Sei sulla pagina 1di 10

Answer ALL the questions

1. The table below refers to the first and second divisions of meiosis. If the statement is correct, place a
tick () in the appropriate box and if the statement is incorrect, place a cross () in the appropriate box.
Statement

First division of meiosis

Second division of
meiosis

Pairing of homologous
chromosomes occurs.
Each chromosome consists of
a pair of chromatids during
prophase.
Crossing over occurs and
chiasmata are formed.
Independent assortment of
chromosomes occurs.
(Total 4 marks)
2. The table below shows the percentage saturation with oxygen of human haemoglobin and mouse
haemoglobin, at a range of partial pressures of oxygen.
Partial pressure of oxygen
/ kPa
1
3
5
7
9
11
13
15

Percentage saturation of haemoglobin


with oxygen
Human
Mouse
haemoglobin
haemoglobin
8
3
40
10
71
25
85
50
92
75
96
90
98
97
98
98

(a) (i) Describe the relationship between the percentage saturation of human haemoglobin with oxygen
and the partial pressure of oxygen.
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................

...............................................................................................................................
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................
(2)
(ii) Small mammals have a higher rate of oxygen use per gram of body mass than larger mammals. From
the table, it can be seen that at an oxygen partial pressure of 7 kPa, human haemoglobin is 85%
saturated, but mouse haemoglobin is only 50% saturated.
Suggest how this difference might be related to the difference in size of a mouse and a human.
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................
(2)
(b) Haemoglobin combines with oxygen in the lungs. Describe the mechanism by which air is brought
into the lungs (inspiration) in humans.
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
(4)

(Total 8 marks)
3. (a) DNA in eukaryotic organisms is a double helix. Bases on one strand bond to bases on the second
strand to form base pairs. During protein synthesis, one strand of DNA (the coding strand) acts as a
template to make mRNA. The second strand is known as the non-coding strand.
The base sequence of a small section of the coding strand of a DNA molecule is shown below.
AGACTTGCAACTTGACATGTA
(i) How many codons are shown in this sequence?
...............................................................................................................................
(1)
(ii) Give the sequence of the first five bases that would be present in each of the following:
1. the mRNA molecule transcribed from this DNA strand
.........................................................................................................................
2. the non-coding strand of this DNA
.........................................................................................................................
(2)
(b) A sample of DNA from a locust was analysed to determine the percentage of each base present. The
percentage of adenine was found to be 29.4%.
Calculate the percentage of cytosine in this sample. Show your working and give an explanation for your
answer.
Percentage of cytosine = ..............................................................................................
Explanation: ...................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
(5)

(Total 8 marks)
4. (a) Beetroot cells contain a red water-soluble pigment in their vacuoles. This pigment cannot pass
through membranes. If the membrane is damaged, red pigment will leak out of the cell. An
experiment was carried out to test the effect of different temperatures on beetroot cell membranes.
Eight equal-sized discs of beetroot were cut and carefully rinsed in distilled water. One disc was
transferred to a test tube containing 10 cm3 of distilled water maintained at a temperature of 25 C
and left for 30 minutes. After this time, the intensity of red coloration of the liquid in the test tube
was measured using a colorimeter. Each of the other seven discs was treated in a similar way but
maintained at a different temperature. The results of the investigation are shown in the graph
below.

(i) Describe the effect of increasing temperature on the intensity of the red coloration of the solution.
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................
(3)
(ii) Suggest an explanation for these results.
...............................................................................................................................
...............................................................................................................................

...............................................................................................................................

(3)

(b) Some substances pass through membranes by active transport. Describe the process of active
transport.
......................................................................................................................................

(5)
(Total 11 marks)

5. Amylase is an enzyme that catalyses the breakdown of starch into maltose. An experiment was carried
out to investigate the effect on amylase by keeping it at a high temperature before it was used. A 1%
solution of amylase was prepared and placed in a waterbath at 60 C. Immediately, 2 cm3 of this
amylase solution was put into a test tube and placed in another waterbath set at 20 C. Five more 2 cm3
samples of amylase were removed at 1 minute intervals from the amylase solution kept at 60 C. These
samples were also placed in the 20 C waterbath.
The activity of each amylase sample was then determined.
(a) Describe how the test for starch can be used to compare the activity of these amylase samples.
......................................................................................................................................
......................................................................................................................................

(3)

(b) The results of this experiment are shown in the table below.
Length of time that amylase was in the 60 C
waterbath / mins (Incubation time)

Activity of amylase

12.5

4.9

2.3

0.2

0.1

0.0

/ arbitrary units

Describe the effect of increasing the length of the incubation time at 60 C on the activity of amylase.
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................

(3)

(c) (i) Enzymes are proteins. Describe the tertiary structure of an enzyme.
...............................................................................................................................
...............................................................................................................................
(3)
(ii) Suggest an explanation for the change in amylase activity with increased incubation time at 60 C.
...............................................................................................................................
...............................................................................................................................

(3)
(Total 12 marks)

6. Read through the passage below on the heart, and then write on the dotted lines the most appropriate
word or words to complete the passage.
Contraction

of

the

atria

(atrial

systole)

is

stimulated

by

an

impulse

generated

by

the ................................................., situated in the wall of the right atrium.


The impulse reaches the walls of the ................................................. by means of the bundle of His and
Purkyne (Purkinje) fibres. Oxygenated blood is supplied to the heart muscle by
the ................................................. which branch directly from the aorta. Heart muscle contains a dense
network of ................................................., from which oxygen diffuses to the muscle.
(Total 4 marks)
7. (a) The diagram below shows the structure of part of the human breathing system.

Name the parts labelled A and B.


A ................................................................................
B ................................................................................
(2)
(b) Describe how the process of inspiration (breathing in) is brought about.
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................

(3)

(c) The table below shows the percentage of oxygen in inspired air and in alveolar air.
Air

Percentage of oxygen (%)

Inspired

20.71

Alveolar

13.20

Suggest an explanation for the difference in the percentage of oxygen in inspired air and in alveolar air.
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................

(2)

(d) Describe how alveoli are adapted for the function of gas exchange.
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................

(5)
(Total 12 marks)

8. Many attempts have been made to find methods of using gene therapy to treat cystic fibrosis. One
approach uses viruses to deliver normal alleles of the CFTR gene into epithelial cells of the airways.
Viral delivery systems have two main problems:
The virus may trigger an immune response which destroys the infected cells.
Most non-pathogenic viruses are not very good at getting into cells, so very few cells receive the allele.
A team of researchers in the USA developed a new strain (AAV2.5T) of AAV, a nonpathogenic virus.
AAV2.5T has an improved ability to bind with epithelial cells of the airways.

Genes for the CFTR protein and for an enzyme, luciferase, were added to the DNA of the viruses.
Luciferase produces a fluorescent green protein when luciferin is added.
The normal AAV strain and the AAV2.5T strain were added to cultures of epithelial cells from the
airways. After adding luciferin, the numbers of cells that had taken up the viral genes was estimated using
the intensity of the green fluorescence which developed.
The results are shown in the following figure.

(a) With reference to the figure above, compare the ability of the two viral strains, AAV and AAV2.5T,
to infect epithelial cells from the airways.
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................

(2)

(b) Explain why the researchers added a gene for luciferase to the viral DNA.
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................

(2)

(c) Suggest how delivering normal alleles of the CFTR gene into epithelial cells in the airways could
relieve the symptoms of cystic fibrosis.
......................................................................................................................................
......................................................................................................................................
......................................................................................................................................

(4)
[Total 8 marks]

9. (a) The diagram below shows a ventral (front) external view of a mammalian heart.

(i) Name the structures labelled X, Y and Z.


X ............................................................................................................................
Y ............................................................................................................................
Z .............................................................................................................................
(3)
(ii) There are four boxes on the heart diagram. Place a tick () in the box that correctly identifies the
position where electrical activity of the heart is initiated.

(1)

(iii) Name the structure that initiates electrical activity in the heart.
...............................................................................................................................

(1)

(b) Blood pressure within the heart varies throughout the cardiac cycle.
(i) Explain what is meant by the term cardiac cycle.
...............................................................................................................................
...............................................................................................................................

(2)

(ii) The table below shows the range of blood pressures found in the left ventricle and in the right
ventricle during one complete cardiac cycle.
Ventricle

Blood pressure / kPa

Right

0.0 to 3.3

Left

0.0 to 15.8

Explain why the maximum blood pressure is higher in the left ventricle than in the right ventricle.
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................

(2)

(iii) Explain why blood pressure varies in a ventricle during the cardiac cycle.
...............................................................................................................................
...............................................................................................................................
...............................................................................................................................

(2)

(c) Apart from high blood pressure, state four other risk factors for heart disease.
......................................................................................................................................
......................................................................................................................................
(2)
(Total 13 marks)
TOTAL MARKS FOR THIS PAPER IS 80