end of the amplification procedure to check the specificity of the PCR reaction. Mean PCR efficiency for each gene was calculated by LinRegPCR [35] by using 46 points and the best correlation coefficient. The reported fold induction is the geometric mean of the relative fold induction values for target genes normalized to each of the endogenous controls, actin (GenBank accession NO: JF735995) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (GenBank accession NO: L26922). The use of actin and GAPDH as internal reference genes was validated by ensuring that the relative expression of each gene remained constant in both small aggregate cultures and large aggregate cultures before and after elicitation with MeJA. The expression ratio results were tested for significance by a randomization test using the relative expression software tool (REST) [36]. The statistical model used by this software is a pair-wise fixed reallocation randomization test. The software returns the probability of the alternative hypothesis (P(H1)), which is that the difference between sample and control groups is due only to chance. A p-value of less than 0.05 was considered significant.
3 Results and discussion

3.1 Analysis of paclitaxel/taxane biosynthetic pathway gene

8 de 21 20/03/2012 16:37
Show messages
expression in unelicited and MeJA-elicited cultures

Cultures accumulated paclitaxel/taxanes only upon elicitation with MeJA (Fig. 1A, B), and therefore this experiment was designed to investigate gene expression in the on/off state of paclitaxel/taxane accumulation. Expression of seven known taxane biosynthetic pathway genes was quantified and compared between MeJA-elicited and unelicited cultures (Fig. 1C). Most genes were significantly upregulated in MeJA-elicited cultures relative to unelicited cultures (1.5160-fold). These data concur with previous reports on different Taxus cell lines that show increased steady state mRNA levels of biosynthetic pathway genes upon MeJA-elicitation using Northern gel blot analysis [26, 27, 37, 38], RT-PCR [27], and qRT-PCR [29, 39]. In this study, the fold change in T5H expression upon elicitation with MeJA was lower than that quantified for most other pathway genes, which agrees with previous
maintenance
results [27, 40]. In a time course study using Northern gel blot analysis, T5H expression was shown to be higher at 6 h relative to 18 h, after which transcripts were not detected [27]. Figure 1C shows results at 15 h post-elicitation, and therefore T5H transcript abundance was significantly lower by this time point, resulting in a lower observed expression ratio. In addition, BAPT expression was relatively weakly induced with MeJA elicitation as compared to the other pathway genes, agreeing with previous data [27]. Thus, these data again support the hypothesis that BAPT may be a critical rate influencing step in the paclitaxel biosynthetic pathway and a primary target for metabolic engineering. Once the qRT-PCR technique was successfully established and induction of gene expression was confirmed with MeJA elicitation, we examined cultures that produced paclitaxel at different levels, enabling a more detailed understanding of metabolic differences amongst Taxus cultures with varying bulk paclitaxel/taxane production capabilities.
Figure 1. Effect of MeJA elicitation on taxane accumulation and expression of taxane biosynthetic pathway genes. (A) Baccatin III accumulation in MeJA-elicited and unelicited cultures. (B) Paclitaxel accumulation in MeJA-elicited and unelicited cultures. (C) Relative gene expression ratio of seven known paclitaxel biosynthetic pathway genes determined with qRT-PCR, calculated using REST 2009 software. Expression ratio represents the median fold change in MeJA-elicited samples relative to unelicited samples at 15 h post-elicitation, normalized by actin, and GAPDH reference gene expressions. The box represents the middle 50% of observations. The dotted line within the box represents the median expression ratio. Whiskers represent the minimum and maximum observations. *p < 0.05, as determined by randomization tests using REST software. Reported values are the average of three biological replicates.
9 de 21
20/03/2012 16:37
Show messages
3.2 Analysis of
maintenance
paclitaxel/taxane accumulation
Download figure to PowerPoint (/doi/10.1002 cultures that exhibit high variability in /biot.201100183/figure.pptx?figureAssetHref=image_n /nfig001.jpg)
A comparison of gene expression in cultures that exhibit variations in paclitaxel/taxane accumulation after MeJA elicitation (i.e., higher-accumulating cultures vs. lower-accumulating cultures) has not previously been reported, but since variability in product synthesis is common amongst cultures, such a comparison is therefore of great practical interest. To obtain such differences in paclitaxel/taxane accumulation, we initiated cultures with different aggregate size profiles but the same initial biomass, and analyzed paclitaxel/taxane accumulation as well as pathway gene expression. Size distributions taken from small aggregate cultures and large aggregate cultures following inoculation on day 0 and prior to elicitation on day 7 indicated that once established, cultures maintained disparate aggregate size profiles (Fig. 2A, B). Growth is typically retarded upon elicitation with MeJA [8, 23] and small and large aggregate cultures maintain similar growth patterns post-elicitation [33]. Throughout the production period of the cell culture batch, small aggregate cultures accumulated higher levels of both baccatin III and paclitaxel in comparison to large aggregate cultures (Fig. 2C, D). The total baccatin III and paclitaxel levels were up to 120- and 15-fold higher, respectively, in small aggregate cultures as compared to large aggregate cultures, indicating substantial difference in metabolite accumulation.
Figure 2. Profiles of aggregate size distributions, taxane accumulation and gene expression patterns in cultures exhibiting a large difference in paclitaxel accumulation. (A, B) Aggregate size distribution at culture initiation and prior to elicitation, respectively. (C, D) Baccatin III and paclitaxel accumulation over a three-week period, respectively. (E, F) Relative gene expression ratio of seven known paclitaxel biosynthetic pathway genes determined with qRT-PCR, calculated using REST 2009 software. Expression ratio represents the median fold change in small aggregate cultures relative to large aggregate cultures at 15 h post-elicitation (E) and just prior to elicitation (F), normalized to actin and GAPDH reference gene expressions. The box represents the middle 50% of observations. The dotted line within the box represents the median expression ratio. Whiskers represent the minimum and maximum observations. *p < 0.05, as determined by randomization tests using REST software. Reported values are the average of three biological replicates. Download figure to PowerPoint (/doi/10.1002 /biot.201100183/figure.pptx?figureAssetHref=image_n /nfig002.jpg)
10 de 21
20/03/2012 16:37
maintenance Five of the seven genes investigated were upregulated in MeJA-elicited small aggregate cultures as compared to MeJA-elicited large aggregate cultures (p<0.05), but the level of upregulation varied amongst Show messages the genes (Fig. 2E). The relative transcript levels of early and middle pathway genes (T5H, DBBT and DBAT) showed a minor (1.4-, 2-, and 1.8-fold, respectively) increase in small aggregate cultures relative to large aggregate cultures. A more substantial increase for the later pathway genes, PAM and DBTNBT (12- and 7-fold, respectively), was observed in small aggregate cultures. The relative expression levels of TASY and BAPT were not significantly different between the cultures. One possibility for suppressed secondary metabolism in large aggregate cultures is that MeJA elicitation is not uniform in larger aggregates, where transport limitations exist, and therefore MeJA may not effectively penetrate into the interior of all aggregates [41]. These effects may be amplified since MeJA is produced endogenously by cells in response to external stimuli [14], as jasmonic acid biosynthesis is regulated by a positive feedback loop [42, 43]. Overall, these data demonstrate some differences in pathway gene expression between cultures that accumulate substantially different paclitaxel levels (in this case 15-fold), but suggest there are additional factors that regulate paclitaxel accumulation. Interestingly, when the relative expression levels of the same pathway genes were compared in unelicited small and large aggregate cultures, higher mRNA levels for most pathway genes (six of the seven evaluated; p<0.05) were observed in the small aggregate cultures (Fig. 2F). Upregulation of greater than two-fold was observed for four genes, DBBT, PAM, BAPT, and DBTNBT, suggesting a difference in initial metabolic state prior to MeJA elicitation. However, no differences were observed in paclitaxel accumulation in unelicited cultures, as the levels of paclitaxel produced were below the limit of quantification of UPLC. These data indicate there are bottlenecks to product accumulation in unelicited cultures that are overcome through elicitation.
3.3 Analysis of cultures with smaller differences in paclitaxel/taxane accumulation but higher levels of production
A second experiment was conducted with the same T. cuspidata cell line, in which the aggregate sizes for both small aggregate cultures and large aggregate cultures were slightly larger (Fig. 3A, B). As in the previous experiment, a similar metabolite trend was observed, with small aggregate cultures accumulating higher levels of baccatin III and paclitaxel (Fig. 3C, D). However, there were two important differences: (i) the relative change in metabolite accumulation between small and large aggregate cultures maximally was only 4.6-fold for baccatin III and 1.7-fold for paclitaxel, compared to 120-fold for baccatin III and 15-fold for paclitaxel in the previous experiment; and (2) the large aggregate cultures in this experiment accumulated a relatively high level of paclitaxel (1.6 mg/g DW), which was 13-fold higher than large aggregate cultures and on the same order as small aggregate cultures from the previous experiment. Aggregate size is not the only factor influencing variability in paclitaxel accumulation amongst cultures, and it is not uncommon to observe varying differentials in paclitaxel accumulation [33]. Additional genetic and epigenetic factors not explicitly measured or controlled for likely contribute to the variability observed amongst Taxus cultures between experiments.
Figure 3. Profiles of aggregate size distributions, taxane accumulation, and gene expression patterns in cultures
11 de 21
20/03/2012 16:37
maintenance In this case, qRT-PCR analysis revealed no differences levels of paclitaxel with ofrelatively genes between accumulating high in the expression levels a pathway small and large small difference in paclitaxel accumulation. (A, B) Show messages aggregate cultures after elicitation with MeJA (Fig. 3E). Both small and large aggregate cultures accumulated high levels of paclitaxel, indicating that pathway genes were upregulated by MeJA, Aggregate size distribution at culture initiation and prior to but the differences in baccatin III and paclitaxel accumulation between small III and paclitaxel cultures elicitation, respectively. (C, D) Baccatin and large aggregate could not be attributed to additional accumulation over aabundance of pathway genes. (E) increases in mRNA three-week period, respectively. Relative gene expression ratio of seven known paclitaxel While this work collectively shows that some degree of variability in secondary metabolism can be linked biosynthetic pathway genes determined with qRT-PCR, to changes in biosynthetic pathway gene expression, there are clearly contributions from other factors. calculated using REST 2009 software. Expression ratio Metabolite levels are not only determined by pathway gene expression levels, but also by represents the median fold change in small aggregate post-transcriptional and/or post-translational regulation of enzyme activity [44]. For example, cultures relative to large aggregate cultures at 15 h discrepancies in post-transcriptional and/or post-translational regulation were hypothesized for the lack of post-elicitation, normalized using actin, and GAPDH resveratrol production in Vitis vinifera cell cultures even after high induction of one of the key pathway reference gene expressions. The box represents the middle genes [45]. Primary metabolism is known to provide critical substrates for secondary metabolic pathways 50% of observations. The dotted line within the box and hence, precursor pool availability can also affect product accumulation. For example, phenylalanine represents the median expression ratio. Whiskers represent addition to T. cuspidata cultures resulted in an increase in paclitaxel accumulation [46]. In addition to the minimum and maximum observations. Results are paclitaxel biosynthesis, post-biosynthetic events such as storage and degradation of paclitaxel and its statistically similar for all genes (p > 0.05) as determined precursors may be important [5, 47, 48]. The paclitaxel biosynthetic pathway originates in the plastid and by randomization tests using REST software. Reported involves hydroxylation in the endoplasmic reticulum and acylation in the cytosol [49]. Knowledge about values are the average of three biological replicates. subcellular trafficking and transport of paclitaxel and precursors, mechanisms for extracellular secretion Download figure to PowerPoint (/doi/10.1002 and in vivo degradation will help suggest additional potential regulators of paclitaxel/taxane accumulation. /biot.201100183/figure.pptx?figureAssetHref=image_n
4 Concluding remarks
/nfig003.jpg)
Significant variability is observed in paclitaxel accumulation amongst cultures of different Taxus species and over time within a single species. In this paper, we studied the relationship between paclitaxel biosynthetic pathway gene expression and the varying bulk levels of paclitaxel observed amongst cultures. Through qRT-PCR, we demonstrated induction of paclitaxel biosynthetic pathway genes through elicitation with MeJA, which is necessary for paclitaxel accumulation. By analyzing MeJA-elicited cultures with varying levels of paclitaxel accumulation, we observed additional upregulation of paclitaxel biosynthetic pathway gene expression between cultures with significant differences in paclitaxel accumulation capabilities (15-fold). In particular, increased expression of late pathway genes, such as PAM and DBTNBT, was observed when there were substantial differences in bulk paclitaxel
12 de 21
20/03/2012 16:37
maintenance accumulation levels. However, when paclitaxel accumulation levels are only moderately different (two-fold), no Show messages differences in pathway gene expression were measured, suggesting that other factors affect the bulk paclitaxel accumulation patterns. This is the first study to address the relationship between gene expression and variability in paclitaxel accumulation through generating cultures with different paclitaxel accumulation potentials upon elicitation with MeJA. A systems-wide genomics approach along with consideration of post-biosynthetic pathway events such as transport and degradation are necessary to fully understand the factors that regulate paclitaxel accumulation in cell culture.
Acknowledgements
This work was supported by grants from the NIH (GM070852) to S. C. R., E. L. W., and J. N. and NSF (CBET-0730779) to S. C. R. M. E. K. also acknowledges support from a National Research Service Award T32 GM08515 from the NIH and the NSF-sponsored Institute for Cellular Engineering IGERT Program (DGE-0654128). We thank Dr. Donna Gibson of the USDA, Agricultural Research Service, for the Taxus cell cultures. We also thank Dr. Guang Xu and Dr. Steven Rich for their assistance with qRT-PCR analysis. The authors declare no conflict of interest.
REFERENCES
13 de 21
20/03/2012 16:37
maintenance 1 Li, J. W. H., Vederas, J. C., Drug discovery and natural Products: End of an era or an Show messages endless frontier? Science 2009, 325, 161165. CrossRef (/resolve/reference/XREF?id=10.1126/science.1168243), PubMed (/resolve /reference/PMED?id=19589993), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD1MXos1Srurs%3D), Web of Science Times Cited: 174 (/resolve/reference/ISI?id=000267802000035), ADS (/resolve/reference /ADS?id=2009Sci...325..161L) 2 Colegate, S. M., Molyneux, R. J. (Eds.), Bioactive Natural Products: Detection, Isolation, and Structural Determination, CRC Press, USA 2008. 3 Vongpaseuth, K., Roberts, S. C., Advancements in the understanding of Paclitaxel metabolism in tissue culture. Curr. Pharm. Biotechnol. 2007, 8, 219236. CrossRef (/resolve/reference/XREF?id=10.2174/138920107781387393), PubMed (/resolve/reference/PMED?id=17691991), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD2sXhtVKqsLbJ), Web of Science Times Cited: 10 (/resolve/reference/ISI?id=000249234200005) 4 Lee, E. K., Jin, Y. W., Park, J. H., Yoo, Y. M. et al., Cultured cambial meristematic cells as a source of plant natural products. Nat. Biotechnol. 2010, 28, 12131217. CrossRef (/resolve/reference/XREF?id=10.1038/nbt.1693), PubMed (/resolve/reference /PMED?id=17828703), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BC3cXhtlahu7fM), Web of Science Times Cited: 6 (/resolve/reference/ISI?id=000283924100025) 5 Roberts, S. C., Production and engineering of terpenoids in plant cell culture. Nat. Chem. Biol. 2007, 3, 387395. CrossRef (/resolve/reference/XREF?id=10.1038/nchembio.2007.8), PubMed (/resolve /reference/PMED?id=17576426), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD2sXms1Srsb0%3D), Web of Science Times Cited: 58 (/resolve/reference/ISI?id=000247462800013) 6 Fett-Neto, A. G., DiCosmo, F., Reynolds, W. F., Sakata, K., Cell culture of Taxus as a source of the antineoplastic drug Taxol and related taxanes. Nat. Biotechnol. 1992, 10, 15721575. CrossRef (/resolve/reference/XREF?id=10.1038/nbt1292-1572), PubMed (/resolve /reference/PMED?id=1369501), CAS (/resolve/reference /CAS?id=1:CAS:528:DyaK3sXhtVSnt74%3D), Web of Science Times Cited: 88 (/resolve/reference/ISI?id=A1992LM36900029) 7 Srinivasan, V., Pestchanker, L., Moser, S., Hirasuna, T. J. et al., Taxol production in bioreactors: Kinetics of biomass accumulation, nutrient uptake, and taxol production by cell suspensions of Taxus baccata. Biotechnol. Bioeng. 1995, 47, 666676. Direct Link: Abstract (/doi/10.1002/bit.260470607/abstract) PDF(970K) (/doi/10.1002/bit.260470607/pdf) References (/doi/10.1002/bit.260470607/references) 8 Yukimune, Y., Tabata, H., Higashi, Y., Hara, Y., Methyl jasmonate-induced overproduction
14 de 21
20/03/2012 16:37
maintenance of paclitaxel and baccatin III in Taxus cell suspension cultures. Nat. Biotechnol. 1996, Show messages 14, 11291132. CrossRef (/resolve/reference/XREF?id=10.1038/nbt0996-1129), PubMed (/resolve /reference/PMED?id=9631065), CAS (/resolve/reference /CAS?id=1:CAS:528:DyaK28Xls1Wgtr0%3D), Web of Science Times Cited: 214 (/resolve/reference/ISI?id=A1996VF84300036) 9 Wickremesinhe, E. R. M., Arteca, R. N., Taxus cell suspension cultures Optimizing growth and production of Taxol. J. Plant Physiol. 1994, 144, 183188. CrossRef (/resolve/reference/XREF?id=10.1016/S0176-1617(11)80541-9), CAS (/resolve /reference/CAS?id=1:CAS:528:DyaK2cXlsFGrs70%3D), Web of Science Times Cited: 46 (/resolve/reference/ISI?id=A1994PC76300009) 10 Ushiyama, K., Large-scale culture of ginseng. in: Komamine, A., Misawa, M., DiCosmo, F. (Eds.), Plant Cell Culture in Japan: Progress in Production of Useful Plant Metabolites by Japanese Enterprises Using Plant Cell Culture Technology, CMC Co. Ltd., Tokyo 1991, pp. 9298. 11 Fujita, Y., Tabata, M., Nishi, A., Yamada, Y., New medium and production of secondary compounds with the two-staged culture method. in: Fujiwara, A. (Ed.), Plant Tissue Culture, The Japanese Association for Plant Tissue Culture, Maruzen Co. Ltd., Tokyo 1982, pp. 399400. 12 Sato, F., Yamada, Y., High berberine-producing cultures of coptis japonica cells. Phytochemistry 1984, 23, 281285. CrossRef (/resolve/reference/XREF?id=10.1016/S0031-9422(00)80318-0), CAS (/resolve /reference/CAS?id=1:CAS:528:DyaL2cXitVKmsb4%3D), Web of Science Times Cited: 116 (/resolve/reference/ISI?id=A1984SG89500015) 13 Kolewe, M. E., Gaurav, V., Roberts, S. C., Pharmaceutically active natural product synthesis and supply via plant cell culture technology. Mol. Pharm. 2008, 5, 243256. CrossRef (/resolve/reference/XREF?id=10.1021/mp7001494), PubMed (/resolve /reference/PMED?id=18393488), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD1cXkt1CktLg%3D), Web of Science Times Cited: 36 (/resolve/reference/ISI?id=000254708600007) 14 Gundlach, H., Muller, M. J., Kutchan, T. M., Zenk, M. H., Jasmonic acid is a signal transducer in elicitor-induced plant-cell cultures. Proc. Natl. Acad. Sci. USA 1992, 89, 23892393. CrossRef (/resolve/reference/XREF?id=10.1073/pnas.89.6.2389), PubMed (/resolve /reference/PMED?id=11607285), CAS (/resolve/reference /CAS?id=1:CAS:528:DyaK38XisFagsb8%3D), Web of Science Times Cited: 646 (/resolve/reference/ISI?id=A1992HJ05300081), ADS (/resolve/reference /ADS?id=1992PNAS...89.2389G) 15 Mirjalili, N., Linden, J. C., Methyl jasmonate induced production of taxol in suspension cultures of Taxus cuspidata: Ethylene interaction and induction models. Biotechnol. Prog. 1996, 12, 110118. Direct Link:
15 de 21
20/03/2012 16:37
maintenance Show messages
Abstract (/doi/10.1021/bp9500831/abstract) Full Article (HTML) (/doi/10.1021/bp9500831/full) PDF(162K) (/doi/10.1021/bp9500831/pdf)
References (/doi/10.1021/bp9500831/references) 16 Ketchum, R. E. B., Gibson, D. M., Croteau, R. B., Shuler, M. L., The kinetics of taxoid accumulation in cell suspension cultures of Taxus following elicitation with methyl jasmonate. Biotechnol. Bioeng. 1999, 62, 97105. Direct Link: Abstract (/doi/10.1002/(SICI)1097-0290(19990105)62:1<97::AIDBIT11>3.0.CO;2-C/abstract) PDF(221K) (/doi/10.1002/(SICI)1097-0290(19990105)62:1<97::AIDBIT11>3.0.CO;2-C/pdf) References (/doi/10.1002/(SICI)1097-0290(19990105)62:1<97::AIDBIT11>3.0.CO;2-C/references) 17 Tabata, H., Paclitaxel production by plant-cell-culture technology. in: Biomanufacturing, Springer, Berlin, Heidelberg 2004, pp. 123. 18 Bringi, V., Kadkade, P. G., Prince, C. L., Roach, B. L. Enhanced production of Taxol and Taxanes by cell cultures of Taxus species. US patent 7264951, 2007. 19 Morris, P., Rudge, K., Cresswell, R., Fowler, M. W., Regulation of product synthesis in cell-cultures of Catharanthus roseus .5. Long-term maintenance of cells on a production medium. Plant Cell Tissue Organ Cult. 1989, 17, 7990. CrossRef (/resolve/reference/XREF?id=10.1007/BF00046853), CAS (/resolve/reference /CAS?id=1:CAS:528:DyaL1MXltlamsLw%3D), Web of Science Times Cited: 17 (/resolve/reference/ISI?id=A1989U657100001) 20 Qu, J. G., Zhang, W., Yu, X. J., Jin, M. F., Instability of anthocyanin accumulation in Vitis vinifera L. var. Gamay Freaux suspension cultures. Biotechnol. Bioprocess Eng. 2005, 10, 155161. CrossRef (/resolve/reference/XREF?id=10.1007/BF02932586), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD2MXjvFaktbs%3D), Web of Science Times Cited: 5 (/resolve/reference/ISI?id=000228825000009) 21 Deusneumann, B., Zenk, M. H., Instability of indole alkaloid production in Catharanthus roseus cell-suspension cultures. Planta Med. 1984, 50, 427431. CrossRef (/resolve/reference/XREF?id=10.1055/s-2007-969755), PubMed (/resolve /reference/PMED?id=17340345), CAS (/resolve/reference /CAS?id=1:CAS:528:DyaL2MXlvFCjtw%3D%3D), Web of Science Times Cited: 101 (/resolve/reference/ISI?id=A1984TR14400016) 22 Ketchum, R. E. B., Gibson, D. M., Paclitaxel production in suspension cell cultures of Taxus. Plant Cell Tissue Organ Cult. 1996, 46, 916. CrossRef (/resolve/reference/XREF?id=10.1007/BF00039691), CAS (/resolve/reference /CAS?id=1:CAS:528:DyaK28XntlGls70%3D), Web of Science Times Cited: 58 (/resolve/reference/ISI?id=A1996VR87500002) 23 Kim, B. J., Gibson, D. M., Shuler, M. L., Effect of subculture and elicitation on instability
16 de 21
20/03/2012 16:37
maintenance of Taxol production in Taxus sp suspension cultures. Biotechnol. Prog. 2004, 20, Show messages 16661673. Direct Link: Abstract (/doi/10.1021/bp034274c/abstract) Full Article (HTML) (/doi/10.1021/bp034274c/full) PDF(221K) (/doi/10.1021/bp034274c/pdf) References (/doi/10.1021/bp034274c/references) 24 Baebler, S., Hren, M., Camloh, M., Ravnikar, M. et al., Establishment of cell suspension cultures of yew (Taxus x Media Rehd.) and assessment of their genomic stability. In Vitro Cell. Dev. Biol. Plant 2005, 41, 338343. CrossRef (/resolve/reference/XREF?id=10.1079/IVP2005642), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD2MXos1alur8%3D), Web of Science Times Cited: 10 (/resolve/reference/ISI?id=000230506000026) 25 Bonfill, M., Exposito, O., Moyano, E., Cusido, R. M. et al., Manipulation by culture mixing and elicitation of paclitaxel and baccatin III production in Taxus baccata suspension cultures. In Vitro Cell. Dev. Biol. Plant 2006, 42, 422426. CrossRef (/resolve/reference/XREF?id=10.1079/IVP2006761), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD2sXhtVeqt7s%3D), Web of Science Times Cited: 4 (/resolve/reference/ISI?id=000242217900011) 26 Hefner, J., Ketchum, R. E., Croteau, R., Cloning and functional expression of a cDNA encoding geranylgeranyl diphosphate synthase from Taxus canadensis and assessment of the role of this prenyltransferase in cells induced for taxol production. Arch. Biochem. Biophys. 1998, 360, 6274. CrossRef (/resolve/reference/XREF?id=10.1006/abbi.1998.0926), PubMed (/resolve /reference/PMED?id=9826430), CAS (/resolve/reference /CAS?id=1:CAS:528:DyaK1cXnvFOku78%3D), Web of Science Times Cited: 75 (/resolve/reference/ISI?id=000077357100009) 27 Nims, E., Dubois, C. P., Roberts, S. C., Walker, E. L., Expression profiling of genes involved in paclitaxel biosynthesis for targeted metabolic engineering. Metab. Eng. 2006, 8, 385394. CrossRef (/resolve/reference/XREF?id=10.1016/j.ymben.2006.04.001), PubMed (/resolve/reference/PMED?id=16793302), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD28XoslOgsbc%3D), Web of Science Times Cited: 25 (/resolve/reference/ISI?id=000240600800001) 28 Jennewein, S., Wildung, M. R., Chau, M., Walker, K., Croteau, R., Random sequencing of an induced Taxus cell cDNA library for identification of clones involved in Taxol biosynthesis. Proc. Natl. Acad. Sci. USA 2004, 101, 91499154. CrossRef (/resolve/reference/XREF?id=10.1073/pnas.0403009101), PubMed (/resolve /reference/PMED?id=15178753), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD2cXltlWqtrs%3D), Web of Science Times Cited: 65 (/resolve/reference/ISI?id=000222104900058), ADS (/resolve/reference /ADS?id=2004PNAS..101.9149J)
17 de 21
20/03/2012 16:37
maintenance 29 Gao, M., Zhang, W., Li, X., Ruan, C., Fan, S., Expression profiling of genes involved in Show messages Taxuyunnanine C biosynthesis in cell suspension cultures of Taxus chinensis by repeated elicitation with a newly synthesized jasmonate and sucrose feeding. Sheng Wu Gong Cheng Xue Bao 2011, 27, 101107. PubMed (/resolve/reference/PMED?id=21548483) 30 Kolewe, M. E., Henson, M. A., Roberts, S. C., Characterization of aggregate size in Taxus suspension cell culture. Plant Cell Rep. 2010, 29, 485494. CrossRef (/resolve/reference/XREF?id=10.1007/s00299-010-0837-5), PubMed (/resolve /reference/PMED?id=20217417), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BC3cXksFGnsLs%3D), Web of Science Times Cited: 3 (/resolve/reference/ISI?id=000276615300006) 31 Wallner, S. J., Nevins, D. J., Formation and dissociation of cell aggregates in suspension cultures of Pauls Scarlet Rose. Am. J. Bot. 1973, 60, 255261. CrossRef (/resolve/reference/XREF?id=10.2307/2441216), Web of Science Times Cited: 25 (/resolve/reference/ISI?id=A1973O800900009) 32 Verma, D., Van Huystee, R., Relationship between peroxidase, catalase and protein synthesis during cellular development in cell cultures of peanut. Can. J. Biochem. 1970, 48, 444449. CrossRef (/resolve/reference/XREF?id=10.1139/o70-072), PubMed (/resolve/reference /PMED?id=5418966), CAS (/resolve/reference /CAS?id=1:CAS:528:DyaE3cXktlagt7Y%3D), Web of Science Times Cited: 26 (/resolve/reference/ISI?id=A1970G098800009) 33 Kolewe, M. E., Henson, M. A., Roberts, S. C., Analysis of aggregate size as a process variable affecting paclitaxel accumulation in Taxus suspension cultures. Biotechnol. Prog. 2011, 27, 13651372. Direct Link: Abstract (/doi/10.1002/btpr.655/abstract) Full Article (HTML) (/doi/10.1002/btpr.655/full) PDF(665K) (/doi/10.1002/btpr.655/pdf) References (/doi/10.1002/btpr.655/references) 34 Naill, M. C., Roberts, S. C., Preparation of single cells from aggregated Taxus suspension cultures for population analysis. Biotechnol. Bioeng. 2004, 86, 817826. Direct Link: Abstract (/doi/10.1002/bit.20083/abstract) PDF(473K) (/doi/10.1002/bit.20083/pdf) References (/doi/10.1002/bit.20083/references) 35 Ramakers, C., Ruijter, J. M., Deprez, R. H. L., Moorman, A. F. M., Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 2003, 339, 6266. CrossRef (/resolve/reference/XREF?id=10.1016/S0304-3940(02)01423-4), PubMed (/resolve/reference/PMED?id=12618301), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD3sXhs1Kks70%3D), Web of Science Times Cited: 923
18 de 21
20/03/2012 16:37
(/resolve/reference/ISI?id=000181411500016) 36 Show messages Pfaffl, M. W., Horgan, G. W., Dempfle, L., Relative expression software tool (REST (c)) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002, 30. e36. CrossRef (/resolve/reference/XREF?id=10.1093/nar/30.9.e36), PubMed (/resolve /reference/PMED?id=11972351), Web of Science Times Cited: 1581 (/resolve /reference/ISI?id=000175591100030) 37 Hu, F. X., Huang, J. H., Xu, Y. F., Gian, X. H., Zhong, J. J., Responses of defense signals, biosynthetic gene transcription and taxoid biosynthesis to elicitation by a novel synthetic jasmonate in cell cultures of Taxus chinensis. Biotechnol. Bioeng. 2006, 94, 10641071. Direct Link: Abstract (/doi/10.1002/bit.20921/abstract) PDF(195K) (/doi/10.1002/bit.20921/pdf) References (/doi/10.1002/bit.20921/references) 38 Kai, G., Zhao, L., Zhang, L., Li, Z. et al., Characterization and expression profile analysis of a new cDNA encoding taxadiene synthase from Taxus media. J. Biochem. Mol. Biol. 2005, 38, 668675. CrossRef (/resolve/reference/XREF?id=10.5483/BMBRep.2005.38.6.668), PubMed (/resolve/reference/PMED?id=16336781), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD2MXhtlertrvN), Web of Science Times Cited: 8 (/resolve /reference/ISI?id=000233627800006) 39 Exposito, O., Syklowska-Baranek, K., Moyano, E., Onrubia, M. et al., Metabolic responses of Taxus media transformed cell cultures to the addition of methyl jasmonate. Biotechnol. Prog. 2010, 26, 11451153. PubMed (/resolve/reference/PMED?id=20730769), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BC3cXht1Kju77O), Web of Science Times Cited: 4 (/resolve/reference/ISI?id=000281045100028) 40 Wheeler, A. L., Long, R. M., Ketchum, R. E. B., Rithner, C. D. et al., Taxol biosynthesis: differential transformations of taxadien-5[small alpha]-ol and its acetate ester by cytochrome P450 hydroxylases from Taxus suspension cells. Arch. Biochem. Biophys. 2001, 390, 265278. CrossRef (/resolve/reference/XREF?id=10.1006/abbi.2001.2377), PubMed (/resolve /reference/PMED?id=11396929), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD3MXktFKjsr8%3D), Web of Science Times Cited: 31 (/resolve/reference/ISI?id=000169542800013) 41 Yuan, Y. J., Li, C., Hu, Z. D., Wu, J. C., Zeng, A. P., Fungal elicitor-induced cell apoptosis in suspension cultures of Taxus chinensis var. mairei for taxol production. Process Biochem. 2002, 38, 193198. CrossRef (/resolve/reference/XREF?id=10.1016/S0032-9592(02)00071-7), CAS (/resolve /reference/CAS?id=1:CAS:528:DC%2BD38XltlGmtbk%3D), Web of Science Times Cited: 26 (/resolve/reference/ISI?id=000178900800008) 42 Wasternack, C., Jasmonates: An update on biosynthesis, signal transduction and action
maintenance
19 de 21
20/03/2012 16:37
maintenance in plant stress response, growth and development. Ann. Bot. 2007, 100, 681697. CrossRef (/resolve/reference/XREF?id=10.1093/aob/mcm079), PubMed (/resolve Show messages /reference/PMED?id=17513307), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD2sXhtlyhs7vF), Web of Science Times Cited: 348 (/resolve/reference/ISI?id=000250663300001) 43 Pauwels, L., Morreel, K., Witte, E. D., Lammertyn, F. et al., Mapping methyl Jasmonatemediated transcriptional reprogramming of metabolism and cell cycle progression in cultured arabidopsis cells. Proc. Natl. Acad. Sci. USA 2008, 105, 13801385. CrossRef (/resolve/reference/XREF?id=10.1073/pnas.0711203105), PubMed (/resolve /reference/PMED?id=18216250), Web of Science Times Cited: 64 (/resolve/reference /ISI?id=000252873900054), ADS (/resolve/reference/ADS?id=2008PNAS..105.1380P 44 Verpoorte, R., Memelink, J., Engineering secondary metabolite production in plants. Curr. Opin. Biotechnol. 2002, 13, 181187. CrossRef (/resolve/reference/XREF?id=10.1016/S0958-1669(02)00308-7), PubMed (/resolve/reference/PMED?id=11950573), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD38Xis1CltLk%3D), Web of Science Times Cited: 80 (/resolve/reference/ISI?id=000174643900018) 45 Lijavetzky, D., Almagro, L., Belchi-Navarro, S., Martinez-Zapater, J. et al., Synergistic effect of methyljasmonate and cyclodextrin on stilbene biosynthesis pathway gene expression and resveratrol production in Monastrell grapevine cell cultures. BMC Res. Notes 2008, 1, 132. CrossRef (/resolve/reference/XREF?id=10.1186/1756-0500-1-132), PubMed (/resolve /reference/PMED?id=19102745), CAS (/resolve/reference /CAS?id=1:CAS:528:DC%2BD1MXht1GhsL%2FE) 46 Fett-Neto, A. G., Melanson, S. J., Nicholson, S. A., Pennington, J. J., Dicosmo, F., Improved taxol yield by aromatic carboxylic acid and amino acid feeding to cell cultures of taxus cuspidata. Biotechnol. Bioeng. 1994, 44, 967971. Direct Link: Abstract (/doi/10.1002/bit.260440813/abstract) PDF(481K) (/doi/10.1002/bit.260440813/pdf) References (/doi/10.1002/bit.260440813/references) 47 Siegler, D., Plant Secondary Metabolism, Kluwer Academic Publisher, Dordrecht 1998. 48 Zhang, W., Curtin, C., Franco, C., Towards manipulation of post-biosynthetic events in secondary metabolism of plant cell cultures. Enzyme Microb. Technol. 2002, 30, 688696. CrossRef (/resolve/reference/XREF?id=10.1016/S0141-0229(02)00041-8), CAS (/resolve /reference/CAS?id=1:CAS:528:DC%2BD38XktVCnu7g%3D), Web of Science Times Cited: 12 (/resolve/reference/ISI?id=000175961200002) 49 Croteau, R., Ketchum, R., Long, R., Kaspera, R., Wildung, M., Taxol biosynthesis and molecular genetics. Phytochem. Rev. 2006, 5, 7597. CrossRef (/resolve/reference/XREF?id=10.1007/s11101-005-3748-2), PubMed (/resolve /reference/PMED?id=20622989), CAS (/resolve/reference
20 de 21
20/03/2012 16:37
maintenance
/CAS?id=1:CAS:528:DC%2BD28Xptlyms7Y%3D)
Show messages Get PDF (355K) (/doi/10.1002/biot.201100183/pdf)
More content like this

Find more content: like this article (/advanced/search/results?articleDoi=10.1002/biot.201100183&scope=allContent& start=1&resultsPerPage=20) Find more content written by: Rohan A. Patil (/advanced/search/results?searchRowCriteria[0].queryString="Rohan A. Patil"&searchRowCriteria[0].fieldName=author&start=1&resultsPerPage=20) Martin E. Kolewe (/advanced/search/results?searchRowCriteria[0].queryString="Martin E. Kolewe"&searchRowCriteria[0].fieldName=author&start=1&resultsPerPage=20) Jennifer Normanly (/advanced/search/results?searchRowCriteria[0].queryString="Jennifer Normanly"&searchRowCriteria[0].fieldName=author&start=1&resultsPerPage=20) Elsbeth L. Walker (/advanced/search/results?searchRowCriteria[0].queryString="Elsbeth L. Walker"&searchRowCriteria[0].fieldName=author&start=1&resultsPerPage=20) Susan C. Roberts (/advanced/search/results?searchRowCriteria[0].queryString="Susan C. Roberts"&searchRowCriteria[0].fieldName=author&start=1&resultsPerPage=20) All Authors (/advanced/search/results?searchRowCriteria[0].queryString="Rohan A. Patil" "Martin E. Kolewe" "Jennifer Normanly" "Elsbeth L. Walker" "Susan C. Roberts"&searchRowCriteria[0].fieldName=author&start=1&resultsPerPage=20)
21 de 21
20/03/2012 16:37

Contribution of Taxane Biosynthetic Pathway Gene Expression To Observed Variability in Paclitaxel Accumulation in Taxus Suspension Cultures

Caricato da

Informazioni sul documento

Titolo originale

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

Contribution of Taxane Biosynthetic Pathway Gene Expression To Observed Variability in Paclitaxel Accumulation in Taxus Suspension Cultures

Caricato da

Copyright:

Formati disponibili

Contribution of taxane biosynthetic pathway gene expression to observe...

maintenance Show messages

Research Article You have full text access to this content