Molecular Microbiology (2010) 75(2), 413425

doi:10.1111/j.1365-2958.2009.06986.x First published online 11 December 2009

Escherichia coli ribonuclease III activity is downregulated by osmotic stress: consequences for the degradation of bdm mRNA in biolm formation
mmi_6986 413..425

Se-Hoon Sim,1 Ji-Hyun Yeom,1 Choy Shin,2 Woo-Seok Song,1 Eunkyoung Shin,1 Hong-Man Kim,1 Chang-Jun Cha,3 Seung Hyun Han,4 Nam-Chul Ha,5 Si Wouk Kim,6 Yoonsoo Hahn,1 Jeehyeon Bae7 and Kangseok Lee1* 1 Department of Life Science (BK21 program) and 2 Graduate School of Education, Chung-Ang University, Seoul 156-756, Republic of Korea. 3 Department of Biotechnology, Chung-Ang University, Anseong 456-756, Republic of Korea. 4 Department of Oral Microbiology and Immunology, Dental Research Institute, and BK21 program, School of Dentistry, Seoul National University, Seoul 110-749, Republic of Korea. 5 College of Pharmacy and Research Institute for Drug Development, Pusan National University, Busan 609-735, Republic of Korea. 6 Department of Biomaterials Engineering, BK21 Team for Biohydrogen Production, Chosun University, Gwangju, 501-759, Republic of Korea. 7 Graduate School of Life Science and Biotechnology, CHA University, Seongnam 463-836, Republic of Korea.

coding region constitute a rate-determining step for bdm mRNA degradation. We also discovered that downregulation of the ribonucleolytic activity of RNase III is required for the sustained elevation of RcsB-induced bdm mRNA levels during osmotic stress and that cells overexpressing bdm form biolms more efficiently. These ndings indicate that the Rcs signalling system has an additional regulatory pathway that functions to modulate bdm expression and consequently, adapt E. coli cells to osmotic stress.

Introduction
Bacterial mRNA has been recognized for more than half a century as an inherently unstable molecule in vivo (Brenner et al., 1961; Gros et al., 1961). This intrinsic property of bacterial mRNA is believed to contribute to the rapid regulation of gene expression that is required for cells to adapt to environmental changes. Although bacterial mRNA is normally unstable, the longevity of mRNA varies from seconds to hours depending on the RNA molecules and the physiological state of the cell (Nicholson, 1999; Bernstein et al., 2004). Many cis- and transacting elements that govern the differential stability of mRNA have been identied. Among them, ribonucleases play a pivotal role in modulating mRNA stability. In Escherichia coli, the RNase E (Rne) endoribonuclease is a major ribonuclease that catalyses the initial ratedetermining cleavage of a large number of transcripts (Hagege and Cohen, 1997). A recent study has also shown that the removal of phosphates from the 5 end of mRNA by the pyrophosphatase RppH greatly inuences the stability of a few hundred of mRNAs (Deana et al., 2008). In recent years, the ribonuclease III (RNase III) family of enzymes has emerged as one of the most important endoribonucleases in the control of mRNA stability in higher organisms (Lee et al., 2006; Jaskiewicz and Filipowicz, 2008; Ramachandran and Chen, 2008). Although the RNase III family is divided into three classes, all RNase III family members contain a characteristic ribonuclease domain commonly called the RNase III domain.

Summary
During the course of experiments aimed at identifying genes with ribonuclease III (RNase III)-dependent expression in Escherichia coli, we found that steady state levels of bdm mRNA were dependent on cellular concentrations of RNase III. The half-lives of adventitiously overexpressed bdm mRNA and the activities of a transcriptional bdmcat fusion were observed to be dependent on cellular concentrations of RNase III, indicating the existence of cis-acting elements in bdm mRNA responsive to RNase III. In vitro and in vivo cleavage analyses of bdm mRNA identied two RNase III cleavage motifs, one in the 5 -untranslated region and the other in the coding region of bdm mRNA, and indicated that RNase III cleavages in the
Accepted 16 November, 2009. *For correspondence. E-mail kangseok@cau.ac.kr; Tel. (+82) 2 820 5241; Fax (+82) 2 822 5241. These authors contributed equally to this work.

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd

414 S-H. Sim et al.

Class 1 proteins are E. coli RNase III-like proteins, which usually contain a single ribonuclease domain and a dsRNA-binding domain (dsRBD). Class 2 proteins have a dsRBD and two ribonuclease domains that are commonly referred to as RNase IIIa and RNase IIIb. Class 3 proteins are the largest and typically contain two ribonuclease domains: a dsRBD and an N-terminal DExD/H-box helicase domain followed by a small domain of unknown function (DUF283) and a PAZ domain. The E. coli RNase III was the rst specic doublestranded RNA endoribonuclease discovered (Robertson et al., 1968). This enzyme is an Mg2+-dependent nuclease that cleaves phosphodiester bonds, creating 5phosphate and 3-hydroxyl termini with an overhang of two nucleotides (Court, 1993). RNase III is best known for its role in ribosomal RNA (rRNA) processing in bacteria (Bram et al., 1980), although it has also been shown to participate in initiating the decay of several mRNA species such as rnc mRNA (Bardwell et al., 1989; Matsunaga et al., 1996a) and pnp mRNA (Regnier and Portier, 1986). In this study we set out to investigate the functional role of RNase III in mRNA stability, and identied 100 genes with steady state levels of mRNA that were decreased at least twofold by increased cellular concentrations of RNase III. Among these genes, the steady state levels of bdm (biolm-dependent modulation) mRNA uctuated greatly in a manner that was independent of the RcsCBD His-Asp phosphorelay system (Rcs system) (Gottesman et al., 1985), which has been shown to regulate bdm expression under osmotic stress (Francez-Charlot et al., 2005; Shabala et al., 2009). Based on our experimental results, we demonstrate the existence of an additional regulatory pathway for bdm expression that is mediated by RNase III, and that the downregulation of RNase III activity is required for a sustained elevation of bdm mRNA levels in cells under high osmotic stress.

Results
Identication of genes whose mRNA abundance is dependent on RNase III The functional and evolutionary conservation of RNase III-related enzymes in bacteria and higher organisms attests to their biological importance in RNA processing and degradation. The importance of these enzymes in the regulation of gene expression in higher organisms has been vigorously investigated in recent years. However, the functional role of RNase III-related enzymes in the regulation of gene expression in bacteria has not been systematically studied. This lack of study is likely due to the active role of RNase III-related enzymes on the processing of structural RNAs such as rRNA and tRNA, as well as the absence of genetic systems that can identify

RNase III target mRNA species without affecting normal cellular growth. For this reason, we wished to establish the functional role of RNase III in regulating gene expression in E. coli through the use of microarray analyses that would identify genes with mRNA levels that were dependent on cellular concentrations of RNase III. However, for this purpose, we could not apply a simple procedure that utilizes total RNA samples prepared from paired cultures of wild-type and mutant (rnc-deleted in this case) cells because E. coli cells with RNase III gene (rnc) deleted grow at signicantly lower rates than wild-type cells and, consequently, a comparison of mRNA abundance between these two strains resulted in the alteration of mRNA abundance of several hundreds of growth raterelated genes, such as those involved in major metabolic pathways, DNA replication, transcription and translation (data not shown), all of which masked the identication of genes whose mRNA abundance was directly regulated by RNase III. To circumvent this problem, we constructed an rnc-deleted strain harbouring a cloned copy of rnc under an arabinose-inducible promoter (pRNC1). Using this strain we determined the cellular concentrations of RNase III that did not interfere with normal cellular growth. The results showed that normal cellular growth was maintained when RNase III was expressed in the range of 0.110.0 times the endogenous level of RNase III found in wild-type cells (Fig. 1). It is not unusual for E. coli cells to maintain the normal cellular growth in rich media when a broad range of ribonuclease concentrations was established by genetic manipulations. For instance, the cellular concentrations of the essential E. coli protein, RNase E, required for normal cellular growth in rich media have been reported to range from approximately 0.1 to 3 times the level of endogenous RNase E found in wild-type cells (Jain et al., 2002; Yeom and Lee, 2006; Shin et al., 2008). Based on the results shown in Fig. 1, we isolated total RNA from paired cultures of cells that expressed 0.1, 1.0 or 10.0 times the endogenous level of RNase III (0.1, 1.0 or 10.0) for microarray analysis. This procedure allowed us to differentiate genes whose expression was altered by different cellular concentrations of RNase III from those dependent on different cellular growth rates. The results showed that an increased cellular concentration of RNase III from 0.1 to 10.0 upregulated 87 genes as well as downregulated 100 genes by more than twofold (Fig. 1C and Table S1). The relative mRNA abundance of these genes was changed in a manner dependent on cellular concentrations of RNase III (Fig. 1D). To validate the microarray data, the abundance of four gene transcripts that were greatly upregulated (ompF and ptsA) or downregulated (bdm and mltD) by increased cellular concentration of RNase III was measured using quantitative RT-PCR. The results of RT-PCR were well correlated with microarray data (Fig. S1). These results indicate that

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425

Regulation of bdm expression by RNase III 415

Strain Plasmid

rnc pKAN6
0.00100 0.00100 0.00100 0.00025

rnc pRNC1
0.00013 0.00006 0.00003 0.00000

Fig. 1. Effect of cellular RNase III concentrations on E. coli growth

and transcript prole. A. Arabinose concentration-dependent expression of RNase III. Cultures of W3110 cells harbouring pKAN6 and W3110rnc cells harbouring pKAN6 or pRNC1 were grown to the early log phase (OD600 = 0.1) and different concentrations of arabinose were added to induce the synthesis of RNase III (0.001% arabinose for cells harbouring pKAN6 and 0.00100%, 0.00050%, 0.00025%, 0.00013%, 0.00006% and 0.00000% arabinose for W3110rnc cells harbouring pRNC1). Culture samples were harvested at OD600 = 0.60.8 to obtain total protein for Western blot analysis of RNase III. The relative abundance of the RNase III protein bands was quantied by setting the amount of RNase III protein produced in W3110 cells harbouring pKAN6 as one. B. Growth characteristics of cells expressing different levels of RNase III. Cells were grown as described above and their growth was monitored by analysing cell density (absorbance at 600 nm) at the indicated time intervals. C. The hierarchical clustering of genes with relative mRNA levels that changed by 2.0-fold or more. Red shades represent an increase and green shades represent a decrease in the level of the transcript in W3110 plus pKAN6 grown in the presence of 0.001% arabinose and W3110rnc plus pRNC1 grown in the presence of 0.0002% (1.0 RNase III) or 0.001% arabinose (10.0 RNase III) compared with those grown in the presence of 0% arabinose. Genes with relative mRNA levels that changed by 2.0-fold or more in W3110 plus pKAN6 grown in the presence of 0.001% arabinose were eliminated for the clustering. Lane 1, 0.1 versus 1.0 RNase III; lane 2, 0.1 versus 10.0 RNase III; lane 3, 0% versus 0.001% arabinose. D. Graphic representation of changes in mRNA abundance of the genes used for the hierarchical clustering in lanes 1 and 2 in Fig. 1C.

Arabinose (%)

RNase III

Relative amount 1.00 0.00 9.82 1.66 0.84 0.36 0.27 0.10 of RNase III

S1

5 4

0.0X RNase III 0.1X RNase III 1.0X RNase III 10.0X RNase III

OD600

3 2 1

0
0 30 60 90 120 150 180 210 240 270 300 330 360

Time (min)

1 2 3

8 6

4 2

-2

-4

0.1X vs. 1X 0.1X vs. 10.0X

Ratio of cellular concentrations of RNase III

RNase III, best known for its role in processing structural RNAs such as rRNA and tRNA in bacteria, is actively involved in the processing and degradation of mRNA, and consequently, the post-transcriptional regulation of gene expression in E. coli. RNase III negatively regulates bdm gene expression Among the genes with steady state mRNA levels that were decreased by increased cellular concentrations of RNase III, the bdm gene attracted our attention for the following reasons. First, the steady state levels of bdm

mRNA were dramatically changed by the alteration of RNase III concentrations in the cell (Fig. S1). Second, the bdm gene has been known to be transcriptionally regulated by the RcsCBD His-Asp phosphorelay system (Rcs system) (Gottesman et al., 1985) in which transcriptional activation of bdm is directly mediated by an activator protein RcsB (Francez-Charlot et al., 2005). However, the steady state levels of rcsB mRNA were not dependent on cellular concentrations of RNase III (Fig. S1). Therefore, the increased steady state levels of bdm mRNA caused by decreased cellular concentrations of RNase III were not caused by transcriptional activation of a bdm promoter containing an RcsB responsive element (Francez-Charlot et al., 2005). Third, unlike other RcsB targets that are upregulated by high osmolarity through the RcsB system, induced expression of bdm was not transient and was sustained, a nding that suggested the existence of an unidentied mechanism for sustaining RcsB-dependent, osmoregulation-induced bdm expression (FrancezCharlot et al., 2005). To test whether bdm mRNA contains cis-acting elements that respond to cellular RNase III activity, we measured the degree of resistance to chloramphenicol of cells expressing a transcriptional bdm cat fusion mRNA in the presence and the absence of RNase III. The transcriptional bdm cat fusion construct expresses mRNA containing a 5-untranslated region (5-UTR) and the coding

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425

log2 (Cy5/Cy3)

416 S-H. Sim et al.

HT115

HT115

W3110

W3110

A
105 104 103 102 101

Number of cells

RNase III CAT S1

Cm 0

Cm 30
HT115 + pBDM3 pRNC1

C
pKAN6 RNase III 10.0X 0.1X 1.0X 0.0X min 0 1 2 4 8 0 1 2 4 8 0 1 2 4 8 0 1 2 4 8

bdm RNA M1 RNA

Fig. 2. Downregulation of bdm expression by RNase III. A. Effects of RNase III on the activities of bdm cat fusion. Strains W3110 and HT115 (W3110 rnc-14::DTn10) containing plasmid pBRS1 that expresses the bdm cat fusion were grown at 37C to OD600 = 0.6 and 10105 cells were spotted on LB-agar containing 0 or 30 mg of chloramphenicol per ml. B. Western blot analysis of CAT protein. Total protein was obtained from the cultures used in (A) and the amount of CAT, RNase III and ribosomal protein S1 were analysed using Western blot. The same membrane probed for CAT was cut and probed with polyclonal antibodies to RNase III and S1. The relative abundance of CAT protein bands was quantied by setting the amount of protein produced by W3110 containing pBRS1 as one. C. Effects of cellular RNase III concentration on bdm mRNA decay. Strains HT115 harbouring pBDM3 and pKAN6 or pRNC1 were grown at 37C to OD600 = 0.2 and transcription of bdm and rnc from the plasmids were induced by the addition of 0.1 mM IPTG for bdm and 0%, 0.0002%, and 0.001% arabinose for 0.1, 1.0, and 10.0 expression of RNase III, respectively, for 2 h. Total RNA samples were prepared from the cultures 0, 1, 2, 4 and 8 min after the addition of rifampicin (200 mg ml-1) and separated by electrophoresis on 6% polyacrylamide gel containing 8 M urea. The abundance of bdm mRNA and M1 RNA, the RNA component of RNase P (Kole and Altman, 1979; Reed et al., 1982), was measured by Northern blotting with 5 end-labelled primers. The abundance of M1 RNA was measured to provide an internal standard for evaluating the amount of total RNA in each lane.

HT115

W3110

by Western blot the amount of CAT protein in cells in the presence and absence of RNase III expression. Cells expressing both RNase III and bdm cat fusion mRNA showed a ~3.9-fold decrease in the amount of CAT protein when compared with rnc-deleted cells that expressed bdm cat fusion mRNA (Fig. 2B). We further showed that the change in the abundance of the RNase III-dependent bdm mRNA resulted from an alteration of bdm mRNA half-life by measuring the decay rate of bdm mRNA in cells adventitiously coexpressing bdm mRNA and 0.0, 0.1, 1.0 or 10.0 RNase III. Northern blot analyses revealed a more than threefold increase in the half-life of the bdm transcript (240 versus 72 s) in cells expressing no RNase III compared with cells that expressed 1.0 RNase III (Fig. 2C). The half-life of bdm mRNA in cells expressing 0.1 and 10.0 RNase III was 106 and 50 s respectively. Collectively, these ndings suggest that the increased steady state level of bdm mRNA in cells with decreased RNase III activity resulted from the stabilization of bdm transcripts. Effects of cellular concentrations of RNase E on bdm mRNA abundance We tested whether cellular levels of a single-stranded RNA specic endoribonuclease RNase E, which is known to play a major role in mRNA decay in E. coli (Apirion, 1975; Lee et al., 2003; Carpousis, 2007), have an effect on bdm mRNA abundance. As the RNase E gene (rne) is essential in E. coli, we utilized E. coli strain KSL2000 (Lee et al., 2002), in which the chromosomal rne gene has been deleted and complemented with a construct that expresses RNase E from an rne gene under the arabinose-inducible PBAD promoter in the pBAD-RNE plasmid. In the KSL2000 strain, the synthesis of RNase E is controlled solely by the concentration of arabinose, and cellular RNase E levels can be conditionally knocked down to ~10% of endogenous RNase E levels without signicantly affecting normal cellular growth in rich media. Steady state levels of bdm mRNA were measured in KSL2000 cells either in the presence or the absence of arabinose. The results revealed no signicant changes in bdm mRNA abundance in cells depleted for RNase E compared with cells that expressed endogenous levels of RNase E, indicating that RNase E is not actively involved in the decay pathway of bdm mRNA (Fig. 3). Identication of RNase III cleavage sites in bdm mRNA in vitro We were unable to detect distinct decay intermediates of bdm mRNA in a Northern blot analysis of total RNA prepared from the cells that overexpressed bdm mRNA and RNase III (data not shown). However, the fact that decay intermediates of mRNAs were not detectable at the time of

region of bdm that are fused to the coding region of CAT. The fusion mRNA was constitutively expressed from a mutant tryptophan promoter (Lee et al., 2001) in a multicopy plasmid (pBRS1) in wild-type cells (W3110) or cells deleted for rnc gene (HT115), and the degree of resistance of the cells to chloramphenicol was measured. The results showed a good correlation between the activities of the bdm cat fusion and the cellular concentration of RNase III (Fig. 2A), indicating that RNase III-responsive cis-acting elements are present in bdm mRNA. To conrm that the enhanced resistance to chloramphenicol of rncdeleted cells expressing bdm cat fusion mRNA was a result of increased CAT protein synthesis, we quantied

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425

Regulation of bdm expression by RNase III 417

KSL2000 -ara +ara RNase E RNaseIII S1

B
bp 300 200

KSL2000 -ara +ara

Relative amount of mRNA

Fig. 3. Effects of cellular concentration of RNase E on bdm mRNA abundance. A. Western blot analysis of RNase III and RNase E. The same membrane was probed with anti-RNase E, anti-RNase III and anti-S1 antibody. The S1 protein was used to provide an internal standard to evaluate the amount of cell extract in each lane. B. RT-PCR analysis of bdm mRNA abundance. An E. coli strain KSL2000 was cultured to OD600 = 0.6 and harvested for total RNA and protein preparation. RNase E in KSL2000 cells were depleted as previously described (Lee et al., 2002). The relative abundance of bdm mRNA was measured using RT-PCR and shown at the bottom of the gel.

analysis was not unusual as these mRNA decay intermediates are usually subject to rapid decay. For this reason, cleavages of bdm mRNA by RNase III were demonstrated biochemically using in vitro synthesized bdm mRNA transcripts and puried RNase III. RNase III cleavage of internally 32P-labelled bdm mRNA in vitro generated three major cleavage products approximately 160, 60 and 55 nucleotides in length (bands d, g and h respectively, in Fig. 4A) and several minor cleavage products consisting of approximately 260-, 220-, 140-, 120-, 25- and 15-nucleotide-long RNA fragments (bands ac, e, f, i and j respectively, in Fig. 4A). The band a was not well distinguished from the intact substrate in Fig. 4A. However, the band a was clearly visible in another autoradiograph prepared from a gel that was run for a longer time (Fig. S2A). These results indicate that several cleavage sites exist in the bdm mRNA transcript. To identify the cleavage sites, 5-32P-end-labelled bdm mRNA transcripts were cleaved with RNase III. The reaction generated one major and three minor cleavage products of ~220, ~160, 23 and 14 nucleotides in length that corresponded to bands b, d, i and j respectively. These results showed that these RNase III cleavage products generated from the 5 end-labelled bdm mRNA transcripts contained the intact 5-terminus, and that at least four RNase III cleavage sites existed in bdm mRNA. The RNase III cleavage sites that produced the bands i and j were identied using an RNA ladder generated by alkaline hydrolysis of 5 end-labelled bdm mRNA transcripts (rst lane in Fig. 4B). These sites were designated as cleavage sites 1 and 2, and were positioned in the double-stranded region in the 5-UTR of bdm mRNA, a nding that was further conrmed by primer extension analysis using in vitro cleavage products puried from RNase III cleavage reactions and the 5 end-labelled primer (+20R) (Fig. 4C).

To identify other cleavage sites, primer extension analyses were performed as described above with the 5 endlabelled primers (bdmR and +135R) shown in Fig. 4G. The results showed ve additional cleavage sites, four of which were clustered in a close proximity and designated as cleavage site 4 (IIV) (Fig. 4D, E and G). Cleavage site 3 was positioned in the strand opposite of cleavage site 4 in the double-stranded region of bdm mRNA. The identied cleavage sites were consistent with the size of the cleavage products detected in Fig. 4A, B and H. As shown in Fig. 4G, RNase III cleaved the double-stranded regions in the secondary structure of bdm mRNA, which was deduced using the M-fold program (http://mfold.bioinfo.rpi. edu/cgi-bin/rna-form1.cgi) and was partially conrmed by RNase T1 cleavage (Fig. 4B). Overall, RNase III cleaved bdm mRNA in vitro at specic sites that contained RNase III cleavage motifs: one in the 5-UTR and the other in the coding region of the mRNA (Fig. 4G). Based on the observation that the cleavage products generated by RNase III cleavages in the coding region of bdm (RNA fragments d, g and h in Fig. 4A) rapidly appeared and persisted, we concluded that these sites (3 and 4) are predominantly responsible for determining the rate of bdm mRNA degradation in vitro. To obtain a biological relevance of these RNase III cleavage sites identied in the synthetic bdm mRNA by in vitro cleavage assays, we performed primer extension analyses on bdm mRNA produced in vivo using total RNA samples prepared from cells adventitiously overexpressing bdm mRNA. Extension of the same primers used for primer extension analyses in Fig. 4CE produced cDNA products that corresponded to the cleavage sites 3 and 4-II (Fig. 4F). Other cleavage sites (1, 2, 4-I, 4-III and 4-IV) were not detected (Fig. S2B). The cleavage sites 1 and 2 identied in vitro are in a very short helix that would not conform to a canonical cleavage motif of RNase III, which might have resulted from either a false structure of bdm mRNA or the intrinsic property of RNase III to tend to randomly cleave long RNA transcripts in vitro (Xiao et al., 2009). The results indicated that at least sites 3 and 4-II were actually cleaved by RNase III in vivo, although other sites were not detected either because they were not cleaved by RNase III in vivo, or the decay intermediates rapidly were degraded by other ribonucleases. Taken together, analyses of bdm mRNA synthesized in vivo and in vitro imply that sites 3 and 4-II are major RNase III cleavage sites that probably determine the rate of bdm mRNA degradation. To test whether the sites 3 and 4-II are major RNase III cleavage sites in vivo, a nucleotide substitution (A to U) at position 157 of the RNase III cleavage site 4-II in bdm mRNA (bdm-A157U) was introduced in pBDM3 and the half-life of bdm and bdm-A157U mRNA and the cleavage specicity of RNase III were investigated. As shown in

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425

0.950.01

1.00.0

418 S-H. Sim et al.

A
ntd 300 200

III
0 16 1

III + Mg2+
2 4 8 16 min

B
a b c d e f

T1

III

III + Mg 2+

C
sequencing III III + Mg2+
G A T C 2 10 2 10 min

F
1 2

0.5M sequencing pBDM3 NaCl

G A T C + + - RNase III

1 2 4 0 16 1 2 4 8 16 min

b (4) d (3)

100

g h

D
sequencing III III + Mg2+
G A T C 2 10 2 10 min

3 i i (2)

13

E
j (1)
sequencing III III + Mg 2+
G A T C 2 10 2 10 min

4-II
IV III II I

Fig. 4. Identication of RNase III cleavage sites in bdm mRNA in vitro and in vivo. A. In vitro cleavage of bdm mRNA. One pmol of internally 32P-labelled bdm mRNA was incubated with 0.51 mg of puried RNase III, in the cleavage buffer with (III + Mg2+) or without MgCl2 (III). Samples were withdrawn at the indicated time intervals and separated on an 8% polyacrylamide gel containing 8 M urea. Cleavage products are indicated (aj). B. Identication of RNase III cleavage sites using 5 end-labelled bdm mRNA. One pmol of 5 end-labelled bdm mRNA was cleaved with RNase III and analysed as described above. Size markers were generated by alkaline hydrolysis (H) and RNase T1 digestion (T1) of the 5 end-labelled bdm transcript. Cleavage sites identied in (C) (E) are indicated (14). CE. Primer extension analysis of the in vitro cleaved bdm mRNA. Cleavage products of bdm mRNA puried from (B) were hybridized with 5 end-labelled primers (bdm +20R, bdm +135R and bdmR) and extended. F. Primer extension analysis of bdm mRNA synthesized in vivo. Total RNA was prepared from W3110 and HT115 that endogenously (0.5 M NaCl) or adventitiously (pBDM3) overexpressed bdm mRNA and were hybridized with 5 end-labelled primer (bdmR). Synthesized cDNA products were analysed in an 8% polyacrylamide gel. Sequencing ladders were produced using the same primer used in cDNA synthesis and PCR DNA encompassing the bdm gene as a template. G. Predicted secondary structure of bdm mRNA. The secondary structure was deduced using the M-fold program and an RNase T1 digestion as shown in (B). RNase III cleavage sites identied in (B)-(F) are shown (14). Bold arrows indicate the cleavage sites identied in (F). H. Schematic representation of RNase III cleavage products of bdm mRNA. Based on the results from (A) to (F), RNase III cleavage products and sites of bdm mRNA are indicated.

Fig. 5, the half-life of bdm-A157U mRNA was increased by four times (~1 versus ~4 min) and RNase III was not able to efficiently cleave bdm-A157U mRNA at the cleavage sites 3 and 4-II. These results demonstrated that the sites 3 and 4-II are major RNase III cleavage sites in vivo. Osmotic regulation of RNase III activity Previous studies have shown that, unlike other RcsB targets that are upregulated by high osmolarity through

the RcsB system, the induced expression of bdm by the RcsB system is not transient (Francez-Charlot et al., 2005). This observation was the basis for suspecting the existence of an unidentied mechanism that is responsible for the sustained induction of bdm expression by RcsBdependent osmoregulation. This notion prompted us to examine whether the maintenance of induced bdm expression is related to cellular RNase III activity. In order to monitor the ribonucleolytic activity of RNase III in cells under high osmolarity, we used an E. coli strain (KSC004)

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425

Regulation of bdm expression by RNase III 419

1 -50

100 150

1
IV III

50
I

II

200

H
14 10 nt nt 5 1 a b c d e f g h 24 i j 14
Fig. 4. cont.

136 nt 3 214-219 160

54-59 nt 4

59-64 nt

118 59~64 54-59

containing an RNase III target site in single copy of a pnp lacZ reporter gene fusion (Robert-Le Meur and Portier, 1992; Kim et al., 2008). It has been shown that RNase III cleaves the pnp untranslated leader, and consequently that b-galactosidase production from this fusion construct is increased approximately threefold in cells containing the rnc14 mutation, which abolishes RNase III expression (Takiff et al., 1989; Robert-Le Meur and Portier, 1992; Beran and Simons, 2001). The activity of the pnp lacZ reporter gene fusion in the KSC004 strain following an osmotic shift with 0.5 M NaCl was increased approximately twofold from 28 h following osmotic upshift compared with cells that were not treated with NaCl (Fig. 6A). This suggests that exposure of cells to high osmolarity resulted in downregulation of cellular RNase III activity, which, in turn, resulted in the decreased cleavage of tran-

scripts containing an RNase III-targeted site in pnp mRNA fused to lacZ. To eliminate a possibility that high osmolarity regulates some other process, such as transcription or translation of the pnp lacZ reporter used, we tested osmotic regulation of RNase III activity using another E. coli strain (KSC006) containing an single copy of a rnc lacZ reporter gene fusion (Matsunaga et al., 1996a; Kim et al., 2008). It has been shown that RNase III cleaves its own transcript, and consequently b-galactosidase production from this fusion construct is increased approximately ninefold in cells expressing non-functional RNase III (Matsunaga et al., 1996a,b). Analogous results were obtained from this experiment (Fig. 6B), indicating that RNase III activity is downregulated by osmotic stress. Decreased cellular RNase III activity was not associated with cellular concentrations of RNase III, as evalu-

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425

420 S-H. Sim et al.

A
pBDM3 min 0 bdm RNA M1 RNA
1 2 4

W3110 pBDM3 - A157T

8 0 1 2 4 8

sequencing

GAT C

pBDM3 - A157T

B
pBDM3

upregulated during cold shock (Kim et al., 2008). Cellular levels of YmdB in KSC004 were similar until 4 h and decreased at 8 h after osmotic shift. We think that the decreased RNase III activity observed in cells exposed to high NaCl was associated with other factors such as uncharacterized protein regulators of RNase III, which have been recently reported to exist (Kim et al., 2008). We further tested the requirement of downregulated RNase III activity to sustain high levels of bdm expression in cells under osmotic stress. For this, we utilized an E. coli strain with a chromosome that contains a transcriptional fusion between the bdm region and lacZ (lbdm6). The transcriptional fusion lbdm6 contains all the RNase III cleavage sites that were identied in the experiments described in Fig. 4. The activities of this fusion were monitored following an osmotic shift with 0.5 M NaCl in the presence of cellular concentrations 1 and 10 RNase III. The fusion was activated at a similar degree upon the osmotic shift as previously reported (Francez-Charlot et al., 2005). However, the activities of the fusion were decreased by approximately twofold when RNase III was 10 times overexpressed (Fig. 6D and E). These results show that the downregulation of RNase III activity is required to sustain the high levels of bdm mRNA induced by the RcsB system in cells during osmotic stress. Enhancement of biolm formation by induction of bdm expression It has been shown that bdm expression is upregulated in cells during osmotic stress (Weber and Jung, 2002; Cheung et al., 2003; Francez-Charlot et al., 2005) and altered in biolms (Prigent-Combaret et al., 1999), but its physiological relevance has not been characterized. We therefore designed experiments to characterize the relationship between bdm expression and biolm formation. The results showed a good correlation between bdm expression levels and enhancement of biolm formation. Biolm formation was enhanced when overexpression of bdm was induced adventitiously from a multicopy plasmid or endogenously by osmotic upshift, and was inhibited when bdm expression levels were decreased by RNase III overexpression (Fig. 6F). The degree of the enhanced formation of biolm was higher when bdm overexpression was adventitiously induced compared with that by osmotic shift. Analysis of bdm mRNA abundance showed a 2.7fold increase in the steady state level of bdm mRNA present in cells that adventitiously overexpressed bdm than in cells with an osmotic shift (Fig. 6F), indicating that the differences we observed in the degree of enhanced biolm formation were probably due to the different expression levels of bdm mRNA in these cells. The correlation coefficient between the relative amount of bdm mRNA and the amount of biolm formation was 0.94,

4-II

Fig. 5. Effects a nucleotide substitution (A157U) in the RNase III cleavage site 4-II on the bdm mRNA half-life and RNase III cleavage in vivo. A. Effects of A157U on bdm mRNA decay. Strains W3110 harbouring pBDM3 or pBDM3-A157U were grown at 37C to OD600 = 0.2 and transcription of bdm from the plasmids was induced by the addition of 0.1 mM IPTG for 2 h. RNA samples were prepared and analysed as described in the legend of Fig. 2C. B. Effects of A157U on bdm mRNA cleavage by RNase III in vivo. Total RNA was prepared from the cultures described above and analysed as described in the legend of Fig. 4F.

ated quantitatively by measuring cellular levels of RNase III protein using antibodies specic to RNase III in Western blot analysis (Fig. 6C). We further tested the requirement of downregulated RNase III activity for sustaining high levels of bdm mRNA was not associated with cellular levels of YmdB (Fig. 6C), a recently discovered protein inhibitor of RNase III that has been shown to be

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425

Regulation of bdm expression by RNase III 421

A
1200

D
-galactosidase activity (Miller units)
1000 800 600 400 200 0 1 2 3 4 5 6 7 8

-galactosidase activity (Miller units)

KSC004 (-NaCl) KSC004 (+0.5M NaCl)

12000 10000 8000 6000 4000 2000 0 1 2 3 4 5 6 7 8

bdm6+pPM30 (+0.5M NaCl) bdm6+pRNC3 (+0.5M NaCl)

Time (hr)

Time (hr)

B
500

E
-galactosidase activity (Miller units)
KSC006 (-NaCl) KSC006 (+0.5M NaCl) Plasmid Time (hr) S1 RNase III
300

pPM30
1 2 4 8 1

pRNC3
2 4 8

400

200

F
Biofilm formation (OD595)
100 0

0.7 0.6 0.5 0.4 0.3 0.2 0.1

Time (hr)

C
0.5M NaCl Time (hr) S1 RNase III YmdB
1 2

4 8 1 2

+
4 8

1 2 3 4 5 Strains Relative activity of 1.0 1.0 ~0.5 ~1.0 ~3.0 RNase III Relative amount of 0 1.0 0.0 2.9 0.1 7.8 0.0 5.7 0.1 bdm mRNA

Fig. 6. Downregulation of RNase III activity by high osmolarity and effect on biolm formation. A and B. Osmotic regulation of RNase III activity. E. coli strains KSC004 (A) and KSC006 (B) were grown in M63 supplemented with 0.4% glucose and either shocked at time zero with 0.5 M NaCl or left untreated. Cultures were withdrawn at the indicated time intervals and a b-galactosidase assay was performed. C. Western blot analysis of RNase III and YmdB. Total proteins were prepared from the KSC004 cultures grown as described in Fig. 6A, separated on 8% SDS-PAGE and immunoblotted with anti-RNase III, anti-YmdB and anti-S1 protein. The S1 protein was used to provide an internal standard to evaluate the amount of cell extract in each lane. D. Effects of RNase III overexpression on bdm expression in cells under osmotic stress. E. coli strain lbdm6 containing a single copy of a bdm lacZ reporter gene fusion was grown as described in (A), and a b-galactosidase assay was performed. E. Western blot analysis of RNase III. Total proteins were prepared from the cultures grown as described in Fig. 6D and immunoblotting was performed as described above. F. Effects of bdm overexpression on biolm formation. Strains used were: 1. W3110Dbdm plus pKAN6 and pTrc99A (no NaCl); 2. W3110 plus pKAN6 and pTrc99A (no NaCl); 3. W3110 plus pKAN6 and pTrc99A (0.5 M NaCl); 4. W3110 plus pKAN6 and pBDM3 (no NaCl); 5. W3110 plus pRNC1 and pBDM3 (no NaCl). Overexpression of bdm was endogenously (3, W3110 plus pKAN6 and pTrc99A) or adventitiously (4, W3110 plus pKAN6 and pBDM3) induced by an osmotic shift with 0.5 M NaCl or addition of 0.1 mM IPTG respectively. 0.1 mM IPTG and 0.1% arabinose were added to all the cultures (15). Relative activity of RNase III was estimated based on Fig. 6AD. The degree of biolm formation was quantied using the crystal violet staining method as described in the Experimental procedures section. Quantication of bdm mRNA abundance was measured using RT-PCR.
2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425

422 S-H. Sim et al.

which shows a strong interrelationship between them. These ndings suggest that bdm is involved in osmotic stress-induced formation of biolm.

Discussion
Genome-wide analyses of mRNA abundance at singlegene resolution identied 87 genes that were upregulated and 100 genes that were downregulated by increased cellular concentrations of RNase III. These genes are primarily involved in carbohydrate transport and metabolism, energy production and conversion, post-translational modication, protein turnover and chaperones, illustrating the effects of RNase III activity on a broad range of cellular physiological processes. Expression levels of these RNase III-dependent genes might be the consequence of an indirect effect of cellular RNase III concentration, such as regulation at the transcriptional level. However, the present study and other studies have shown that expression of at least some of these genes results from the direct action of RNase III on mRNA (Aristarkhov et al., 1996; Matsunaga et al., 1996a; Robert-Le Meur and Portier, 1992). In the case of adh expression, adh mRNA is processed in the 5-UTR by RNase III to yield translationally active mRNA, which becomes stable due to ribosomal protection from ribonucleases. We also found that the mRNA of some of upregulated genes is cleaved in the 5-UTR by RNase III to yield translationally active mRNA (S-H. Sim, E. Shin and K. Lee, in preparation). In contrast to mRNA species processed by RNase III, RNase III degrades bdm mRNA by cleaving it in several places, which are constituted by two RNase III cleavage motifs, one in the 5-UTR and the other in the coding region of the mRNA (Fig. 4). Analysis of cleavage products indicated that RNase III cleavage sites in the coding region are likely to be responsible for determining the rate of bdm mRNA degradation (Figs 4 and 5). Considering that RNase III is a doublestranded RNA-specic endonuclease and that these cleavage sites (3 and 4-II) are present in the doublestranded region of the bdm coding region, it seems that bdm mRNA forms an extensive secondary structure similar to the one shown in Fig. 4G as a result of poor translation, and consequently is subject to degradation by RNase III. A recent report also indicated that mRNA folding plays a predominant role in mRNA stability and translation efficiency (Kudla et al., 2009). Taken together, these observations imply that the abundance of a subset of mRNA species is directly controlled by RNase III. However, comparative analyses of predicted highly expressed genes (Karlin and Mrazek, 2000) and RNase III-dependent genes failed to show a correlation between protein expression levels and the degree of mRNA abundance that is controlled by RNase III (data not shown).

This may reect the complexity of the mechanisms that govern the modulation of RNase III activity upon each of the RNase III-targeted mRNA molecules. Multiple cisand/or trans-acting elements seem to be involved in determining which of the RNase III-targeted mRNA species is degraded or processed, as indicated in the present study. Among the genes downregulated by RNase III, we investigated the physiological importance of bdm downregulation by RNase III and identied an additional regulatory pathway mediated by modulation of RNase III activity during the RcsB-dependent adaptation of E. coli cells to high osmolarity. This novel pathway involves modulation of RNase III activity on degradation of bdm mRNA whose product enhances biolm formation. Involvement of bdm expression in biolm formation has been suspected, but not demonstrated until the present study. Homologues of Bdm are found in closely related bacterial species of E. coli including Shigella dysenteriae, Salmonella enterica ssp., Enterobacter sp. and Klebsiella pneumonia, thus indicating the existence of a conserved function of Bdm protein in these bacterial species. A recently discovered protein inhibitor of RNase III activity, YmdB, which is upregulated during cold shock (Kim et al., 2008), is not involved in osmoregulation of RNase III activity (Fig. 6C). We believe that at least one other unidentied trans-acting factor inhibits RNase III activity on bdm mRNA degradation under conditions of osmotic stress. This view is supported by the report of several different inhibitors of RNase III (Kim et al., 2008), whose identities are not yet described. Trans-acting factors that inhibit RNase III activity on bdm mRNA degradation can be experimentally identied by a genetic approach similar to that used by Kim et al. (2008). In the case of RNase E, protein inhibitors that differentially modulate the ribonucleolytic activity have been recently discovered (Lee et al., 2003; Gao et al., 2006). The present study demonstrates the ability of RNase III to promote the decay of bdm mRNA, allowing cells to rapidly adjust to environmental changes, and imply that RNase III ribonucleolytic activity is differentially regulated by molecular mechanisms that involve mRNA-specic cisand/or trans-acting factors.

Experimental procedures
Strains and Plasmids
E. coli strain HT115 (W3110 rnc-14::DTn10) was obtained from Dr D. L. Court. The N3433rnc strain was constructed from N3433 by phage P1-mediated transduction using HT115 as a donor strain. W3110Dbdm was constructed by deleting the open reading frame of bdm in the genomic DNA of W3110 using the procedure described by Datsenko and Wanner (2000). PCR primer were 5-bdm-D (5- AACCCCTAAATTAG

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425

Regulation of bdm expression by RNase III 423

GTTGCCGATCAAGCATAGCACCTTAGTGTAGGCTGGAGC TGCTTC) and 3-bdm-D (5- GCAGACACCATAAATACACA GACACGGAGAATCACTATGCATATGAATATCCTCCTTA), and pKD3 (Datsenko and Wanner, 2000) was used as a template. To construct pRNC1, the coding region of rnc was amplied using two primers, rnc-5 (5-AGAATTCATATGAACCCCA TCGTAATAA) and rnc-3 (5-CTCTAGATCATTCCAGC TCCAGTTTTTTCA), digested with NdeI and XbaI and ligated into pKAN6B-IF1 (Yeom et al., 2008). Plasmid pBDM3 was constructed by subcloning an NcoI and XbaI fragment encoding Bdm that was amplied using the primers bdm-UTR-F (5-ATCCATGGGCTTTATAAATCTGCGATCC) and bdm-R2 (5-CGTCTAGATTAAAGCGTAGGGTGCTGGCCAC) into pTrc99A. Plasmid pBDM3-A157T was constructed by subcloning an NcoI and XbaI fragment encoding Bdm that was amplied using overlap-extension PCR into pTrc99A. The primers used were bdm-UTR-F, bdm-R2 bdm +155R (5AGGATGTCGTTATCAGAAGCTTCAAC), and bdm-A157T-F (5-GTTGAAGCTTCTGATAACGACATCCTCTGTGATATCTA CCAGCAAACG). The pBRS1 plasmid that expresses the bdm cat fusion was constructed in multiple steps. To construct pBRS1, NcoI and NotI sites were created using the overlap-extension PCR method with following primers: bdm-reporter 1 (5-GC ATAGCGGCCGCTTTATAAATCTGCGATCCGTAG), bdmreporter 2 (5-GGTATATCCAGTGATTTTTTTCTCAAGCG TAGGGTGCTGGCCACTG), Eno3 (5-GAGAAAAAAAT CACTGGATA) and RMC-MscI (5-CCTTGTCGCCTTGC GTATAA). Two separate PCR products (PCRs 1 and 2) were obtained using primers, bdm-reporter 1/bdm-reporter 2 and Eno3/RMC-Msc I respectively, and the PCR products PCRs 1 and 2 were combined and amplied using two outside primers bdm-reporter 1 and RMC-Msc 1. The resulting PCR product was digested with NotI and NcoI and cloned into the pCAT924. Plasmid pCAT924 was constructed by self-ligating the BamHI fragment from pRNA122 (Lee et al., 1997; 2001). E. coli strains KSC004 (Robert-Le Meur and Portier, 1992; Kim et al., 2008) and KSC006 (Matsunaga et al., 1996a; Kim et al., 2008) were obtained from Dr Stanley N. Cohen. E. coli strain lbdm6 (Francez-Charlot et al., 2005) was obtained from Dr Kaymeuang Cam.

ditions in two replicate comparisons, selecting genes whose relative mRNA levels were changed twofold or more and further clustering them by the previously described method (Eisen et al., 1998).

Western blot analysis

Western blot analysis was carried out as described previously (Kime et al., 2008). Polyclonal antibodies to RNase III were obtained from rabbits inoculated with puried His-tagged RNase III as described (Amarasinghe et al., 2001). Polyclonal antibodies to YmdB were obtained from Dr Stanley N. Cohen. Specic proteins were imaged using VersaDoc 100 (Bio-Rad) and quantied by Quantity One (Bio-Rad).

RT-PCR
The procedure for RT-PCR analysis has previously been described (Yeom and Lee, 2006; Yeom et al., 2008). The following primers were used: 5-ATGTTTACTTATTA TCAGGCAG and 5-TTAAAGCGTAGGGTGCTGGCCAC for bdm, 5-ATGAAGGCAAAAGCGATATTAC and 5-TCAGGAA TCTGGCATGTTGTTG for mltD, 5-ATGATGAAGCG CAATATT and 5-TTAGAACTGGTAAACGAT for ompF, 5-ATGGCCCTGATTGTGGAA and 5-TTACAGTTCCA GTTCATG for ptsA and 5-ATGAACAATATGAACGTA and 5-TTAGTCTTTATCTGCCGG for rcsB.

Northern blot analysis

Total RNA samples were prepared from the cultures using an RNeasy mini prep kit (Qiagen) following 0, 2, 4 and 8 min after addition of rifampicin (200 mg per ml). Twenty micrograms of the total RNA sample was denatured at 70C for 10 min in an equal volume of formamide loading buffer and separated by electrophoresis on a 6% polyacrylamide gel containing 8 M urea. The procedure for Northern blot analysis has previously been described (Lee et al., 2002). The oligonucleotide probes used for probing M1 RNA and bdm mRNA were M1 (5-GCTCTCTGTTGCACTGGTCG) and bdm (5ATGTTTACTTATTATCAGGCAG) respectively.

Microarray procedures
Relative mRNA levels were determined by parallel twocolour hybridization to DNA oligonucleotide microarrays on glass slides, which have been produced and provided by the 21st Century Frontier Microbial Genomics and Application Center Program of the Korean Ministry of Science (http://www.microbe.re.kr/). Comparisons between paired cultures that expressed 0.1 versus 1.0 and 0.1 versus 10.0 RNase III proteins relative to the expression level of endogenous RNase III were performed directly. To identify genes whose mRNA abundance was changed due to the different concentrations of arabinose present in the cultures, comparisons between paired cultures of wild-type cells grown in the presence of 0% and 0.001% arabinose were also performed. Synthesis of cDNA and hybridization were performed by Digital Genomics (Seoul, Korea). We measured the relative mRNA abundance under appropriate con-

In vitro cleavage assay

His-tagged RNase III purication and cleavage assays were performed as previously described (Amarasinghe et al., 2001). One pmol of labelled RNA were incubated with 0.51 mg of puried RNase III in the presence of 0.25 mg ml-1 of yeast tRNA (Ambion) and 20 U of RNaseOUT (Invitrogen) in cleavage buffer (30 mM Tris-HCl, pH 7.9, 160 mM NaCl, 0.1 mM DTT, 0.1 mM EDTA pH 8.0). Cleavage reactions were initiated by adding 10 mM MgCl2 after 5 min of incubation at 37C. Samples were removed at time intervals and mixed with an equal volume of Gel Loading Buffer II (Ambion) containing 95% of formamide, 18 mM EDTA, 0.025% SDS, 0.025% xylene cyanol and 0.025% bromophenol blue. The samples were denatured at 65C for 10 min and separated on an 8% or 10% polyacrylamide gel containing 8 M urea and 1 TBE.

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425

424 S-H. Sim et al.

Primer extension analysis

In vitro cleaved RNA was puried by phenol extraction and ethanol precipitation, and hybridized with 5-32P-labelled primers. The following primers were used: bdm +20R (5GCCTGATAATAAGTAAACAT), bdm +135R (5-TTCAA CCCATTTGGTCAGCT) and bdm-R (5-TTAAAGCGT AGGGTGCTGGC). RNA and labelled primers were annealed at 65C for 10 min then slowly cooled down to 37C for 12 h, and extended at 37C for 1 h using AMV reverse transcriptase (New England Biolabs, USA). The extended fragments were separated on polyacrylamide gels as described above.

b-Galactosidase assay
b-Galactosidase activity in whole cells was determined as described previously (Miller, 1992).

Quantication of biolm formation

Biolm formation was measured by the ability of the cells to adhere to the wells of 96-well PVC microtiter plates (BD falcon) as previously described (Djordjevic et al., 2002). Overnight cultures were diluted in LB medium at OD600 = 0.1, 0.1 mM IPTG and/or 0.001% arabinose were added to induce transcription from plasmid-born promoters and cultured to OD600 = 0.70.8. For osmotic upshift, NaCl was added to a nal concentration of 0.5 M. The cultures were diluted 1:10 in minimal M9 medium containing 0.4% glucose, and 0.2 ml of the diluted cultures was transferred into PVC microtiter plate wells per strain. The plate was incubated at 30C overnight for biolm formation. After a 10 or 20 h incubation period, medium was removed from the well using micropipette. Plates were air-dried for 30 min, 20 ml of 1% crystal violet was added into each well. Plates were placed at room temperature for 20 min and each well was rinsed thoroughly with water followed by an addition of 200 ml of 95% ethanol to destain the wells. The absorbance of the crystal violet stained biolm was measured at 595 nm in a spectrophotometer.

Acknowledgements
We are grateful to Dr Allen W. Nicholson for helpful commentary. This work was supported by grants from National Research Foundation of Korea Grant funded by the Korean Government (2009-0065181), the 21C Frontier Microbial Genomics and Application Center Program of the Ministry of Education, Science and Technology, Republic of Korea, and the Pioneer Research Program for Converging Technology of the Ministry of Education, Science and Technology, Republic of Korea (M1071118001-08M1118-00110).

References
Amarasinghe, A.K., Calin-Jageman, I., Harmouch, A., Sun, W., and Nicholson, A.W. (2001) Escherichia coli ribonuclease III: affinity purication of hexahistidine-tagged enzyme and assays for substrate binding and cleavage. Methods Enzymol 342: 143158. Apirion, D. (1975) The fate of mRNA and rRNA in Escherichia coli. Brookhaven Symp Biol 26: 286306.

Aristarkhov, A., Mikulskis, A., Belasco, J.G., and Lin, E.C. (1996) Translation of the adhE transcript to produce ethanol dehydrogenase requires RNase III cleavage in Escherichia coli. J Bacteriol 178: 43274332. Bardwell, J.C., Regnier, P., Chen, S.M., Nakamura, Y., Grunberg-Manago, M., and Court, D.L. (1989) Autoregulation of RNase III operon by mRNA processing. EMBO J 8: 34013407. Beran, R.K., and Simons, R.W. (2001) Cold-temperature induction of Escherichia coli polynucleotide phosphorylase occurs by reversal of its autoregulation. Mol Microbiol 39: 112125. Bernstein, J.A., Lin, P.H., Cohen, S.N., and Lin-Chao, S. (2004) Global analysis of Escherichia coli RNA degradosome function using DNA microarrays. Proc Natl Acad Sci USA 101: 27582763. Bram, R.J., Young, R.A., and Steitz, J.A. (1980) The ribonuclease III site anking 23S sequences in the 30S ribosomal precursor RNA of E. coli. Cell 19: 393401. Brenner, E.A., Nota, N.R., and Frigerio, M.J. (1961) Staphylococcus in chronic osteomyelitis. Lysotyping, antibiogram and study of the related ora. Dia Med 33: 20772080. Carpousis, A.J. (2007) The RNA degradosome of Escherichia coli: an mRNA-degrading machine assembled on RNase E. Annu Rev Microbiol 61: 7187. Cheung, K.J., Badarinarayana, V., Selinger, D.W., Janse, D., and Church, G.M. (2003) A microarray-based antibiotic screen identies a regulatory role for supercoiling in the osmotic stress response of Escherichia coli. Genome Res 13: 206215. Court, D.L. (1993) RNA processing and degradation by RNase III. In Control of Messenger RNA Stability. Belasco, J. and Brawerman, G. (eds). New York: Academic Press, pp. 71116. Datsenko, K.A., and Wanner, B.L. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97: 66406645. Deana, A., Celesnik, H., and Belasco, J.G. (2008) The bacterial enzyme RppH triggers messenger RNA degradation by 5 pyrophosphate removal. Nature 451: 355358. Djordjevic, D., Wiedmann, M., and McLandsborough, L.A. (2002) Microtiter plate assay for assessment of Listeria monocytogenes biolm formation. Appl Environ Microbiol 68: 29502958. Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. (1998) Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA 95: 14863 14868. Francez-Charlot, A., Castanie-Cornet, M.P., Gutierrez, C., and Cam, K. (2005) Osmotic regulation of the Escherichia coli bdm (biolm-dependent modulation) gene by the RcsCDB His-Asp phosphorelay. J Bacteriol 187: 3873 3877. Gao, J., Lee, K., Zhao, M., Qiu, J., Zhan, X., Saxena, A., et al. (2006) Differential modulation of E. coli mRNA abundance by inhibitory proteins that alter the composition of the degradosome. Mol Microbiol 61: 394406. Gottesman, S., Trisler, P., and Torres-Cabassa, A. (1985) Regulation of capsular polysaccharide synthesis in Escherichia coli K-12: characterization of three regulatory genes. J Bacteriol 162: 11111119.

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425

Regulation of bdm expression by RNase III 425

Gros, F., Hiatt, H., Gilbert, W., Kurland, C.G., Risebrough, R.W., and Watson, J.D. (1961) Unstable ribonucleic acid revealed by pulse labelling of Escherichia coli. Nature 190: 581585. Hagege, J.M., and Cohen, S.N. (1997) A developmentally regulated Streptomyces endoribonuclease resembles ribonuclease E of Escherichia coli. Mol Microbiol 25: 1077 1090. Jain, C., Deana, A., and Belasco, J.G. (2002) Consequences of RNase E scarcity in Escherichia coli. Mol Microbiol 43: 10531064. Jaskiewicz, L., and Filipowicz, W. (2008) Role of Dicer in posttranscriptional RNA silencing. Curr Top Microbiol Immunol 320: 7797. Karlin, S., and Mrazek, J. (2000) Predicted highly expressed genes of diverse prokaryotic genomes. J Bacteriol 182: 52385250. Kim, K.S., Manasherob, R., and Cohen, S.N. (2008) YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity. Genes Dev 22: 34973508. Kime, L., Jourdan, S.S., and McDowall, K.J. (2008) Identifying and characterizing substrates of the RNase E/G family of enzymes. Methods Enzymol 447: 215241. Kole, R., and Altman, S. (1979) Reconstitution of RNase P activity from inactive RNA and protein. Proc Natl Acad Sci USA 76: 37953799. Kudla, G., Murray, A.W., Tollervey, D., and Plotkin, J.B. (2009) Coding-sequence determinants of gene expression in Escherichia coli. Science 324: 255258. Lee, K., Varma, S., SantaLucia, J., Jr and Cunningham, P.R. (1997) In vivo determination of RNA structure-function relationships: analysis of the 790 loop in ribosomal RNA. J Mol Biol 269: 732743. Lee, K., Holland-Staley, C.A., and Cunningham, P.R. (2001) Genetic approaches to studying protein synthesis: effects of mutations at y516 and A535 in Escherichia coli 16S rRNA. J Nutr 131: 2994S3004S. Lee, K., Bernstein, J.A., and Cohen, S.N. (2002) RNase G complementation of rne null mutation identies functional interrelationships with RNase E in Escherichia coli. Mol Microbiol 43: 14451456. Lee, K., Zhan, X., Gao, J., Qiu, J., Feng, Y., Meganathan, R., et al. (2003) RraA. a protein inhibitor of RNase E activity that globally modulates RNA abundance in E. coli. Cell 114: 623634. Lee, Y., Han, J., Yeom, K.H., Jin, H., and Kim, V.N. (2006) Drosha in primary microRNA processing. Cold Spring Harb Symp Quant Biol 71: 5157. Matsunaga, J., Dyer, M., Simons, E.L., and Simons, R.W. (1996a) Expression and regulation of the rnc and pdxJ operons of E. coli. Mol Microbiol 22: 977989. Matsunaga, J., Simons, E.L., and Simons, R.W. (1996b) RNase III autoregulation: structure and function of rncO, the posttranscriptional operator. RNA 2: 1228 1240. Miller, J.H. (1992) A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Nicholson, A.W. (1999) Function, mechanism and regulation

of bacterial ribonucleases. FEMS Microbiol Rev 23: 371 390. Prigent-Combaret, C., Vidal, O., Dorel, C., and Lejeune, P. (1999) Abiotic surface sensing and biolm-dependent regulation of gene expression in Escherichia coli. J Bacteriol 181: 59936002. Ramachandran, V., and Chen, X. (2008) Small RNA metabolism in Arabidopsis. Trends Plant Sci 13: 368374. Reed, R.E., Baer, M.F., Guerrier-Takada, C., Donis-Keller, H., and Altman, S. (1982) Nucleotide sequence of the gene encoding the RNA subunit (M1 RNA) of ribonuclease P from Escherichia coli. Cell 30: 627636. Regnier, P., and Portier, C. (1986) Initiation, attenuation and RNase III processing of transcripts from the Escherichia coli operon encoding ribosomal protein S15 and polynucleotide phosphorylase. J Mol Biol 187: 2332. Robert-Le Meur, M., and Portier, C. (1992) E. coli polynucleotide phosphorylase expression is autoregulated through an RNase III-dependent mechanism. EMBO J 11: 2633 2641. Robertson, H.D., Webster, R.E., and Zinder, N.D. (1968) Purication and properties of ribonuclease III from Escherichia coli. J Biol Chem 243: 8291. Shabala, L., Bowman, J., Brown, J., Ross, T., McMeekin, T., and Shabala, S. (2009) Ion transport and osmotic adjustment in Escherichia coli in response to ionic and non-ionic osmotica. Environ Microbiol 11: 137148. Shin, E., Go, H., Yeom, J.H., Won, M., Bae, J., Han, S.H., et al. (2008) Identication of amino acid residues in the catalytic domain of RNase E essential for survival of Escherichia coli: functional analysis of DNase I subdomain. Genetics 179: 18711879. Takiff, H.E., Chen, S.M., and Court, D.L. (1989) Genetic analysis of the rnc operon of Escherichia coli. J Bacteriol 171: 25812590. Weber, A., and Jung, K. (2002) Proling early osmostressdependent gene expression in Escherichia coli using DNA macroarrays. J Bacteriol 184: 55025507. Xiao, J., Feehery, C.E., Tzertzinis, G., and Maina, C.V. (2009) E. coli RNase III (E38A) generates discret-sized products from long dsRNA. RNA 15: 984991. Yeom, J.H., and Lee, K. (2006) RraA rescues Escherichia coli cells over-producing RNase E from growth arrest by modulating the ribonucleolytic activity. Biochem Biophys Res Commun 345: 13721376. Yeom, J.H., Go, H., Shin, E., Kim, H.L., Han, S.H., Moore, C.J., et al. (2008) Inhibitory effects of RraA and RraB on RNAse E-related enzymes imply conserved functions in the regulated enzymatic cleavage of RNA. FEMS Microbiol Lett 285: 1015.

Supporting information
Additional supporting information may be found in the online version of this article. Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

2009 The Authors Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 75, 413425