BIOL1133:Biological Sciences Laboratory Course Practical 1: DNA sequencing and analysis

Name: May,Chan Ka Ying(UID:3035001211) Group:1 Demonstrator: Eric Date of experiment:19-1-2012 Abstract The aim of the experiment is to identify an unknown gene which was cloned into a vector plasmid by using automated sequencing with dye-terminators and BLAST. In the experiment, 755 bases were identified to be the cloned DNA out of 851 bases which were obtained from the chromatogram. The BLAST analysis indicated the gene inserted was most likely Kruppel-like factor 4 (gut).(64 words) Introduction DNA sequencing is the process of finding out the order of nucleotides in a DNA fragments. Many different DNA sequencing methods have been developed since the 1970s. For example, in 1977, Maxam and Gilbert developed Chemical method to sequence DNA. In this method, the single-stranded DNA is first labeled with radioactive phosphate at the 5' end. Then the DNA is cleaved by base-specific chemical reaction and the DNA fragments without radioactive-phosphate label are removed. After reaction, DNA fragments are separated by electrophoresis. X-ray film is developed to make the sequence readable. Moreover, Sanger established Dideoxy method using dideoxyribonucleotides(ddNTPs) for DNA sequencing. In this method, four separated reactions are used to sequence one sample. DNA template, radioactively labeled primer, DNA polymerase, four kinds of deoxyribonucleotides (dATP, dTTP, dCTP and dGTP) and small amount of one ddNTPs(ddATP, ddTTP, ddCTP or ddGTP)are added in each reaction. After reactions, electrophoresis is carried out for four sets of product in four parallel lanes of gel. X-ray film is made to determine the DNA sequence. Automated sequencing with dye-terminators, which is carried out in this experiment, is also a DNA sequencing technique. Primer, DNA polymerase, four kinds of dNTPs and small amount of four fluorescently-labeled ddNTPs are added in a single-stranded DNA sample. The reaction takes place in PCR machine to carry out cycle sequencing reaction. The PCR products are purified using ethanol/EDTA precipitation method and electrophoresis is performed. A chromatogram is obtained and DNA sequence can be read. Sequencing by synthesis(SBS technology) will probably be then next generation sequencing technique which includes 454 sequencing(large-scale parallel pyrosequencing) ,Solexa sequencing, SOLiD and Helicos. Pyrosequencing is a high throughput sequencing and light produced in the reaction can be detected whenever a nucleotide is incorporated. The above mentioned sequencing techniques can enhance the development of new knowledge. For instance, genetic diseases can be identified in advanced through DNA sequencing and specific treatments can be developed. Methods Please refer to the lab manual, except for the following: Plasmid DNA No.: 9 Results and discussion Figure 1:The chromatogram of the DNA sequence

Figure 2:The identified gene-Mus musculus Krueppel-like factor 4 mRNA, complete cds
Length=1452 Score = 409 bits (221), Expect = 5e-111 Identities = 221/221 (100%), Gaps = 0/221 (0%) Strand=Plus/Plus Query Sbjct Query Sbjct Query Sbjct Query Sbjct 1 298 61 358 121 418 181 478 CTCCTGGACCTAGACTTTATCCTTTCCAACTCGCTAACCCACCAGGAATCGGTGGCCGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTCCTGGACCTAGACTTTATCCTTTCCAACTCGCTAACCCACCAGGAATCGGTGGCCGCC ACCGTGACCACCTCGGCGTCAGCTTCATCCTCGTCTTCCCCAGCGAGCAGCGGCCCTGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACCGTGACCACCTCGGCGTCAGCTTCATCCTCGTCTTCCCCAGCGAGCAGCGGCCCTGCC AGCGCGCCCTCCACCTGCAGCTTCAGCTATCCGATCCGGGCCGGGGGTGACCCGGGCGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGCGCGCCCTCCACCTGCAGCTTCAGCTATCCGATCCGGGCCGGGGGTGACCCGGGCGTG GCTGCCAGCAACACAGGTGGAGGGCTCCTCTACAGCCGAGA ||||||||||||||||||||||||||||||||||||||||| GCTGCCAGCAACACAGGTGGAGGGCTCCTCTACAGCCGAGA 221 518 60 357 120 417 180 477

Interpretation of chromatogram (Figure 1) The sequencing reaction was quite successful despite the problems which will be discussed below. There was a complete signal lost of the first 40 bases while the signal was weak and not stable for bases no.40 to 180. Therefore, the sequence of the first 180 bases may not be accurate. However, it would not affect much to identify the gene as there was no restriction site in that region according to the gene map of the vector(Please refer to the lab manual). From bases no.180 to 650, signal were strong and peaks were well-defined without much overlapping. The sequence obtained in this region should be reliable so that bases no.430 to 650 was selected for BLAST(raw sequence please refer to Appendix I). It was determined that the gene was cloned in the restriction site for AfI II. After deleting the vector backbone, 755 bases were got. After bases no.650, more peaks joined together and base spacing was not even at all. The sequence in this region was not suitable to be used for BLAST as it would increase errors. Besides, there was noise throughout the whole sequence but it was too low to affect the results, except for the first 40 bases with weak signal as the noise might overlook them. Many possibly match DNA sequence were demonstrated by BLAST and the most likely match one is Mus musculus Krueppel-like factor 4 mRNA, complete cds.(Please refer to Appendix II) Table 1:Brief information of the most likely match DNA sequence

Definition

Mus musculus Krueppel-like factor 4 mRNA, complete cds. JF277566 1 326375397 Mus musculus (house mouse) linear

Accession number Version number GI number Source Structure

Accession number is a number that unique and fix to every gene when it was discovered or predicted. Version number can show how many times the information of the gene has been modified. GI number is another number with longer history and has similar function to accession number, but the whole number will change when the gene is updated to new version(NCBI 2004). Table 2: Brief information of gene identified Official Full Name Gene type

Kruppel-like factor 4 (gut) Protein coding

Gene ID 16600 Kruppel-like factor 4 (gut) is a transcription factor that can acts as both activator and repressor that presents in Mus musculus (house mouse). The gene is highly expressed in thymocytes and mature T cells(An et.al 2011). It also help to maintain embryonic stem cells and prevent their differentiation . It also controls synthesis of thyrotropin-releasing hormone in hypothalamus development(Charli et.al 2011). It binds the 5'-CACCC-3' sequence and promotor region of its own gene to activate transcription. For tissue specificity, the highest expression is in the colon while the lower levels are in testis, lung and small intestine(UniProtKB 2011). The problem of the sequencing reaction was the noise throughout the chromatogram. The sources would be the present of contaminents such as unincorporated ddNTPs, remaining PCR primers and ethanol/EDTA. Washing of pellet can be carried out twice for longer time and complete removal of ethanol/EDTA should be done to avoid the problem. There is precaution that should be noticed to minimize errors and avoid failure of the experiment. Extra attention should be paid when removing the supernatant to isolate and purify DNA after centrifugation. As the pellet formed at the bottom of the tip may be to small to see in naked eyes, removal of supernatant should be carried out slowly and carefully to avoid disturbing and discarding of the pellet otherwise it might lead to negative result. Conclusion The gene inserted into the plasmid no.9 is most likely Kruppel-like factor 4 (gut) with 755 bases. References An et.al,2011. Krppel-like factor 4 (KLF4) directly regulates proliferation in thymocyte development and IL-17 expression during Th17 differentiation.[cited 31-12012]http://www.ncbi.nlm.nih.gov/pubmed/21685331

Charli et.al,2011.The Krppel-like factor 4 controls biosynthesis of thyrotropin-releasing hormone during hypothalamus development.[cited 31-1-2012] .http://www.ncbi.nlm.nih.gov/pubmed/21182892 NCBI,2004. Sequence Identifiers: A Historical Note [cited 31-1-2012] http://www.ncbi.nlm.nih.gov/Sitemap/sequenceIDs.html UniProtKB,2011.Q60793 (KLF4_MOUSE) [cited 31-1-2012[http://www.uniprot.org/uniprot/q60793