The Plant Journal (2002) 32, 447456

Ozone-induced ethylene production is dependent on salicylic acid, and both salicylic acid and ethylene act in concert to regulate ozone-induced cell death
Mulpuri V. Rao1, Hyung-il Lee2,y and Keith R. Davis1, 1 Paradigm Genetics, Inc., 108 Alexander Drive, Research Triangle Park, NC 27709, and 2 Biotechnology Center, Cook College-Foran Hall, Rutgers University, New Brunswick, NJ 08901, USA
Received 12 February 2002; revised 17 June 2002; accepted 9 July 2002. For correspondence (fax 919 485 8789; e-mail kdavis@paragen.com). y Present address: Sunol Molecular Corporation, 2810 North Commerce Parkway, Mirama, Florida 33025, USA.

Summary Ethylene is known to inuence plant defense responses including cell death in response to both biotic and abiotic stress factors. However, whether ethylene acts alone or in conjunction with other signaling pathways is not clearly understood. Ethylene overproducer mutants, eto1 and eto3, produced high levels of ethylene and developed necrotic lesions in response to an acute O3 exposure that does not induce lesions in O3-tolerant wild-type Col-0 plants. Treatment of plants with ethylene inhibitors completely blocked O3induced ethylene production and partially attenuated O3-induced cell death. Analyses of the responses of molecular markers of specic signaling pathways indicated a relationship between salicylic acid (SA)- and ethylene-signaling pathways and O3 sensitivity. Both eto1 and eto3 plants constitutively accumulated threefold higher levels of total SA and exhibited a rapid increase in free SA and ethylene levels prior to lesion formation in response to O3 exposure. SA pre-treatments increased O3 sensitivity of Col-0, suggesting that constitutive high SA levels prime leaf tissue to exhibit increased magnitude of O3-induced cell death. NahG and npr1 plants compromised in SA signaling failed to produce ethylene in response to O3 and other stress factors suggesting that SA is required for stress-induced ethylene production. Furthermore, NahG expression in the dominant eto3 mutant attenuated ethylene-dependent PR4 expression and rescued the O3-induced HR (hypersensitive response) cell death phenotype exhibited by eto3 plants. Our results suggest that both SA and ethylene act in concert to inuence cell death in O3-sensitive genotypes, and that O3-induced ethylene production is dependent on SA. Keywords: active oxygen species, cell death, cross talk, ethylene, ozone, salicylic acid.

Introduction Rapid changes in urbanization and human activities during the 21st century have substantially increased tropospheric O3 concentrations to levels that threaten cultivated crop and forest species (Heath and Taylor, 1997). Numerous laboratory and eld studies have demonstrated that acute O3 exposure can cause signicant reductions in plant growth and induce necrotic lesions, reminiscent of lesions activated during plantpathogen interactions (reviewed in Rao et al. 2000a). Historically, O3 is believed to affect plant metabolism by oxidizing cellular membranes (Heath and Taylor, 1997; Mudd, 1997; Rao et al. 2000a); however, recent studies suggest that O3 acts by inducing a hypersensitive
2002 Blackwell Publishing Ltd

response (HR) similar to that induced by pathogens and other stress factors (Rao et al., 2000a; Sandermann et al., 1998; Sharma et al., 1996). Activation of an oxidative burst is one of the earliest responses of plants to pathogen infection and is an essential component of pathogen-induced HR cell death (Jabs, 1999; Lamb and Dixon, 1997). Similar to plant pathogens, O3 has been shown to activate an oxidative burst and the concomitant accumulation of active oxygen species (AOS) such as superoxide radical (O2) and hydrogen peroxide (H2O2) (Overmyer et al., 2000; Pellinen et al., 1999; Rao and Davis, 1999; Rao et al. 2000b; Schraudner et al., 1998). 447

448 Mulpuri V. Rao et al. O3-induced AOS are believed to activate distinct signaling pathways dependent on salicylic acid (SA), jasmonic acid (JA), and ethylene, and induce a wide array of defense reactions including HR cell death (Overmyer et al., 2000; Rao et al., 2000a,b; Sandermann et al., 1998; Sharma et al., 1996). Although SA has been shown to be a major regulator of plant defense reactions including cell death, other studies suggest that antagonistic and/or synergistic interactions between SA-, JA-, and/or ethylene-signaling pathways inuence plant cell death (Asai et al., 2000; Overmyer et al., 2000; Rao et al., 2000b). Plants produce ethylene in response to several biotic and abiotic stress factors and the involvement of ethylene in wide range of stress responses led to the speculation that ethylene is a major regulator of plant defense responses including cell death (Johnson and Ecker, 1998; Kieber, 1997). Ethylene has been shown to modulate plant cell death induced by pathogens (Moore et al., 1999; ODonnell et al., 2001), O3 exposure (Bae et al., 1996; Overmyer et al., 2000; Tuomainen et al., 1997), hypoxia (He et al., 1996), and organ senescence (Quirino et al., 2000). O3 exposure induces genes involved in ethylene biosynthesis (Miller et al., 1999; Overmyer et al., 2000; Tuomainen et al., 1997; Vahala et al., 1998) and the aminocyclopropane-1-carboxylic acid synthase-mediated conversion of S-adenosyl-L-methionine to 1-aminocyclopropane1-carboxylic acid is the rate limiting step of ethylene biosynthesis in O3-exposed plants (Tuomainen et al., 1997). Although several studies support a casual relationship between ethylene levels and plant sensitivity to O3 (Mehlhorn and Wellburn, 1987; Wellburn and Wellburn, 1996), it is not clear whether ethylene acts alone or in conjunction with other signaling pathways. In plants, two major forms of cell death have been characterized in detail, HR cell death and senescence (Quirino et al., 2000). Because both HR and senescence are genetically dened cell death programs and bear several similarities, it has been speculated that common steps might exist for the induction and/or execution of these two processes (Pontier et al., 1999; Quirino et al., 2000). Since O3 induces both ethylene and SA biosynthesis (Miller et al., 1999; Overmyer et al., 2000; Rao et al., 2000a; Vahala et al., 1998), we speculated that a synergistic interaction between SA and ethylene may modulate the magnitude of lesion formation in response to O3 exposure. Therefore, we have sought to investigate the relationship between SA- and ethylene-signaling pathways in Arabidopsis plants exposed to O3. Here, we report that functional SA-signaling pathways are required for O3-induced ethylene biosynthesis and that both SA and ethylene act in concert to modulate the magnitude of O3-induced HR-like cell death. Furthermore, we also demonstrate that the previously described ethylene overproducer (eto) mutants have an altered stress-ethylene phenotype at postseedling stages of development. Results and discussion Over the past several decades, studies have documented a casual relationship between high levels of ethylene and plant sensitivity to O3 (Mehlhorn and Wellburn, 1987; Wellburn and Wellburn, 1996). To further investigate the role of ethylene and plant sensitivity to O3, we used Arabidopsis mutants, eto1 and eto3. Etiolated seedlings of these mutants have been shown to overproduce ethylene (Guzman and Ecker, 1990; Kieber et al., 1993). As shown in Figure 1(a), eto1 and eto3 plants exposed to 300 ppb O3 for 6 h rapidly developed necrotic lesions within 24 h after the initiation of O3 exposure. No major changes were observed in wild-type Col-0 plants exposed to O3. The observations that untreated soil-grown eto1 and eto3 plants produce wild-type levels of ethylene (Woeste et al., 1999) prompted us to investigate whether the O3 sensitivity exhibited by treated eto plants is related to increased ethylene biosynthesis. Control (untreated) plants of Col-0, eto1, eto3 produced similar levels of ethylene. However, compared to untreated control plants, ethylene levels in Col-0 plants exposed to O3 for 3 h increased by ninefold, whereas the ethylene levels in eto1 and eto3 increased by 26- and 27-fold, respectively (Figure 1b). These ndings demonstrate a strong correlation between high levels of ethylene production and plant sensitivity to O3. In addition, these results demonstrate, for the rst time, that the eto1 and eto3 mutants grown in soil under light conditions overproduce ethylene in response to stress conditions. Treatment of plants with inhibitors of ethylene perception or biosynthesis attenuated the magnitude of O3induced lesions in various plant species (Bae et al., 1996; Tuomainen et al., 1997). Therefore, we used two inhibitors of ethylene biosynthesis, aminoethoxyvinyl-glycine (AVG) and cobalt chloride (CoCl2) to verify whether high levels of ethylene produced by eto1 and eto3 plants in response to O3 exposure are important for O3-induced cell death. Both AVG and CoCl2 have been shown to inhibit ethylene biosynthesis by inactivating the activities of ACC synthase and ACC oxidase, respectively (Kende, 1993; Yang and Hoffman, 1984). A previously described conductivity assay was used to obtain a more quantitative measure of the decrease in cell death exhibited by plants treated with the inhibitors of ethylene biosynthesis (Rao and Davis, 1999). Pre-treatment of plants with 1 mM AVG or 1 mM CoCl2, 20 h before exposure to O3, attenuated O3-induced ethylene production by >90% in both eto1 and eto3 plants compared to untreated plants exposed to O3 (Figure 2). O3-induced ion leakage of eto1 and eto3 plants pre-treated with ethylene inhibitors was reduced by 2530% compared to untreated plants exposed to O3. No major changes were observed in the ion leakage of wild-type Col-0 plants irrespective of the treatment (Figure 2). These results demonstrate that
Blackwell Publishing Ltd, The Plant Journal, (2002), 32, 447456

Ozone-induced ethylene production

449

Figure 1. Ozone-induced necrotic lesions (a) and ethylene production (b) in Arabidopsis genotypes. (a) All experiments were conducted three times with identical results and a representative example of each genotype from the same experiment is shown. Pictures were taken 24 h after initiation of O3 exposure. (b) Ethylene measurements were performed by removing plants from O3 chamber at the indicated time intervals and incubating in air-tight glass containers for 2 h. About 1 ml head space was removed in duplicate and used for ethylene measurements. Plants maintained in O3-free air served as controls. All experiments were repeated with two replicates and the data from one representative experiment is presented. Error bars indicate SD.

increased ethylene production is at least partially responsible for O3-induced cell death. Earlier studies demonstrated that the antagonistic action of SA- and JA- signaling pathways regulate the magnitude of O3-induced HR cell death (Rao and Davis, 1999; Rao et al. 2000b), while other studies showed that JA and ethylene act synergistically in inducing plant defense responses (Maleck and Dietrich, 1999; Pieterse and Van Loon, 1999; Thomma et al., 1998). Therefore, we investigated whether perturbations in SA- and/or JA-signaling pathways may have predisposed eto1 and eto3 plants to produce high levels of ethylene production by monitoring the responses of molecular markers of SA-, ethylene-, and JA-signaling pathways. No major changes were observed in the
Blackwell Publishing Ltd, The Plant Journal, (2002), 32, 447456

steady-state levels of SA-dependent PR1 (Sharma et al., 1996), ethylene-dependent PR4 (Lawton et al., 1994), and JA-dependent PDF1.2 mRNA transcripts (Penninckx et al., 1996) between control plants of all genotypes. However, a 6-h O3 exposure induced an increase the transcript levels of PR1 and PR4 in eto1 and eto3 plants to a greater magnitude, compared to wild-type Col-0 plants exposed to O3 (Figure 3a). In contrast, exposure of Col-0, eto1, and eto3 plants to O3 induced the expression of JA-dependent PDF1.2 transcripts (Figure 3a) to similar levels in all the genotypes. Although O3 exposure caused an increase in JA biosynthesis, the magnitude of induction was similar in Col-0, eto1, and eto3 plants (15.8-, 16.5-, and 17.2-fold, respectively, compared to control plants; data not shown), suggesting

450 Mulpuri V. Rao et al.

Figure 2. The effect of ethylene inhibitors on O3-induced ethylene production and cell death in Arabidopsis genotypes. Ethylene measurements were performed on plants exposed to O3 for 3 h as described in Figure 1(b). Ion leakage was estimated by punching leaf discs from plants that were allowed to recover for 2 h in O3-free air after the completion of a 6-h O3 exposure. A total of six leaf discs, 1 cm in diameter, were excised from third and fourth rosette leaves of six different plants and incubated in 5 ml of water for 6 h at room temperature, prior to measuring the conductivity. Mean values marked with asterisk are significantly different compared to their respective control plants (P < 0.05).

that O3-induced changes in JA-dependent molecular marker (PDF1.2) is reective of changes in JA signaling. These results suggest that the O3 sensitivity of eto1 and eto3 plants is associated with the hyperinduction of both SAand ethylene-signaling pathways, and independent of changes in JA signaling (Figure 3a). Since ethylene has been shown to increase plant sensitivity to SA (Lawton et al., 1994), we tested whether the signicant induction of PR1 transcripts observed in eto1 and eto3 plants exposed to O3 is related to increased SA biosynthesis and/or to increased plant sensitivity to SA. Control plants of both eto1 and eto3 mutants accumulated free and total SA levels that are greater by 50% and threefold, respectively, compared to wild-type Col-0 (Figure 3b). Further, a 6-h O3 exposure increased free SA levels of Col-0, eto1, and eto3 plants by 2.5-, 5-, and 6.4-fold, respectively, compared to control plants. Although the magnitude of O3induced increase in total SA content was almost identical ($threefold) in all three genotypes, the absolute amounts of total SA in eto1 and eto3 plants was signicantly greater than the levels detected in Col-0 plants (Figure 3b). These ndings suggest that the hyperinduction of PR1 transcripts observed in eto mutants exposed to O3 is related to increased SA biosynthesis. This conclusion is supported by observations that pre-treatment of plants with 1 mM

Figure 3. Ozone-induced changes in defense gene expression (a) and SA (b) in Arabidopsis genotypes. (a) Rosette leaves harvested and the RNA blots were hybridized with the probes indicated on the left of the figure. Hybridized filters were exposed to Phosphorimager screens (Molecular Dynamics, Sunnyvale, CA, USA) and the signal intensity was quantified using Molecular Dynamics ImagQuant Software. The data shown is corrected for RNA loading differences determined by re-probing the blots with a control 28S ribosomal gene (Rao and Davis, 1999). The experiments were repeated with similar results and the relative counts from a representative experiment are presented. (b) Whole rosette leaves were harvested and used for free and total SA measurements. The data shown are the averages of two independent experiments with two replicates in each and represent the mean SD. Mean values with same letter are not significantly different (P < 0.05).

Blackwell Publishing Ltd, The Plant Journal, (2002), 32, 447456

Ozone-induced ethylene production AVG did not signicantly alter the magnitude of O3-induced PR1 transcripts in Col-0, eto1, and eto3 plants (data not shown). Measurements of SA levels presented indicates a relationship between high levels of SA and increased sensitivity of eto1 and eto3 mutants to O3 (Figure 3b). Studies with various cell death mutants have demonstrated that constitutive high SA levels induce HR-related defense responses including lesions (Dangl et al., 1996; Greenberg et al., 2000; Rate et al., 1999). Further, pre-existing SA levels have also been shown to potentiate plant defense responses and cell death in response to elicitor or pathogen treatments (Draper, 1997; Shirasu et al., 1997). Therefore, we explored whether (i) high levels of SA detected in eto1 and eto3 plants may have contributed to the increased cell death in these plants and (ii) pre-treatment of O3-tolerant wild-type Col-0 plants with SA prior to O3 exposure would increase their sensitivity. Leaves of Col-0, eto1, and eto3 plants grown under standard conditions stained with trypan blue: a dye that stain dead cells not visible to the naked eye (Weigel and Glazebrook, 2002) did not reveal evidence for dead cells (data not shown). These results suggest that SA levels detected in eto mutants are not sufcient to induce cell death under non-stress conditions. However, treatment of Col-0 plants with SA prior to O3 exposure increased the magnitude of O3-induced cell death in a dose-dependent manner (Figure 4). Pre-treatment of Col-0 plants with 0.1 and 0.25 mM SA increased O3-induced ion leakage by 82 and 166% compared to a 22% induction observed in plants exposed to O3 alone. In contrast, no major changes were

451

observed in the magnitude of O3-induced ion leakage of NahG plants pre-treated with SA compared to plants exposed to O3 alone (Figure 4). These ndings support the hypothesis that pre-existing SA levels potentiate the magnitude of O3-induced cell death. The discovery that both high levels of SA and ethylene are associated with O3-sensitive phenotype exhibited by eto1 and eto3 led to the question of whether O3-induced ethylene is dependent on SA or vice versa. Treatment of plants with ethylene alone failed to induce SA-dependent PR1 transcripts (Lawton et al., 1994), while control plants of both eto1 and eto3 accumulated higher levels of SA and produced high levels of ethylene in response to a O3 exposure (Figures 13). These observations suggest that O3-induced ethylene production may be SA-dependent. To test this possibility, we used transgenic Col-0 expressing the bacterial salicylate hydroxylase gene (NahG) that converts SA to catechol and an Arabidopsis npr1 mutant blocked in SA-dependent systemic acquired resistance. In contrast to Col-0 plants, both NahG and npr1 plants failed to exhibit increased ethylene production in response to an O3 exposure (Figure 5a). Compared to untreated plants, a 3-h O3 exposure increased ethylene levels of Col-0 by eightfold, while no signicant changes were observed in NahG plants. Exposure of npr1 plants to O3 for 3 h increased ethylene levels by 86% compared to control plants. These results

Figure 4. SA pre-treatment increases the magnitude of O3-induced cell death. Plants were treated with 0.1 and 0.25 mM SA 24 h prior to O3 exposure and exposed to a single dose of 300 ppb O3 for 6 h. Ion leakage was estimated as described in the legend of Figure 2. Mean values marked with asterisk are significantly different compared to their respective control plants (P < 0.05).

Figure 5. SA is required for stress-induced ethylene production in Arabidopsis exposed to O3 (a), drought and paraquat (b). (a) At indicated intervals, plants were removed from O3 chamber and ethylene levels were measured as described in Figure 1(b). (b) Plants exposed to drought and paraquat were used for ethylene measurements as described for Figure 1(b). All experiments were repeated with two replicates and the data from one representative experiment is presented. Error bars indicate SD.

Blackwell Publishing Ltd, The Plant Journal, (2002), 32, 447456

452 Mulpuri V. Rao et al. suggest that O3-induced ethylene production is dependent on a functional SA-signaling pathway. Several plant species have been shown to produce ethylene in response to various stress factors (Johnson and Ecker, 1998; Kieber, 1997). Hence, we tested whether there is a SA requirement for ethylene production induced by other stress factors such as drought and paraquat treatments. Neither treatment induced visible damage. Exposure of plants to water decits for 6 days induced ethylene levels in Col-0 and eto3 by 2.6- and 5.5-fold, respectively, while paraquat treatments for 24 h induced ethylene levels in Col-0 and eto3 plants by 2.1- and 6.4-fold, respectively, compared to control plants. Neither treatment induced ethylene production in NahG plants (Figure 5b) suggesting that SA is required for increased ethylene production by these two stresses. The observations that SA pre-treatment increased O3 sensitivity of Col-0 plants (Figure 4) and that SA is required for stress-induced ethylene production (Figure 5) led us to test whether the modestly higher SA levels detected in control eto3 plants may have primed leaf tissue to hyperinduce ethylene in response to a O3 exposure. Double mutants were generated by crossing eto3 plants with pollen from Col-0:NahG plants. Since both the eto3 allele and NahG transgene act as dominant loci, F1 progeny were used for most of these experiments (Figure 6). As shown in Figure 6(b), NahG expression in Col-0 and eto3 plants decreased the O3-induced increases in ethylene-dependent PR4 transcripts by 7581% compared with the levels detected in Col-0 and eto3 plants exposed to O3. The success of the genetic cross was conrmed by monitoring the strong suppression in O3-induced, SA-dependent PR1 transcripts (Figure 6a) and the expression of NahG transcripts (data not shown). Further, expression of NahG in a background containing dominant mutant allele of eto3 strongly attenuated O3-induced HR lesions (data not shown). Expression of NahG in the dominant eto3 mutant background rendered a Col-0:NahG phenotype in response to O3 exposure that is well characterized by the absence of HR-related defense gene expression and the development of small, slower developing lesions that are distinct from HR lesions (Rao and Davis, 1999). These results were further conrmed with F2 plants homozygous for both the NahG transgene and the eto3 mutant allele (data not shown), suggesting that accumulation of SA is epistatic to stressinduced ethylene production in Arabidopsis. Over the past several decades, ethylene has been shown to regulate many of the plant developmental and stress responses including cell death (He et al., 1996; Kieber, 1997; Moore et al., 1999; Pell et al., 1997; Wellburn and Wellburn, 1996). Although plants produce ethylene in response to O3 exposure, its precise role in regulating O3-induced responses is not clearly understood. Historically, ethylene is believed to react with gaseous O3 to form cell-damaging AOS and aldehydes (Elstner et al., 1985); however, recent studies suggest a regulatory role for ethylene in modulating O3-induced lesions. Firstly, a recent survey of various plant species indicated a relationship between O3 sensitivity and O3-induced ethylene production (Wellburn and Wellburn, 1996). Secondly, inhibition of ethylene production attenuated the magnitude of O3-induced cell death in a wide variety of plant species (Bae et al., 1996; Overmyer et al., 2000; Tuomainen et al., 1997). Thirdly, ethylene-insensitive (ein2) mutant plants exhibited reduced damage in response to O3 exposure even under those conditions that induced cell death in O3-tolerant Col-0 (Overmyer et al., 2000). Studies involving various cell death mutants indicated that three distinct processes regulate cell death in plants: lesion initiation, propagation, and containment (Dangl et al., 1996; Greenberg et al., 2000; Maleck and Dietrich, 1999; Rate et al., 1999; Yu et al., 1998). Several signaling molecules have been proposed to act either synergistically or antagonistically to regulate the kinetics of lesion initiation, propagation, and containment. Among them, SA, JA, and ethylene have received wide attention as global regulators of plant defense responses including cell death (Dong, 1998; Maleck and Dietrich, 1999). Studies with mutants defective in SA signaling demonstrated a central role for SA in initiating lesions in response to O3 exposure (Rao and Davis, 1999; Rao et al., 2000b), while studies with rcd1 and ein2 plants exposed to O3 have demonstrated a specic role
Blackwell Publishing Ltd, The Plant Journal, (2002), 32, 447456

Figure 6. NahG expression attenuates O3-induced expression of SA-dependent PR1 transcripts (a) and ethylene-dependent PR4 transcripts (b) in Arabidopsis. Rosette leaves harvested and the RNA blots were hybridized with the probes indicated on the left of the figure as described in Figure 3(a). The experiment was repeated twice with similar results and the relative counts from a representative experiment are presented.

Ozone-induced ethylene production for ethylene in lesion propagation by promoting superoxide radical production (Overmyer et al., 2000). Expression of ethylene insensitivity (ein2) attenuated lesion propagation in rcd1 mutant without altering lesion initiation kinetics, suggesting that both lesion initiation and propagation are two distinct processes. Exposure of jar1, a JA-insensitive mutant, and fad3/7/8, a mutant blocked in JA biosynthesis, to acute O3 rapidly developed lesions (Rao et al., 2000b). Further, treatment of plants with Me-JA attenuated O3-induced, SA-dependent cell death in an O3-sensitive ecotype Cvi-0 (Rao et al. 2000b), and O3-induced, ethylene-dependent lesion propagation in an O3-sensitive rcd1 mutant (Overmyer et al., 2000) suggest that JA-signaling pathways play an important role in lesion containment processes. Therefore, it appears that many O3induced defense reactions including cell death are dependent on the plants ability to respond to SA, JA, and ethylene and the nature and the nal response depend on the extent of cross-talk that exists between these molecules (Overmyer et al., 2000; Rao et al., 2000b). In the present report, we demonstrated a role for SA in not only initiating but also in propagating lesions by controlling ethylene production, thus dening an increased level of complexity in this cell death pathway. Control plants of eto1 and eto3 accumulated moderate levels of SA, hyperinduced ethylene production, and defense gene expression and developed lesions in response to acute O3 exposure (Figures 1 and 3). SA pre-treatments increased O3 sensitivity of Col-0 plants suggesting that constitutive high SA levels potentiate O3-induced plant defense responses including cell death (Figure 4). Although ethylene inhibition partially reduced the magnitude of O3-induced lesions (Figure 2), compromising SA accumulation completely reduced ethylene production in plants exposed to O3, drought, and paraquat (Figure 5). Further, NahG expression attenuated the expression of ethylene-dependent molecular markers (Figure 6) and lesions in eto3 mutants suggesting that SA is required for stress-induced ethylene production and that the synergistic action of SA and ethylene ne-tune the kinetics and magnitude of lesion formation in O3-sensitive plants. Our novel observations on a SA requirement for stressinduced ethylene production are also supported by studies of double mutants of accelerated cell death 5 (acd5) and ethylene insensitive 2 (ein2) (Greenberg et al., 2000). The ein2 mutation partially attenuated cell death phenotypes exhibited by single acd5 mutant alone, while NahG expression completely rescued all the phenotypes associated with acd5 mutant, suggesting a synergistic interaction between SA and ethylene on cell death (Greenberg et al., 2000). SA is required for the induction of senescence-associated gene SAG12, which has been shown to be ethylene-responsive (Quirino et al., 2000). Similarly, studies with various Arabidopsis mutants defective in SA signaling also revealed a
Blackwell Publishing Ltd, The Plant Journal, (2002), 32, 447456

453

Figure 7. A schematic model illustrating the synergistic and antagonistic interactions between SA-, ethylene-, and JA-signaling pathways on O3induced cell death.

role for SA in regulating senescence (Moris et al., 2000). Further, Arimura et al. (2002) have recently demonstrated that SA-signaling pathways regulate ethylene biosynthesis in Tetranychus urticae-infested lima bean plants. In addition, Pontier et al. (1999) have documented senescent cells immediately at the periphery of primary HR lesions and concluded that signals for senescence emerge from cells undergoing HR. This notion is supported by studies that have localized ethylene biosynthetic enzymes such as ACS and ACO to the chlorotic tissue surrounding primary HR lesions (de Laat and van Loon, 1983). Based on the data presented above, we propose a schematic model to illustrate that O3-induced, HR cell death in Arabidopsis is the net result of extensive cross-talk between multiple interacting signaling pathways that converge to modulate the type and the magnitude of O3-induced defense responses (Figure 7). Upon entering the leaf tissue via stomata, O3 generates excess AOS resulting in increased biosynthesis of signaling molecules such as SA, which in turn, potentiates the feedback amplication loop of runaway cell death cycle that induces the biosynthesis of signaling molecules such as ethylene. Ethylene has been shown to induce lipases known to promote senescence, a slow form of cell death (Hong et al., 2000). As yet, we do not know whether SA alone is sufcient to induce ethylene. Exogenous treatment of plants with 1 mM SA induced ethylene levels by vefold within 6 h of treatment; however, we were not able to obtain a clear dose dependency (data not shown). These ndings suggest a possibility that SA may require an additional stress-induced component(s) to maximize ethylene production. On the other hand, O3, either by reacting directly with membrane lipids (Mudd, 1997) and/or by generating excess AOS, induces the biosynthesis of JA or methyl jasmonate, which has been shown to reduce O3-induced lesions both by attenuating SA-dependent lesion initiation (Rao et al., 2000b) and ethylene-dependent lesion propagation processes (Overmyer et al., 2000; Figure 7, depicted by dotted lines). Several factors such as genotype, physiological state of the plant, presence of other stress factors, and any specic interactions that might occur between the activated signaling pathways govern the outcome of plant responses to stress factors. The results presented here indicate that O3induced HR cell death is dependent on the concerted action

454 Mulpuri V. Rao et al. of both SA and ethylene-signaling pathways. Interaction between these two pathways appears to ne-tune lesion initiation and propagation. On the other hand, O3-induced JA has been shown to attenuate both SA- and ethylenemediated cell death (Overmyer et al., 2000; Rao et al., 2000b). Thus, the nature of the balance and interaction between the signaling pathways of SA, ethylene, and JA modulate the kinetics and the magnitude of lesion formation. However, how and where different stimuli converge to result in different responses remains yet to be answered. One possibility is that plants contain regulatory switches such as SSI1, MPK4 to control the temporal expression and/ or the amplitude of multiple pathways (Petersen et al., 2000; Shah et al., 1999) and provide exibility for plants to specically tailor their responses to multiple environmental and developmental cues. Ongoing detailed analyses of double mutants will help to further clarify the regulatory circuits that control the cross-talk between various signaling pathways and their inuence on plant defense responses and cell death. Although our results clearly demonstrate a SA requirement for stress-induced ethylene during certain treatments in Arabidopsis, it is important to note that this interaction may not hold true for all stresses in all plants. Different plant species have been shown to have different responses and requirements with regard to SA and ethylene signaling during stress responses, particularly during plantpathogen interactions. For example, ODonnell et al. (2001) have shown that SA accumulation during a susceptible interaction in tomato is dependent on ethylene production and that SA apparently does not have a role in resistance. Similarly, SA accumulates at a later stage during the interaction of tomato with Xanthomonas campestris pv. Vesicatoria, while Arabidopsis accumulates SA within hours in response to pathogen infection (Zhou et al., 1998). Further, inhibition of O3-induced ethylene production completely attenuated O3-induced cell death in tomato (Bae et al., 1996; Tuomainen et al., 1997), while ethylene inhibition in Arabidopsis partially attenuated O3-induced cell death (Overmyer et al., 2000; Figure 2). These observations are in direct contrast to the role of SA the resistance response in Arabidopsis. Given that SA and ethylene apparently play different roles in different plant species during responses to biotic and abiotic stresses, it is likely that it will be impossible to completely understand the interactions between signaling pathways by analysis in a single model system such as Arabidopsis. Experimental procedures Plant growth conditions
Arabidopsis thaliana, accession Col-0 (Columbia), the NahG transgenic line expressing salicylate hydroxylase and the npr1 mutant line were the same as those described earlier (Rao and Davis, 1999; Sharma et al., 1996). Seeds of both eto1 and eto3 were obtained from the Arabidopsis Biological Resource Center (ABRC, Ohio State University, Columbus, OH, USA), and all the mutant lines used in this study are in Col-0 background. Plant growth conditions were as described earlier (Rao and Davis, 1999).

Stress and chemical treatments

Unless indicated otherwise, O3 treatments were performed by exposing 18-day-old plants to a single dose of 300 50 ppb O3 for 6 h in an O3 chamber as described previously (Rao and Davis, 1999). Plants maintained in ambient air served as controls. O3induced ethylene production was inhibited by spraying plants, until runoff, with 1 mM AVG and 1 mM CoCl2, 20 h prior to O3 exposure. Drought conditions were imposed on 16-day-old plants by withholding water for 6 days. Plants that received water r egularly served as controls. Paraquat and SA treatments were performed by spraying plants with 10 mM methyl viologen (Sigma, St. Louis, MO, USA) and with 0.1 and 0.25 mM SA until runoff 24 h prior to sampling. Plants sprayed with water served as controls.

Cell death quantification

O3-induced changes in cell death were quantied by measuring ion leakage with a conductivity meter (model 1051; Amber Science, San Diego, CA, USA) as described elsewhere (Rao and Davis, 1999).

Ethylene and SA measurements

For ethylene measurements, plants were grown in plastic pots of 15-cm diameter. At the indicated intervals, during and after O3 treatments, three pots containing two plants each were placed in an air tight glass container. Duplicate containers were left in control growth chambers for 2 h prior to removal of 1 ml head space with a syringe and used for ethylene measurements (Knee et al., 2000). Whole rosettes of 35 plants were pooled for the estimation of both free and total SA following the methods described in (Rao et al., 2000b). All data were corrected for recovery by including internal controls.

RNA isolation and analysis

Total RNA was isolated using a SDSphenol extraction method and subjected to RNA gel blot hybridization analysis as described previously (Rao and Davis, 1999). PR4 and PDF1.2 gene products were obtained by amplifying the genomic sequences by PCR using the primer sets 50 -AATGGATCCACAATGCGGTCGTCAAGG-30 /50 -AATGAAT TCTTCTGGAATCAGGCTGCC-30 and 50 -GAGTCTGGTCATGGCACAAGTTC-30 /50 -CTT GGCACATTGTTCCGACGCTC30 , respectively. PCR was run for 40 cycles with annealing temperatures of 568C and the 600 and 400 bp products of PR4 and PDF1.2, respectively, were cloned in pGEM-T easy vector (Promega). The PCRproductsweresequencedonbothstrandsbeforeuse.Theprobe for PR1 gene was as described (Rao and Davis, 1999).

Double mutant generation

Double mutants of eto3:NahG were generated by performing reciprocal crosses with eto3 and Col-0:NahG plants following Blackwell Publishing Ltd, The Plant Journal, (2002), 32, 447456

Ozone-induced ethylene production

standard protocols. For comparative purposes, reciprocal crosses were also made between eto3 and wild-type Col-0 plants.

455

Acknowledgements
We thank Arabidopsis Biological Resource Center at the Ohio State University, Drs J. Ryals (formerly at Novartis) and X. Dong (Duke University), for providing the seed stock used in this study. Drs I. Raskin (Rutgers University) and M. Knee (Ohio State University) are thanked for providing facilities for SA and ethylene measurements, respectively. Drs J. Koch and J. Edmonds for assisting in ethylene measurements and Charles Bettini for assisting in trypan blue staining. The studies described in the paper were supported by USDA Co-operative State Research Service Grant (#96-351003214) to KRD.

References
Arimura, G.-I., Ozawa, R., Nishioka, T., Boland, W., Koch, T. and Kuhnemann, F. (2002) Herbivore-induced volatiles induce the emission of ethylene in neighboring lima bean plants. Plant J. 29, 8798. Asai, T., Stone, J.M., Heard, J.E., Kovtun, Y., Yorgey, P., Sheen, J. and Ausubel, F.M. (2000) Fumonisin B1-induced cell death in Arabidopsis protoplasts requires jasmonate-, ethylene-, and salicylate-dependent signaling pathways. Plant Cell, 12, 18231836. Bae, G.Y., Nakajima, N., Ishizuka, K. and Kondo, N. (1996) The role in ozone phytotoxicity of the evolution of ethylene upon induction of 1-aminocyclopropane-1-carboxylic acid synthase by ozone fumigation in tomato plants. Plant Cell Physiol. 37, 129135. Dangl, J.L., Dietrich, R.A. and Richberg, M.A. (1996) Death dont have no mercy: cell death programs in plantmicrobe interactions. Plant Cell, 8, 17931807. Elstner, E.F., Osswald, W. and Youngman, R.J. (1985) Basic mechanisms of pigment bleaching and loss of structural resistance in spruce (Picea abies) needles: advances in phytomedical diagnostics. Experentia 41, 591597. Draper, J. (1997) Salicylate, superoxide synthesis and cell suicide in plant defense. Trends Plant Sci. 2, 162165. Dong, X. (1998) SA, JA, ethylene, and disease resistance in plants. Curr. Opin. Plant Biol. 1, 316323. Greenberg, J.T., Silverman, F.P. and Liang, H. (2000) Uncoupling salicylic acid-dependent cell death and defense-related responses from disease resistance in the Arabidopsis mutant acd5. Genetics, 156, 341350. Guzman, P. and Ecker, J.R. (1990) Exploiting the triple response of Arabidopsis to identify ethylene-related mutants. Plant Cell, 2, 513523. He, C.-J., Morgan, P.W. and Drew, M.C. (1996) Transduction of an ethylene signal is required for cell death and lysis in the root cortex of maize during aerenchyma formation induced by hypoxia. Plant Physiol. 112, 463472. Heath, R.L. and Taylor, G.E. (1997) Physiological processes and plant responses to ozone exposure. In Forest Decline and Ozone: a Comparison of Controlled Chamber and Field Experiments, Vol. 127 (Sandermann, H. et al., eds). Springer, Berlin: Ecological Studies, pp. 317368. Hong, Y., Wang, T.-W., Hudak, K.A., Schade, F., Froese, C.D. and Thompson, J.E. (2000) An ethylene-induced cDNA encoding a lipase expressed at the onset of senescence. Proc. Natl Acad. Sci. USA, 97, 87178722. Blackwell Publishing Ltd, The Plant Journal, (2002), 32, 447456

Jabs, T. (1999) Reactive oxygen intermediates as mediators of programmed cell death in plants and animals. Biochem. Pharmacol. 57, 231245. Johnson, P.R. and Ecker, J.R. (1998) The ethylene gas signal transduction pathway: a molecular perspective. Annu. Rev. Genet. 32, 227254. Kende, H. (1993) Ethylene biosynthesis. Annu. Rev. Plant Physiol. 44, 283307. Kieber, J.J. (1997) The ethylene response pathway in Arabidopsis. Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 277296. Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A. and Ecker, J.R. (1993) CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases. Cell, 72, 427441. Knee, E.M., Hangarter, R.P. and Knee, M. (2000) Interactions of light and ethylene in hypocotyl hook maintenance in Arabidopsis thaliana seedlings. Physiol. Plant. 108, 208215. de Laat, A.M.M. and van Loon, C. (1983) The relation between stimulated ethylene production and symptoms expression in virus-infected tobacco leaves. Physiol. Plant Pathol. 22, 261273. Lamb, C.J. and Dixon, R.A. (1997) The oxidative burst in plant disease resistance. Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 251275. Lawton, K.A., Potter, S.L., Uknes, S. and Ryals, J. (1994) Acquired resistance signal transduction in Arabidopsis is ethylene independent. Plant Cell, 6, 581590. Maleck, K. and Dietrich, R.A. (1999) Defense on multiple fronts: how do plants cope with diverse enemies? Trends Plant Sci. 4, 215219. Mehlhorn, H. and Wellburn, A.R. (1987) Stress ethylene formation determines plant sensitivity to ozone. Nature, 327, 417418. Miller, J.D., Arteca, R.N. and Pell, E.J. (1999) Senescence-associated gene expression during ozone-induced leaf senescence in Arabidopsis. Plant Physiol. 120, 10151023. Moore, T., Martineau, B., Bostock, R.M., Lincoln, J.E. and Gilchrist, D.G. (1999) Molecular and genetic characterization of ethylene involvement in mycotoxin-induced plant cell death. Physiol. Mol. Plant Pathol. 54, 7385. Moris, K., Mackerness, S.A.H., Page, T., John, C.F., Murphy, A.M., Carr, J.P. and Buchanan-Wollaston, V. (2000) Salicylic acid has a role in regulating gene expression during leaf senescence. Plant J. 23, 677685. Mudd, J.B. (1997) Biochemical basis for the toxicity of ozone. In Plant Response to Air Pollution (Yunus, M. and Iqbal, M., eds). NY, USA: John Wiley and Sons, pp. 267284. ODonnell, P.J., Jones, J.B., Antoine, F.R., Ciardi, J. and Klee, H.J. (2001) Ethylene-dependent salicylic acid regulates an expanded cell death response to a plant pathogen. Plant J. 25, 315323. Overmyer, K., Tuomainen, H., Kettunen, R., Betz, C., Langebartels, C., Sandermann, H., Jr and Kangasjarvi, J. (2000) Ozone-sensitive Arabidopsis rcd1 mutant reveals opposite roles for ethylene and jasmonate-singling pathways in regulating superoxidedependent cell death. Plant Cell, 12, 18491862. Pell, E.J., Schlagnaufer, C.D. and Arteca, R.N. (1997) Ozoneinduced oxidative stress: mechanisms of action and reaction. Physiol. Plant. 100, 264273. Pellinen, R., Palva, T. and Kangasjarvi, J. (1999) Subcellular localization of ozone-induced hydrogen peroxide production in birch (Betula pendula) leaf cells. Plant J. 20, 349356. Penninckx, I.A.M.A., Eggermont, K., Terras, F.R.G., Thomma, B.P.H.J., De Samblanx, G.W., Buchala, A., Metraux, J.P., Munner, J.M. and Broekaert, W.F. (1996) Pathogen-induced systemic activation of a plant defensein gene in Arabidopsis follows a salicylic acid-independent pathway. Plant Cell, 8, 23092323.

456 Mulpuri V. Rao et al.

Petersen, M., Brodersen, P., Naested, H. et al. (2000) Arabidopsis MAP kinase 4 negatively regulates systemic acquired resistance. Cell, 103, 11111120. Pieterse, C.J.M. and van Loon, L.C. (1999) Salicylic acid-independent plant defense pathways. Trends Plant Sci. 4, 5258. Pontier, D., Gan, S., Amasino, R.M., Roby, D. and Lam, E. (1999) Markers for hypersensitive response and senescence show distinct patterns of expression. Plant Mol. Biol. 39, 12431255. Quirino, B.F., Noh, Y.S., Himelblau, E. and Amasino, R.M. (2000) Molecular aspects of leaf senescence. Trends Plant Sci. 5, 278282. Rao, M.V. and Davis, K.R. (1999) Ozone-induced cell death occurs via two distinct mechanisms. The role of salicylic acid. Plant J. 17, 603614. Rao, M.V., Koch, J.R. and Davis, K.R. (2000a) Ozone: a tool for probing programmed cell death in plants. Plant Mol. Biol. 44, 345358. Rao, M.V., Lee, H.-I., Creelman, R.A., Mullet, J.E. and Davis, K.R. (2000b) Jasmonate perception desensitizes O3-induced salicylic acid biosynthesis and programmed cell death in Arabidopsis. Plant Cell, 12, 16331646. Rate, D.N., Cuenca, J.V., Bowman, G.R., Guttman, D.S. and Greenberg, J.T. (1999) The gain-of-function Arabidopsis acd6 mutant reveals novel regulation and function of the salicylic acid pathway in controlling cell death, defense, and cell growth. Plant Cell, 11, 16951708. Sandermann, H., Jr, Ernst, D., Heller, W. and Langebartles, C. (1998) Ozone: an abiotic elicitor of plant defense reactions. Trends Plant Sci. 3, 4750. Schraudner, M., Moeder, W., Wiese, C., Van Camp, W., Inze, D., Langebartles, C. and Sandermann, H., Jr (1998) Ozone-induced oxidative burst in the ozone biomonitor plant, tobacco Bel W3. Plant J. 16, 235245. Shah, J., Kachroo, P. and Klessig, D.F. (1999) The Arabidopsis ssi1 mutation restores pathogenesis-related gene expression in npr1 plants and renders defensin gene expression salicylic acid dependent. Plant Cell, 11, 191206. Sharma, Y.K., Leon, J., Raskin, I. and Davis, K.R. (1996) Ozoneinduced expression of stress-related genes in Arabidopsis thaliana: the role of salicylic acid in the accumulation of defense-related transcripts and induced resistance. Proc. Natl Acad. Sci. USA, 93, 50995104. Shirasu, K., Nakajima, H., Rajashekar, K., Dixon, R.A. and Lamb, C. (1997) Salicylic acid potentiates an agonist-dependent gain control that amplies pathogen signals in the activation of defense mechanisms. Plant Cell, 9, 261270. Thomma, B.P.H.J., Eggermon, K., Penninckx, I.A.M.A., MauchMani, B., Vogelsang, R., Cammue, B.P.A. and Broekaert, W.F. (1998) Separate jasmonate-dependent and salicylate-dependent defenseresponse pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proc. Natl Acad. Sci. USA, 95, 1510715111. Tuomainen, J., Betz, C., Kangasjarvi, J., Ernst, D., Yin, Z.H., Langebartels, C. and Sandermann, H., Jr (1997) Ozone induction of ethylene emission in tomato plants: regulation by differential transcript accumulation for the biosynthetic enzymes. Plant J. 12, 11511162. Vahala, J., Schlagnhaufer, C.D. and Pell, E.J. (1998) Induction of an ACC synthase cDNA by ozone in light-grown Arabidopsis thaliana leaves. Physiol. Plant, 103, 4550. Weigel, D. and Glazebrook, J., eds (2002) How to analyze a mutant phenotypically. In Arabidopsis: a Laboratory Manual. NY, USA: Cold Spring, Harbor Laboratory Press, pp. 55118. Wellburn, F.A.M. and Wellburn, A.R. (1996) Variable patterns of antioxidant protection but similar ethene emission differences in several ozone-sensitive and ozone-tolerant plant selections. Plant Cell Environ. 19, 754760. Woeste, K.E., Ye, C. and Kieber, J.J. (1999) Two Arabidopsis mutants that overproduce ethylene are affected in the posttranscriptional regulation of 1-aminocyclopropane-1-carboxylic acid synthase. Plant Physiol. 119, 521530. Yang, S.F. and Hoffman, N.E. (1984) Ethylene biosynthesis and its regulation in higher plants. Annu. Rev. Plant Physiol. 35, 155189. Yu, I.C., Parkes, J.C. and Bent, A.F. (1998) Gene-for-gen disease resistance without the hypersensitive responce in Arabidopsis dnd7 mutant. Proc. Natl. Acad. Sci. USA. 95, 72257230. Zhou, N., Tootle, T.L., Tsui, F., Klessig, D.F. and Glazebrook, J. (1998) PAD4 functions upstream from salicylic acid to control defense responses in Arabidopsis. Plant Cell, 10, 10211030.

Blackwell Publishing Ltd, The Plant Journal, (2002), 32, 447456