Poster Presentations: 2009 The Authors Journal Compilation 2009 Blackwell Verlag GMBH - Mycoses, 52 (Suppl. 1), 29-123

Poster Presentations
P001
In vitro activities of eight antifungal drugs against 275 Cryptococcus gattii isolates F. Hagen1, M. T. Illnait-Zaragozi2, S. Eijkemans3, I. Curfs-Breuker3, T. Boekhout1 and J. F. Meis3 1 CBS Fungal Biodiversity Centre, Utrecht, The Netherlands, 2 Tropical Medicine Institute Pedro Kouri, Havana, Cuba, 3Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Background: Cryptococcus gattii can cause an invasive fungal
infection but is more rarely encountered than Cryptococcus neoformans. Both species consist of ve serotypes: serotype A (C. neoformans var. grubii), serotype D (C. neoformans var. neoformans), serotype AD (a hybrid of the former two serotypes), and serotypes B and C (C. gattii). Patients with compromised immunity are most commonly infected with serotypes A or D, while C. gattii (serotypes B and C) has recently gained attention because of invasive infections in patients with no known immunodeciency, as illustrated by a large ongoing outbreak on Vancouver Island, Canada. While ample studies have been published on the in vitro susceptibility of C. neoformans, large numbers of C. gattii (serotype B and C) have not been tested for antifungal susceptibility. Purpose: To measure the in vitro activities of existing and new antifungals against a worldwide collection of clinical and environmental C. gattii isolates with different genotypes. Methods: A worldwide collection of 275 clinical (n = 171), veterinary (n = 47), environmental (n = 52) and isolates with an unknown source (n = 5) from the CBS Fungal Biodiversity Centre, Utrecht, The Netherlands was used . MICs were determined for amphotericine B (AmB), uconazole (FLU), itraconazole (ITC), voriconazole (VOR), posaconazole (POS), isavuconazole (ISA), micafungin (MICA) and 5ucytosine (5FC). Microdilution testing was done in accordance with CLSI M27-A3 guidelines. Quality control was ensured by including Paecilomyces variotii (ATCC 22319) and Candida krusei (ATCC 6258). Results: AFLP4 (n = 111), AFLP6B (n = 51), AFLP6 (n = 43) and AFLP6A (n = 34) were the most prevalent genotypes. There was no difference in MICs between the different origins, serotypes and AFLP genotypes of the C. gattii isolates. The MIC ranges and MIC50 and MIC90 values (mg L-1) of the 275 isolates are shown in Table 1. Table 1 MIC values of eight antifungal agents.
icin B (AMB), uconazole (FLU), itraconazole (ITR), and voriconazole (VOR) among Candida species and Cryptococcus neoformans isolates associated with deep-seated and disseminated infections during a 24 month-period in patients from seven Croatian medical institutions. Methods: From January 2007 until December 2008 we were able to collect a total of 685 yeast isolates: 650 (95%) isolates of 13 Candida species and 35 (5%) isolates of C. neoformans from ve tertiary care hospitals, one general hospital and the Croatian National Institute of Public Health (CNIPH). The isolates were collected at the individual study sites and were sent to the National Reference Laboratory for systemic mycoses (in CNIPH) for identication and susceptibility testing. Yeast isolates were identied by ID 32 C (BioMerieux) and classical methods. Antifungal susceptibility prole of isolates was determined by ATB FUNGUS 3 (BioMerieux) microdilution methods following the manufacturers instructions. MIC readings were performed visually and the results were interpreted according to the CLSI recommendations. Results: The collection included 115 (16.8%) bloodstream or CSF isolates of Candida species and C. neoformans and 570 (83.2%) isolates of Candida species from other clinical samples (BAL, sputum, urine, aspirates, drainage swabs, stools). Candida species distribution was as follows: C. albicans 360 (55%), C. glabrata 110 (17%), C. parapsilosis 63 (10%), C. krusei 35 (5%), C. tropicalis 25 (4%) and other Candida species 57 (9%). Only 0.3% C. albicans and 8.6% C. krusei isolates were resistant to 5-FC. All Candida species and C. neoformans isolates were sensitive to AMB. Isolates of C. albicans, C. tropicalis, and C. neoformans < were all susceptible to FLU, whereas 82.5% C. glabrata, 88.9% C. parapsilosis, 0% C. krusei, and 97.8% of the other tested Candida species isolates were susceptible to this antifungal agent. Intermediate susceptibility and resistance against ITR were found for 68.2% C. glabrata, 31.7% C. parapsilosis, 94.3% C. krusei, and 20% of the other tested Candida species isolates. Resistance to VOR was detected in four (11.4%) C. krusei isolates. Conclusion: The results of the two years of Croatian antifungal susceptibility surveillance showed the existence of different frequency of isolation pattern and antifungal susceptibility prole in yeast isolates among institutions. C. albicans accounts for approximately one-half of all clinical isolates, and the most (99.7%) of our C. albicans isolates remained susceptible to all antifungal drugs tested. We were able to demonstrate that in Croatia most non-albicans Candida species are represented by C. glabrata, C. parapsilosis, C. krusei, and C. tropicalis isolates still susceptible to 5-FC, AMB and VOR. Conversely, nonalbicans Candida species isolates have higher intermediate and resistance rates to FLU and ITR, the second generation azoles. The overall susceptibility of C. neoformans isolates was 100% for all antifungals tested. However, continuous surveillance programs are needed in order to identify possible changes in the species distribution and antifungal susceptibility patterns of yeasts, particularly after increasing the use of azoles in Croatian hospitals.
Conclusions: Amphotericine, itraconazole, voriconazole, posaconazole and isavuconazole were the most active drugs in vitro against C. gattii isolates. The new azole isavuconazole had at least as good activity as the other new triazoles whereas micafungin had no activity. Acknowledgements: We thank Karen Bartlett, Kathrin Tintelnot, Danielle Swinne, Francoise Dromer, Maria Teresa Montagna and Josep Torres-Rodriguez for providing C. gattii strains. This study was partly supported by Basilea Pharmaceutica, Basel, Switserland.
P004
Effect of farnesol on susceptibility of Candida albicans to amphotericin B and uconazole L. Krivcikova, V. Buchta and M. Vejsova University Hospital, Hradec Kralove, Czech Republic Objectives: Farnesol is a quorum sensing compound, which consid-
P003
Species distribution and antifungal susceptibility prole of Candida species and Cryptococcus neoformans isolates: 2 years of Croatian surveillance E. Mlinaric-Missoni, V. Vazic-Babic and E. Missoni Croatian Institute of Public Health, Zagreb, Croatia Objectives: To conduct a prospective surveillance of species distribution and in vitro susceptibility to 5-uorocitosine (5-FC), amphoter-
erably inuences morphology of vegetative growth form of Candida albicans based on density of cell population. As some antifungals displayed antimicrobial effect depending on fungal morphology, a possible effect of farnesol on antifungal susceptibility testing in this yeast was studied. Methods: Microdilution broth method (M27-A2) and agar diffusion tests (Disk test, Etest) were used to evaluate the effect of farnesol on susceptibility testing of amphotericin B (AmB) and uconazole (FLZ) in C. albicans (n = 5). In broth method, farnesol (10, 30, 50, 100, 250, 500 mmol L-1) was tested in RPMI 1640 and ATB 3 medium, while in
2009 The Authors Journal compilation 2009 Blackwell Verlag GmbH Mycoses, 52 (Suppl. 1), 29123
29
both diffusion techniques, farnesol (3, 30, 300 mmol L-1) incorporated into Mueller-Hinton agar was used to evaluate antifungal susceptibility. Results: There was no effect of farnesol concentrations tested on antifungal susceptibility determined with disk test and Etest. In microbroth dilution, the results were strain-dependent and inuenced with farnesol concentration, e.g. in case of C. albicans ATCC 10321, MIC values of AmB and FLZ was proportional in direct way to farnesol concentration. If farnesol inuenced antifungal susceptibility test results, it was almost always at lower concentration tested ( 50 mmol L-1), at higher concentrations this effect was minimal. The difference in susceptibility were less marked using ATB3 medium. Conclusion: Effect of farnesol on susceptibility of C. albicans to AmB and FLZ is concentration-dependent, strain variable and inuenced with composition of medium. Acknowledgements: The study was supported by the Research Center LC521 of the Ministry of Education, Czech Republic.
P006
Comparison of two methods, disk diffusion and E-test, for testing susceptibility of 102 lamentous fungi to amphotericin B, itraconazole, voriconazole, caspofungin and posaconazole C. I. Colosi1, O. Faure2, C. Bourdon2, B. Dessaigne2, B Lebeau2 and H. Pelloux2 1 University of Medicine and Pharmacy, Cluj-Napoca, Romania, 2 CHU, Grenoble, France Objectives: Antifungal susceptibility testing of lamentous fungi
(FF) is increasingly requested due to the large number of antifungal agents now available and the emergence of resistant isolates. Disk diffusion procedure with new identied guidelines for moulds seems reliable and easy to perform in routine laboratories. So we compared this method with E-test procedure by testing in parallel 102 FF consisting mainly of Aspergillus spp. Methods: We tested 102 FF (Aspergillus fumigatus 49%, other Aspergillus 31%, Fusarium sp. 5%, Mucorales 5%, Scedosporium sp. 3%, and other FF 7%) from clinical samples (mainly sputum and bronchopulmonary aspirate) of Grenoble Hospital inpatients. Two quality control strains (C. parapsilosis ATCC 22019, C. krusei ATCC 6258) were included as controls. Disk diffusion method used NeoSensitabs tablet assay (Rosco) for all antifungals (amphotericin B 10 lg, itraconazole 8 lg, voriconazole 1 lg, caspofungin 5 lg) except posaconazole 5 lg for which sterile disks were impregnated. The newly identied guidelines for mould testing with nonsupplemented Mueller Hinton agar (BioMerieux) were used. E-Test method (AB Biodisk) was performed in accordance with the manufacturers instructions with Etest strips for all antifungals and RPMI agar. Inoculum suspension was adapted according to species, between 6.104 and 9.5.104 CFU ml1 and plates were incubated at 35 C for 2448 h. The following interpretative criteria were used (Espinel-Ingrofff J.Clin.Mycol. 2008): susceptible (S): 1 lg ml-1 and 17 mm (triazoles and caspofungin) or 15 mm (amphotericin B).intermediate (I) /susceptible dose-dependant (SDD): 2 lg ml-1 and 1416 mm (triazoles and caspofungin) or 1314 mm (amphotericin B). Resistant (R): 4 lg ml-1 and 13 mm (triazoles and caspofungin) or 12 mm (amphotericin B). We determined categorical agreement level between E-test MIC or MEC (caspofungin) and tablet end-points, as opposed to the following disagreement parameters: very major discrepancies R to E-test and S to tablet; major discrepancies S to E-test and R to tablet; minor discrepancies- shifts between S and SDD or SDD and R. Statistical analysis was performed using linear regression analyses and computed Pearsons correlation coefcients (R values) between the log transforms of MICs/MEC and the inhibition zone diameters of the ve studied antifungal agents. Results: (Table 1) We obtained 95% (R = -0.821), 96% (R = -0.726), 96% (R = -0.790) and 95% (R = -0.743) of categorical agreement for caspofungin, itraconazole, voriconazole and posaconazole respectively. Amphotericin B exhibited a lower degree of agreement especially for Aspergillus sp. with 76% of categorical agreement (R = -0.672). In all cases above the computed R-values exhibited a high statistical signicance (P < 0.001).
P005
Yeast in vitro susceptibility testing and impact of their phylogenetic relationship A. Schmalreck MBS, Muenchen, Germany Objectives: Clinical important ascomycetous yeasts isolates (CAYI)
are grouped traditionally according to their species identication in anamorphic (ANA) form genera, which are polyphyletic (e.g. Candida, Geotrichum).The aim of this study was to evaluate whether grouping of CAYI in corresponding teleomorphic (TELE) genera or in phylogenetic (PHYLO) groups results in a more coherent susceptibility pattern when comparing with their placement in the current used ANA groups. Methods: In a recently performed German antifungal multicenter study the minimum inhibitory concentration (MIC) of voriconazole (VOR), itraconazole (ITR), uconazole (FLC), and ucytosine (FCY) for 9.893 CAYI had been determined in parallel by microdilution (DIN 58940). Susceptibility pattern analysis was used for assessment of yeast susceptibility data when grouping anamorphic CYI in (i) corresponding TELE-groups (when existing) and in (ii) PHYLOgroups. The latter were arranged according to recently published studies on inferring phylogenetic clades based upon multi-gene analyses. Results: The CAYI studied had been classied into one anamorphic genus (Candida spp.) comprising 33 different species. These isolates could be re-classied into 8013 strains (81.5%) froming one ANAgroup (Candida spp. with no known teleomorphic designations so far), which could be assigned to seven major phylogenetic groups. The remaining 1820 strains (18.5%) with their corresponding teleomorphic afliates comprised 21 species of 12 genera, and could also assigned to the mentioned seven major phylogenetic groups. CAYI of TELE-groups showed signicantly higher resistance rates than those which could not be regrouped into the TELE-associated isolates (43.0%, 26.1%, 6.0% vs. 4.4%, 8.0%, 2.5% for FLC, ITR, and VOR, respectively). The susceptibility patterns of the PHYLO-G group differed signicantly from the others. CAYI of PHYLO-G, B, and D (e.g. C. guilliermondii, C. intermedia, C. lusitaniae, C. inconspicua, C. krusei) showed consistently higher MICs for all triazoles tested when compared to those of clade A (C. albicans complex, C. parapsilosis complex, C. tropicalis), which encompasses the most frequently encountered clinical isolates, frequently exhibiting low MICs. Conclusions: Grouping of the ana-/telemorphic ascomycetous yeasts into their phylogenetic clades thus reecting their natural relationship, is correlated with signicant different MIC distributions, and results in reliably more coherent susceptibility patterns, when compared to grouping into anamorphic or teleomorphic genera, which may be also sometimes polyphyletic (e.g. Pichia). Thus PHYLO-grouping may enhance and facilitate prediction of parallel and/or cross resistant isolates and results in a more reliable MICassessment.
Conclusion: The results of our study suggest a potential value of the Neo-Sensitabs assay for testing itraconazole, voriconazole, caspofungin and posaconazole, while amphotericin B exhibited an overall lower degree of agreement.
30
P007
In vitro activities of amphotericin B, uconazole and voriconazole against Taiwan surveillance of antimicrobial resistance of Yeasts uncommon Candida by use of 2% glucose medium M.S. Tsai Chang Gung Memorial Hospital - Kaohsiung Medical Center; Chang Gung University, College of Medicine, Kaohsiung, Taiwan Objectives: Taiwan Surveillance of Antimicrobial Resistance of Yeasts (TSARY) is an island-wide surveillance project conducted by National Health Research Institutes (NHRI) designed for monitoring the trend of the in vitro susceptibilities of clinical yeast isolates to antifungal agents in Taiwan. During the period between 1999 and 2006, a total of 2533 clinical yeast isolates were submitted to NHRI for in vitro testing. Although Candida albicans, C. tropicalis, C. glabrata, C. parapsilosis and C. krusei made up a substantial portion of TSARY clinical yeast isolates; 41 (1.62%) isolates were Candida spp. which were less frequently isolated. To better understand the in vitro activities of antifungal agents against these infrequently isolated yeasts, minimal inhibitory concentrations (MICs) of amphotericin B, uconazole, and voriconazole were determined. To compare with the MICs obtained by CLSI M27-A2 reference methods, in vitro antifungal susceptibility testing using a 2% glucose medium and MICs read at 24 and 48 h were performed respectively. Methods: TSARY clinical yeast isolates were differentiated to species according to the instructions of API 32C and VITEK Yeast Biochemical Card (BioMerieux, St. Louis, MI, USA). If both API 32C and YBC yielded indistinguishable results, the internal transcribed spaces of yeast ribosomal DNA were sequenced and compared to those available in the GenBank (http://www.ncbi.nlm.nih.gov/BLAST) for species identication. In vitro activities of amphotericin B, uconazole, and voriconazole against clinical Candida isolates were determined by reading 48-hour yeasts growth in the RPMI-1640 microdilution broth according to CLSI M27-A2. The MICs of amphotericin B were read as the lowest drug concentration that resulted in a 95% reduction of yeasts growth. The MICs of uconazole and voriconazole were read as the lowest concentration that inhibited approximately 50% yeasts growth. The MICs of each antifungal agent against Candida spp. grown in a medium with 2% glucose were read at 24 and 48 h respectively. Candida albicans ATCC 90028, C. krusei ATCC 6258, and C. parapsilosis ATCC 90018 were the control yeast strains. Agreement was dened as discrepancies in MIC results of no more than 1 twofold dilution. Intraclass correlation coefcient (ICC) between the MICs of different methodologies was also compared. The ICC was calculated using the formula ICC = (group mean square - error mean square)/(group mean square + error mean square) and has a maximum value of 1 if there is perfect correlation and a minimum value of -1 if there is absence of correlation. Results: See Table 1 and Table 2.
Conclusion: Amphotericin B has a good in vitro activity against 41 TSARY uncommon Candida isolates. The in vitro antifungal susceptibility of C. guilliermondii to either uconzole or voriconazole is slight higher than that of C. lusitaniae. However, MICs of both uconazole and voriconazole against C. lusitaniae and C. guilliermondii are within the susceptible category. Antifungal susceptibility testing results obtained either at 24 or 48 h by CLSI M27-A2 methodology modied by a 2% glucose medium is comparable to the CLSI M27-A2 reference method.
P008
Oral candidiasis in patients with HIV/AIDS: identication of species and evaluation of the prole of sensitivity and resistance to antifungal drugs (preliminary results) B.C.A. Zoppas1, A. P. Delamare2, L. M. Michelin3, J. F. Fracasso3, C. B. Boff3, F. C. Casal1, J. Z. Zacaria2, D. O. Stopiglia4, D. H. Heidrich4, J. Vieira4, M. L. Scroferneker4 and S.E. Echeverigaray2 1 Center for Health Sciences, Caxias do Sul, Brazil, 2Institute of Biotechnology, UCS, Caxias do Sul, Brazil, 3Hospital/Clinic, UCS, Caxias do Sul, Brazil, 4Institute of Basic and Health Sciences, Porto Alegre, Brazil
Yeasts of the genus Candida are opportunistic pathogens that are part of the human microbiota and are associated with high morbidity and mortality in immunocompromised patients. The use of amphotericin B and azoles, which are administered for prolonged periods have shown resistance to these antifungals. This study aims to identify Candida species that affect patients with Acquired Immunodeciency Syndrome in Caxias do Sul and region as well as to determine the sensitivity and resistance to antifungal agents. Samples were collected from patients with oral candidiasis at the Hospital and Clinic of the Universidade de Caxias do Sul, Rio Grande do Sul, Brazil. The primary isolation of Candida species was performed by culture on Sabouraud dextrose agar, and presumptive identication by cultivation on CHROMagar Candida, and testing and germ tube microculture. For molecular characterization, the technique of RAPD was performed by using the sequences starting decameric OPX-03, OPX-07, OPX-06 and OPB-10. For the tests of susceptibility to antifungal agents (ketoconazole, uconazole, itraconazole, terbinane and nystatin) the technique recommended by the microdilution protocol M27-A2 of the Clinical and Laboratory Standards Institute (CLSI) was used. The minimum fungicidal concentration (MFC) was determined by transferring 100 ll of wells that showed 100% inhibition of growth in the microdilution technique into tubes containing 2 ml of Sabouraud dextrose broth. The tubes were incubated for 3 days at 35 C and MFC was determined as the lowest concentration able to inhibit the fungal growth. To date 10 samples were collected, yielding results as presumptive: nine isolates of Candida albicans and one of Candida tropicalis. The analysis by RAPD revealed a total of 59 amplicons, ranging from 10 to 19 bands per primer, and the amplicons showed a molecular weight between 300 and 2100 pb. A comparison of electrophoretic proles of isolates showed a large number of polymorphic bands (98%). Multivariate
31
analysis revealed clusters and the formation of two groups: one formed by eight isolates and another by two isolates. Similarly to the sensitivity tests, results showed that all strains are susceptible or susceptible dosedependent, to itraconazole, however, with an MFC > 16 lg ml-1. As for uconazole, 50% of the strains are sensitive, but 100% MFC present in concentrations higher than those tested. As for nystatin, 60% of the strains showed MIC at the concentration of 2 lg ml-1 and 40%, 1 g ml1 and only 20% of the strains tested showed MFC than 16 g ml-1. However, all other antifungal agents tested showed MFC higher concentrations tested, indicating a high resistance to commercially available antifungal agents. Therefore, the identication of Candida species that affect HIV/AIDS patients, as well as the verication of sensitivity to antifungal drugs and establishment of resistant species may contribute to better monitoring patients and taking action in relation to each appropriate therapy case. Support: CAPES and FAPERGS.
Acknowledgement: The authors acknowledge the Fundacao para

a Ciencia e Tecnologia (FCT) for the post-doc grant attributed to L. A. Vale-Silva (SFRH/BPD/29112/2006).
References
1. Clinical and Laboratory Standards Institute. Approved standard M27-A3, 3rd edn. Wayne, PA: Clinical and Laboratory Standards Institute, 2008. 2. Van Asbeck E, Clemons KV, Martinez M, Tong AJ, Stevens DA. Diagn Microbiol Infect Dis. 2008; 62:1069.
P010
In vitro activity of amphotericin B and uconazole in combination with atorvastatin and moxioxacin against Candida albicans S. Kustimur, S. J. Fadil, S. Kustimur and A. Kalkanci Gazi University, Ankara, Turkey Objectives: Patients suffering from invasive mycoses often receive concomitant antifungal therapy and antibacterial agents. Assessment of pharmacodynamic interactions between antifungal and antibacterial agents is complicated by the absence of a common antifungal end point for both agents. Antifungal effect of non-antifungal compounds such as quinolones and statins has been reported previously. The aim of this study was to investigate the in vitro interaction of moxioxacin and atorvastatin with uconazole and amphotericin B against ten isolates of Candida albicans strains which were resistant to amphotericin B. Methods: Drug interaction model was used to analyze the in vitro interaction of antifungal drugs against various C.albicans strains using the microdilution checkerboard method. Drug interaction was classied as synergistic, additive, indifferent or antagonistic on the basis of the fractional inhibitory concentration (FIC) index. The FIC index is the sum of the FICs for each drug; the FIC is dened as the MIC of each drug when used in combination divided by the MIC of the drug when used alone. The nal concentrations of the antifungal agents ranged from 0.25 to 128 lg ml-1 for uconazole, 0.03 to 16 lg ml-1 for amphotericin B. The nal concentrations of the non-antifungal drugs ranged from 1.25 to 6.25 lg ml-1 for atorvastatin, 3.5 to 1750 lg ml-1 for moxioxacin. MIC endpoints were determined as the rst concentration of the antifungal agent, either alone or in combination, at which the turbidity in the well was less than 50% of that in the control well. Results: Synergistic interactions were observed between amphotericin B and atorvastatin against six of 10 C. albicans strains. Additive interaction was found in resting four strains. Synergy also was found between amphotericin B and moxioxacin against three of 10 C. albicans strains. Additive interaction was found in resting seven strains. Some antagonistic interactions were observed between atorvastatin and uconazole against two of C. albicans strains. Synergistic interaction was observed between these two drugs against two of the strains, while additive effect was found against resting six strains. Additive effect was observed between uconazole and moxioxacin against six of C. albicans strains, tested. Synergy also was found between uconazole and moxioxacin against four of 10 C. albicans strains. In general, atorvastatin enhanced the activity of antifungal agents more than moxioxacin against C. albicans. Conclusion: In this study we analyzed the in vitro interactions between antifungal drugs with non-antifungal drugs. Four different combinations, were used in this study to investigate the interactions between amphotericin B and uconazole each of moxioxacin and atorvastatin. For the majority of strains, the combination tests showed additive activity. Signicant in vitro interactions were found between antifungal agents and atorvastatin or moxioxacin against C. albicans. This particular analysis can provide a useful tool for the assessment of interactions between antifungal agents and nonantifungal compounds, which alone do not elicit any signicant antifungal activity, and possibly of interactions against resistant isolates. Synergy would be the most suitable for routine empirical clinical use, based on clinically achievable drug concentrations with commonly used dosage regimens.
P009
Antifungal susceptibility testing of Candida parapsilosis against caspofungin and anidulafungin by the CLSI broth microdilution protocol, Etest, and a ow cytometry-based method P. Pinto1, L. Vale-Silva2, V. Lopes1, H. Ramos1 and E. Pinto2 1 Centro Hospitalar do Porto, Porto, Portugal, 2University of Porto, Porto, Portugal Objectives: It is common knowledge that there has been an
apparent shift in infections caused by Candida spp., with non-albicans Candida spp., like C. parapsilosis, assuming an increasing role in pathogenesis of candidemia. Candida parapsilosis have shown variable susceptibility patterns to the new antifungal agents, echinocandins. It is advisable to determine the antifungal susceptibility patterns of clinical isolates, which may assist in making appropriate decisions regarding the best therapeutic options. The objective of this study was to compare Etest and ow cytometry (FC) with the reference CLSI broth microdilution method (BMD) for antifungal susceptibility testing (AST) of C. parapsilosis to caspofungin and anidulafungin. Methods: Twenty C. parapsilosis isolates from relevant clinical samples in our Hospital were tested. The broth microdilution method was performed according to the reference CLSI protocol M27-A31. Etest MICs were determined according to the instructions from the manufacturer (AB Biodisk, Solna, Sweden). The ow cytometry method was based on a 4-h incubation of the yeast cells with twofold dilutions of the antifungals, followed by staining with acridine orange. Quality control was performed using C. parapsilosis ATCC 22019 and C. krusei ATCC 6258. Major errors were results of susceptibility by BMD and resistance by Etest or FC. Very major errors were results of resistance by BMD and susceptibility by Etest or FC. Results: The determined caspofungin BMD MICs were 12 lg ml-1 and all strains were thus considered as susceptible. There was a 100% agreement within two log2 concentrations between the reference method and both Etest and FC and a 95% agreement within one dilution for both methods, with one major error registered with FC. Regarding anidulafungin, the BMD MICs ranged from 1 to 4 lg ml-1, with three non-susceptible strains (15%). The agreements within one and two dilutions were 100% for both methods, with one very major error (5%) for each method. Conclusion: We have obtained very good correlations between MIC results for both echinocandins determined according to the reference BMD method, Etest, and a new ow cytometry-based method. The values were clustered around the 2 lg ml-1 breakpoint value for susceptibility, a typical nding for C. parapsilosis2, making it possible for very good MIC value agreements obtained with different methods to admit classication errors. We have found very few of those cases, however. Overall, these results appear to indicate that the three methods could be appropriate for AST of caspofungin and anidulafungin. The less time-consuming could so be employed in substitution of the reference BMD protocol. The FC method could, in addition, allow single day result availability.
32
P011
Differential interactions between azoles and echinocandins against Candida spp. biolms and planktonic cells A. Chatzimoschou, M. Simitsopoulou, C. Antachopoulos and E. Roilides Aristotle University Thessaloniki, Thessaloniki, Greece Objectives: Candida spp. form biolms (BF) on biological and inert surfaces, such as intravascular catheters. Candida albicans (CA) and Candida parapsilosis (CP) are currently the most prevalent species in causing invasive candidiasis. Resistance of Candida BF to conventional antifungal agents has been previously documented (Katragkou et al., AAC, 2008). Given that BF-associated infections are very difcult to cure without device removal, novel, more effective therapies are needed. Antifungal triazoles have been previously shown to exert antifungal activity against Candida BF only at very high concentrations. In addition, triazoles are often administered concurrently with echinocandins. We therefore studied the antifungal activity of voriconazole (VRC) or posaconazole (PSC) against CA or CP BF or planktonic cells (PL) in combination with two echinocandins, caspofungin (CAS) or anidulafungin (AND). Methods: Two well-documented BF-producing Candida species, CAM61 and CP-A71 were used to produce BF by incubation on silicone elastomer disks in 96-well plates, under constant shaking, at 37 C for 48 h and 72 h, respectively. PL cells were grown in YNB medium, supplemented with 2% glucose at 37 C C for 24 h. 5 105 blastoconidia/ml were plated in each well of a 96-well plate. PL and BF were then incubated for 24 h with 2-fold dilutions of VRC or PSC (161024 mg L-1), and CAS or AND (016 mg L-1) alone or concurrently, VRC/PSC with CAS/AND in a checkerboard format. Fungal damage induced by antifungal agents to PL and BF was assessed by XTT assay. The interactions between VRC+AND, VRC+CAS, PSC+AND and PSC+CAS were analyzed using the Bliss model. Synergy, antagonism or indifference was concluded when the observed fungal damage was signicantly higher, lower or equal to the expected damage, respectively. Results: A synergistic interaction was observed between 32 128 mg L-1 of PSC combined with 0.0080.25 mg L-1 of CAS only for CA PL. By contrast, antagonism was observed when either of the two triazoles was combined with AND at the following concentration ranges: 1281024 mg L-1 PSC with 0.030.5 mg L-1 AND, 16 512 mg L-1 VRC with 0.0080.015 mg L-1 AND, 128512 mg L-1 VRC with 0.030.25 mg L-1 AND for CA PL and 321024 mg L-1 VRC with 0.58 mg L-1 CAS for CP PL. All drug combinations demonstrated indifferent interactions against BF of both species. Conclusions: The antagonistic or indifferent interactions between triazoles and echinocandins against PLs and BFs suggest that concurrent administration of these antifungal classes in cases of foreign body-associated infections due to C. albicans and C. parapsilosis should be considered with caution.
shown that caspofungin and micafungin are also able to interfere with Candida biolm growth on polystyrene and central venous catheter sections, as well as to induce a signicant and persistent reduction in the yeast metabolic activity of biolms when used as catheter lock solutions. The aim of this study was to investigate the in vitro activity of anidulafungin on both planktonic and sessile growths of eighty isolates of Candida species (10 C. albicans, 40 C. parapsilosis, 10 C. tropicalis, 10 C. glabrata, and 10 C. krusei) collected from blood infections. Susceptibilities of these isolates to caspofungin and uconazole were also determined. Planktonic MIC90 values and sessile MIC90 values were 0.25 and 0.125, 1 and 2, and 8 and > 256 lg ml-1 for anidulafungin, caspofungin, and uconazole, respectively, suggesting that anidulafungin is more active than caspofungin against Candida biolms.
P013
Candida species distribution and antifungal drugs susceptibility evolutions: a 5 years study in a French intensive care unit P. Fournier1, D. Maubon1, A. Francais2, R. Hamidfar1, A. Bonadona1, O. Faure1, B. Lebeau1, J. F. Timsit3 and H. Pelloux1 1 CHU, Grenoble, France, 2Institut Albert Bonniot, Grenoble, France, 3CHU and INSERM U823, Grenoble, France Objectives: The number of at risk patients for fungal infections in ICU is in constant raise. Widespread prophylactic and therapeutic antifungal use are commonly suspected to contribute to the modication of common fungal epidemiology or to the emergence of resistant strains. A ve year retrospective study of Candida species distribution and their related Minimum Inhibitory Concentration (MIC) for antifungal drugs was achieved in an ICU, in order to precise these phenomenons. Methods: From 2004 to 2008, 20611 biological samples (2817 patients) were analysed. All biological samples for which fungal research was requested were taken into account. Samples were mainly blood culture, respiratory tract, mouth, urines, stools, drainage liquids and surgical scars. Candida species were counted only one time for each patient. Everyday use identication procedure for Candida species was performed. Antifungals susceptibilities were evaluated for deep localisations or supposed sterile sites (n = 876), with the ATB Fungus (from 2004 to 2005) and the E-Test methods (from 2006 to 2008). Wilcoxon test and Chi square for trend test were used for the statistical analysis. Results: Over the 5 years, 19% of the biological samples were positive (3832/20611) corresponding to 31% of patients (879/2817) with no signicant variation between years. The study of the repartition of Candida species showed that Candida albicans slowly decreased (from 51.6% in 2004 to 46.8% in 2008, average 47.4%), as Candida parapsilosis and Candida krusei increased (from 5.3% in 2004 to 8.3% in 2008, average 6% and from 3.2% in 2004 to 6.8% in 2008, average 4.7%, respectively). We also observed the decrease of Candida glabrata since 2005 (from 18.4% in 2005 to 13.2% in 2008, average 15.7%). However, these slow but constant modications were not statistically signicant on the studied period. In contrast, we found signicant variations in MIC studies. The number of Fluconazole resistant or dose-dependant C. glabrata strains signicantly increased during that period (from 6.7% to 23.1%, average 16.1%) and corresponding MICs signicantly increased between 20042006 vs. 20072008 (P = 0.005). Importantly, strains susceptibility to Caspofungin was signicantly reduced from 2007 to 2008 (P = 0.005) for all Candida sp. strains, even if no real resistance in vitro was described during that period. This result need to be further explored in the light of anti-fungal hospital and ICU consumptions. No others susceptibility modications were found, particularly C. albicans susceptibility to Fluconazole was not modied. Conclusion: In this study, the global yeast ora remains statistically stable in the ICU, C. albicans being the most frequent. Yet, slow but constant increase of C. krusei and C. parapsilosis leads us to consider them as emerging species for a near future. We report a signicant
P012
In vitro activity of anidulafungin against biolms formed by bloodstream isolates of Candida species B. Posteraro, B. Fiori, M. Sanguinetti and G. Fadda ` Universita Cattolica del S. Cuore, Roma, Italy
Invasive fungal infections represent a relevant health problem due to their elevated rates of mortality and costs of care. Among these infections, candidiasis can be associated with the formation of biolms on bioprosthetic surfaces. This Candida biolm growth results in antifungal drug resistance and protection of the fungus from host defenses, which carry important clinical repercussions. Echinocandins, namely caspofungin, micafungin, and anidulafungin, represent the newest addition to the arsenal against fungal infections. Through the inhibition of the fungal (1,3)-beta-D-glucan synthase, these agents have a broad spectrum of activity and are similar to each other with respect to in vitro activity against Candida species. Recent studies have
33
increase in Caspofungin MIC for all Candida sp. in vitro. This observation also emphasizes that there is a high need to precise correlation of in vivo and in vitro susceptibility to echinocandins. Thus, there is an essential need to continue antifungal drugs susceptibilities testing for Candida strains from ICU patients.
n Gobierno Vasco) and PI061895/2006 (Fondo de Investigacio Sanitaria del Ministerio de Sanidad y Consumo de Espana).
P015 P014
In vitro activity of current and new antifungal agents against Spanish clinical isolates of Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis I. Miranda Zapico1, E. Eraso1, J. L. Hernandez Almaraz2, A. J. Carrillo Munoz3, J. M. Hernandez Molina4 and G. Guillermo 1 Quindos 1 Universidad del Pas Vasco, Leioa, Spain, 2Hospital de Cruces, Barakaldo, Spain, 3ACIA-Microbiologa, Barcelona, Spain, 4Hospital laga, Spain Carlos Haya, Ma
Candida parapsilosis is an emerging major human pathogen that has dramatically increased in signicance and prevalence. C. parapsilosis is now one of the leading causes of invasive candidiasis in Spain and other Mediterranean countries. However, this species has been recently split in at least three different species Candida parapsilosis sensu stricto, Candida orthopsilosis, and Candida metapsilosis. Objective: To determine the in vitro activity of current and new antifungal agents against C. parapsilosis, C. orthopsilosis, and C. metapsilosis. Methods: In vitro activities of current (5-uorocytosine, amphotericin B, uconazole and itraconazole) and new (anidulafungin, caspofungin, micafungin, posaconazole and voriconazole) antifungals were assessed by Sensititre YeastOne 9 (Trek Diagnostics Systems, USA) against 25 C. parapsilosis, 11 C. orthopsilosis, and eight C. metapsilosis. MICs were determined at the recommended endpoints and time intervals by manufacturers and CLSI M27-A3 document. Results: All antifungals tested were very active against most isolates of C. parapsilosis, C. orthopsilosis, and C. metapsilosis. Only one isolate of C. parapsilosis were inhibited by MICs of 1632 lg ml-1 of uconazole at 48 h. Echinocandins were more active against C. orthopsilosis and C. metapsilosis than against C. parapsilosis. However, differences were observed among echinocandins against C. parapsilosis. 5, 3 and 0 isolates of C. parapsilosis were inhibited at 48 h by MIC > 2 lg ml-1 of anidulafungin, caspofungin and micafungin, respectively. MIC50 and MIC90, MIC range and geometric mean values in microgram per milliliter at 24 h were the following: C. parapsilosis, 5-uorocytosine (0.125/0.125/0.060.5/0.113), amphotericin B (0.5/0.5/0.250.5/ 0.369), itraconazole (0.125/0.25/0.030.25/0.104), uconazole (1/ 2/0.54/0.973), posaconazole (0.06/0.125/0.0080.25/0.042), voriconazole (0.03/0.06/0.0080.125/0.022), anidulafungin (1/2/ 0.252/1.117), caspofungin (0.25/0.5/0.1251/0.330), and micafungin (0.5/1/0.1251/0.529). C. metapsilosis, 5-uorocytosine (0.06/ 0.06/0.0664/0.113), amphotericin B (0.5/1/0.251/0.500), itraconazole (0.125/0.125/0.060.5/0.109), uconazole (2/8/0.2516/ 1.763), posaconazole (0.06/0.125/0.0080.125/0.037), voriconazole (0.03/0.06/0.0080.25/0.028), anidulafungin (0.125/0.5/0.030.5/ 0.182), caspofungin (0.125/0.5/0.031/0.170) and micafungin, (0.25/0.5/0.0150.5/0.182). C. orthopsilosis, 5-uorocytosine (0.06//0.061/0.085), amphotericin B (0.25//0.250.5/0.273), itraconazole (0.125//0.060.25/0.135), uconazole (2/-/0.062/ 0.973), posaconazole (0.03/-/0.0150.125/0.039), voriconazole (0.015/-/0.0080.06/0.020), anidulafungin (0.5//0.1251/0.386), caspofungin (0.25/-/0.060.5/0.210) and micafungin, (0.125/-/0.06 0.25/0.136). Conclusions: Current antifungals, posaconazole and voriconazole were very active against C. parapsilosis, C. orthopsilosis, and C. metapsilosis. Echinocandins were more active against C. orthopsilosis, and C. metapsilosis. Anidulafungin, caspofungin and micafungin showed differences in their in vitro activities against C. parapsilosis sensu stricto. Funding: Projects GIC07 123-IT-22207 (Departamento de Educa cion, Universidades e Investigacion, Gobierno Vasco), S-PE08UN35 (Saiotek 2008, Departamento de Industria, Comercio y Turismo,
Inuence of serum on in vitro susceptibility testing of echinocandins for Candida parapsilosis and Candida guilliermondii Z. Saribas, P. Yurdakul, G. Cetin and S. Arikan Hacettepe University Medical School, Ankara, Turkey Objectives: Candida guilliermondii and Candida parapsilosis are less
susceptible to echinocandins (caspofungin-CAS, micafungin-MICA, and anidulafungin-ANID) in vitro, as compared to other Candida species. The inuence of serum on the results of in vitro echinocandin susceptibility testing has been one of the recent areas of interest. The purpose of this study is to evaluate and compare the effect of human serum on the in vitro susceptibility testing of CAS, MICA, and ANID, specically against the less candin-susceptible Candida species, C. guilliermondii and C. parapsilosis. Methods: A total of 76 clinical isolates (64 C. parapsilosis and 12 C. guilliermondii) were included in the study. Broth microdilution susceptibility testing was performed according to the CLSI M27-A3 method and in absence and presence of 50% sterile human serum (Sigma Aldrich, St. Louis, MO, USA). Based on the results of the preliminary studies, the nal drug concentrations were selected in the range of 5121 lg ml-1 for CAS, 320.06 lg ml-1 for MICA, and 64 0.125 lg ml-1 for ANID. MICs were read after 24 and 48 h of incubation. Since the wells containing human serum were totally turbid and hard-to-read after agitation, two alternative methods of visual reading without agitation (Dr Nathan Wiederhold and Dr Zekaver Odabasi, personal communication) were evaluated for all tests with and without serum. For this purpose, following the respective incubation period, the turbidities of the corresponding pellets in the wells were graded (from one to four) either (i) directly after being taken out of the incubator and as based on the density of the precipitate or (ii) after being centrifuged. Since these two methods of reading demonstrated identical MIC values (data not shown), direct reading (i) was chosen for the rest of the experiments and MICs were read at MIC-2 endpoint for all tests. For comparison and where needed, MIC off-scale values were converted to the next highest dilution. Results: The 24 h MIC results are shown in the Table.
Conclusions: (i) Presence of serum tends to alter the MICs of all

three echinocandins. This change is mostly towards generation of a higher MIC. (ii) The amount of increase in MIC in presence of serum is variable. However, considering the results obtained for most of the isolates and all three drugs, the MIC fold change range is 35 and 24 for C. parapsilosis and C. guilliermondii, respectively. (iii) The inuence of serum on MICs is in general similar for CAS, MICA, and ANID, with minor differences. The inuence is highest with MICA for C. parapsilosis and with ANID for C. guilliermondii. (iv) Further studies are required for evaluation of these in vitro results.
34
P016
Antifungal activity of chemical and physical agents against clinical and environmental strains of Candida parapsilosis A.P. Silva, C. Pina-Vaz and A. G. Rodrigues University of Porto, Porto, Portugal Objective: There is limited information on the effectiveness of
chemical and physical agents vs. C. parapsilosis strains. Futhermore, whether exist differences between clinical and environmental strains. The purpose of the present study was to evaluate the activity of chemical and physical agents against clinical and environmental strains of C. parapsilosis. Material and Methods: Eight clinical and eight environmental strains of C. parapsilosis were studied. All isolates were obtained either from patients admitted at Hospital S. Joa Porto, or from the o, environmental of the same hospital. The potential of different chemical (chlorhexidine, ethanol, sodium hypochlorite, phenol, hydrogen peroxide and cupric sulphate) and physical agents (heating at 60 C, microwave and ultraviolet irradiation) to inactivate C. parapsilosis was evaluated. For chemical agents, susceptibility was determined using a microdilution method (M27-A3 protocol from CLSI). Regarding physical agents, the kinetics of survival of blastoconidia during treatment were studied. Additionally, the assessment of primary cell membrane lesion was evaluated using a cytometric assay with propidium iodide. Results: The concentration of 0.06% of chlorhexidine, 10% of ethanol, 25 ll ml-1 of sodium hypochlorite, 0.31% of phenol, 0.06% of hydrogen peroxide and 2 mg ml-1 of cupric sulphate, were lethal to all C. parapsilosis strains independently of its endogenous or exogenous origin. Regarding physical agents, following heating at 60 C for 5 min, microwave irradiation for 60 s or ultraviolet irradiation for 10 min, a reduction of at least three log in C. parapsilosis growth was registered. In ultraviolet irradiation and heating at 60 C treatments, the reduction in environmental strains were lowest than the reduction in clinical strains. Propidium iodide staining demonstrated that treatment with chlorhexidine, sodium hypochlorite, cupric sulphate and heating at 60 C (45 min) and microwave irradiation (90 s) causes serious primary cell membrane lesions. Conclusions: For disinfection of surfaces and hand washing, chlorhexidine proved to be very effective against C. parapsilosis. For food and water treatment, heating at 60 C and microwave irradiation were found to be effective physical agents. Regarding the other chemical and physical agents tested, its potential to reduce contamination was dened; such data might be of use in the formulation of new products and protocols for hospital cleaning disinfection. Generally, the sensitivity of C. parapsilosis clinical and environmental strains to chemical and physical agents did not varied signicantly. Acknowledgement: A.P. Silva is supported by grant no. SFRH/BD/ 29540/2006 from Science and Technology Foundation (FCT), Portugal.
Methods: We studied a global of 55 isolates of Aspergillus spp. (21

A. fumigatus, 17 A. terreus, 16 A. avus and one A. glaucus) isolated from clinical specimens. The MD reference susceptibility testing was performed following the CLSI M38-A2 document. Stock inoculum suspensions were prepared from 4-days-old cultures grown on potato dextrose agar and adjusted spectrophotometrically with saline solution to ~80% transmittance. The Sensititre Yeast One was performed following the manufacturers instructions, and read the minimum effective concentration (MEC), dened like the lowest concentration of drugs causing abnormal hyphal growth, and MIC (80% of growth inhibition) at 48 h. Reference strains: A. fumigatus ATCC 204305 and A. avus ATCC 204304 and QC: C. parapsilosis 22019 and C. krusei 6258 were included in each susceptibility test for quality control and assessment of reproducibility. Results: All strains were susceptible to three equinocandins tested. Excellent agreement was found with anidulafungin and micafungin as all isolates showed MICs/MECs 0.015 lg ml-1 with anidulafungin and 0.008 lg ml-1 with micafungin by S but lower dilutions should be tested as MICs were 0.03 lg ml-1 by MD for both antifungal agents and we can not determine the concordance to low concentrations. However, lower agreement was obtained with caspofungin due to lower MECs by Sensititre Yeast One. Moreover, with caspofungin MECs results were one or two dilution lower than MICs results obtained by S. Conclusions: (i) All strains of Aspergillus spp were susceptible by both methods, with excellent agreement with anidulafungin and micafungin. (ii) Sensititre Yeast One could be an useful method for testing susceptibility of echinocandins against Aspergillus spp although additional studies are needed with other concentrations range.
P018
Comparison of inhibitory and fungicidal activities of ve triazoles against clinical isolates of Trichosporon asahii G. Cetin and S. Arikan Hacettepe University Medical School, Ankara, Turkey Objectives: Trichosporon asahii is a signicant cause of morbidity
and mortality in immunocompromised patients and treatment of Trichosporon infections remains difcult. Trichosporon species are mostly resistant to the fungicidal activity of amphotericin B and show primary resistance to echinocandins. While triazoles remain as the current and main antifungal agents of choice for treatment of Trichosporon infections, limited data are available comparing the activities of different triazoles against this genus. The aim of this study is to determine minimum inhibitory (MIC, lg ml-1) and minimum fungicidal concentrations (MFC, lg ml-1) of uconazole (FLU), itraconazole (ITRA), voriconazole (VORI), posaconazole (POS), and isavuconazole (ISAVU), and compare the inhibitory and cidal activities of these triazoles against clinical isolates of T. asahii. Methods: Ninety clinical isolates were tested. MICs were determined using CLSI M27-A3 microdilution method. MIC-0 (complete inhibition of growth) and MIC-2 (~50% reduction in turbidity compared to the growth control well) endpoints were recorded. MFCs were determined by the method reported by Canton et al. (DMID 2003; 45: 203206), using 104 cfu ml-1 inoculum size and > 99.9% killing criterion. MIC and MFC results were read at both 24 and 48 h of incubation. Results: MICs and MFCs obtained at 48 h are shown in the Table. Conclusions: (i) FLU exhibits highest MICs and MFCs and limited or no in vitro activity against T. asahii. (ii) VORI, ISAVU, POS, and ITRA show favorable and similar activities in vitro with minor differences. MICs and MFCs of these four drugs are within a narrow range of at most 3 two-fold dilutions of one another. (iii) VORI exhibits the lowest MICs and MFCs of all drugs tested. (iv) MIC-2 endpoint yields 13 two-fold dilution lower MICs in general as compared to MIC-0. (v) These in vitro results warrant further evaluation and in vivo validation.
P017
Evaluation of Sensititre Yeast One in susceptibility testing of echinocandins against Aspergillus spp. M. Trinidad1, C. Castro2, A. I. Martos2, A. Romero2, E. Canton2 and E. Martin-Mazuelos2 1 Hospital of Valme, Seville, Spain, 2Hospital la Fe, Valencia, Spain Objectives: In the last years the resistance to established antifungal
agents has increased, so there remains the need for new agents and susceptibility testing to know the resistance pattern. Echinocandins are new antifungal drugs that may promise for the treatment of invasive fungal infections. We assessed the suitability of the colorimetric method Sensititre Yeast One (S) for testing the susceptibility of different Aspergillus species to anidulafungin, caspofungin and micafungin by comparing with the reference method (MD) (CLSI, M38-A2).
35
Table 1 GM: geometric mean
Conclusion: These results suggest that both methods provide good quantitative and qualitative correlation with the CLSI broth microdilution. VITEK 2 can also provide an automated method that allows the identication of most yeasts. This system offers a faster method for susceptibility testing than E-test and has the advantage of spectrophotometrically reading.
P020
In Vitro Activities of Antifungal Agents Against Rhodotorula Species T. Pelaez, B. Gama, P. Munoz, M. J. Ruiz-Serrano, J. Guinea, R. Flores, M. Pedromingo and E. Bouza o Hospital Gregorio Maran n, Madrid, Spain Objective: Rhodotorula species has emerged as a pathogen that
mainly infects immunosuppressed patients with or without a central venous catheter. Despite the increased incidence of invasive infection due to Rhodotorula species in the last decade, data on the antifungal susceptibility of this species are limited. This study reports the epidemiology and susceptibility data for the clinical isolates of Rhodotorula species in our institution. Methods: From 1988 to 2008, 252 isolates of Rhodotorula species were recovered from 250 patients. MICs were determined using the E-test. The antifungal agents tested were amphotericin B (AMB), uconazole (FZ), itraconazole (IZ), voriconazole (VZ), posaconazole (POS), and caspofungin (CAS). Results: We divided the study into two periods: 198898 (86 isolates/86 patients) and 19992008 (166 isolates/164 patients). Most of the isolates (173, 69%) were identied as Rhodotorula mucilaginosa (formerly R. rubra), 59 (23%) as Rhodotorula glutinis, 5 (2%) as Rhodotorula minuta, and 15 (6%) as Rhodotorula species on the basis of morphological and biochemical features. Clinical isolates were obtained from a variety of clinical sources: skin (n = 64), nails (n = 63), tissue biopsy specimen (n = 25), respiratory tract (n = 24), oropharynx (n = 24), abscesses (n = 16), urine (n = 10), CSF (n = 8), peritoneal uid (n = 6), blood (n = 5), vagina (n = 5), and other sites (n = 2). The MIC ranges (lg ml-1) of all antifungal agents tested against the 41 available clinical isolates of Rhodotorula species from deep sites were as follows: AMB (0.52), FZ (8 to > 256), IZ (0.0616), VZ (0.038), POS (0.0116), and CAS (4 to > 32). The geometric means (GMs) of the MICs and MICs90 were: AMB (1.6/2), FZ (44.1/ > 256), IZ (0.6/16), VZ (0.5/8), POS (0.3/16), and CAS (12.2/> 32). Most of the isolates were inhibited by < 1lg ml-1 of amphotericin B, the most active drug in vitro against Rhodotorula species. Conclusion: To our knowledge, this is the most extensive report of susceptibility data for Rhodotorula species, which is isolated with increasing frequency in our institution. We show that most of the isloates were resistant in vitro to uconazole and caspofungin. Amphotericin B showed the best in vitro activity against clinical isolates of Rhodotorula species.
P019
Voriconazole susceptibilities of Candida spp isolates as determined by the CLSI reference method (M27-A3) and two other commercial methods. M. Trinidad1, A. Gonzales1, A. Romero1, E. Canton2, J. Peman2, G. Quindos3 and E. Martin-Mazuelos3 1 Hospital of Valme, Seville, Spain, 2Hospital la Fe, Valencia, Spain, 3 Universidad de; Pais Vasco, Bilbao, Spain Objectives: The evaluation of an automated commercial method
AST-YS01 card (VITEK 2, bioMerieux) and an agar diffusion method (E-test, AB BIODISK) for determining susceptibility to voriconazole by comparing the MICs obtained by these methods with those of the M27-A3 broth microdilution method (BMD). Although there is a reference method for yeast susceptibility testing, it is not be the most convenient for use in routine in clinical laboratories, so it is important the performance of new methods. Recently has been incorporated a new card to use with the VITEK 2 system. This automated method allows as the identication as the susceptibility testing of most yeasts. Methods: A total of 99 yeast isolates were evaluated (73 Candida albicans, 21 Candida glabrata and six Candida tropicalis). E-test and the VITEK 2 system was performed in accordance with the manufacturers instructions and read at 24 h. Broth microdilution method was performed according to the CLSI document M27-A2. Discrepancies among MIC endpoints of +/- two dilutions were used to calculate the percentage of agreement and categorical agreement (CA) was calculated based on breakpoints published in the M27-A3 document. Major errors (ME) were dened as susceptible (S) by reference method and resistant (R) by the other, while minor errors are considered when MIC indicates S by a method and susceptible doses dependent (SDD) by the other. Very major errors were identied when the result is R by reference procedure and S by the other method. Results: The overall percentage of agreement between VITEK 2 and BMD was 97% and 96% when comparing E-test with BMD. Also similar excellent categorical agreement was found in both comparisons. The best agreement was found with VITEK 2 and C. tropicalis. Only one very major error was found as with VITEK 2 as with E-test. The same isolate was R by BMD and S by the other two methods.
P021
Etest antifungals susceptibility testing directly from blood culture S. Costa de Oliveira1, A. P. Silva1, F. Alves2, C. Correia2, A. G. Rodrigues1 and C. Pina-Vaz2 1 o o, Porto Faculty of Medicine, Porto, Portugal, 2Hospital de Sa Joa Porto, Portugal Objective: Fungaemia is associated with high mortality rate. Blood
cultures have become one of the most critically important tests in the clinical microbiology laboratory. Semi-automatic systems are used to detect growth of microorganisms but subcultivation is mandatory for identication or to perform susceptibility testing. This demands too much time for critically ill patients Antifungal susceptibility prole is
36
important but still is a cumbersome and lengthy procedure. The purpose of this study was to evaluate Etest susceptibility to the main antifungals directly from blood culture, as soon as growth is detected by BACTEC system. Candida strains, with a known susceptibility prole, were inoculated on blood culture bottles and Etest immediately performed after growth detection by the automatic system. The results were compared with the reference method (CLSI, M27-A3). Methods: An inoculum of ve Candida cells per milliliter was suspended on Myco/F Lytic medium and incubated in the Bactec 9000 system (Becton Dickinson, Sparks, Md.). A total of 40 Candida strains (14 C. albicans, 13 C. parapsilosis, ve C. glabrata, four C. krusei and four C. tropicalis) with different antifungal phenotypes determined by microdilution method (CLSI, M27-A3 protocol) were evaluated. Whenever the automatic system gave a positive result, aliquots was plated in RPMI agar (BioMerieux, Paris) and MIC to six different antifungals (amphotericin B, uconazole, voriconazole, posaconazole, caspofungin and anidulafungin) was determined using Etest (ABiodisk, Sweden). Minimal inhibitory concentration (MIC) was registered after 24 h of incubation at 37 C and the results compared with values obtained following the microdilution method. Phenotypes were compared according to published CLSI breakpoints. Results: Regarding amphotericin B no discrepant results were found for echinocandins, one discrepant result for caspofungin and four for anidulafungin were found. Concerning azoles, a larger number of discrepant results were found: for uconazole in 19 cases (47.5%), for voriconazole in 15 cases (37.5%) and for posaconazole in 12 cases (30%). The majority of the errors were found with C. albicans . Etest was able to detect all resistant phenotypes; most errors involved susceptible phenotypes that were reported as resistant. Conclusion: Antifungal susceptibility testing with Etest directly from blood culture is a quick and practical method to perform susceptibility testing although it overestimates the resistance regarding azoles. Acknowledgments: S Costa de Oliveira and A P Silva are supported by the grants SFRH/BD/27662/2006 and SFRH/BD/29540/ 2006, respectively, from Portuguese Science and Technology Foundation (FCT).
voriconazole. Concerning the echinocandins elevated MICs were observed for C. glabrata, C. parapsilosis, C. guilliermondii and C. lusitaniae. However, only two strains of C. parapsilosis showed MICs > 2 mg L-1 against anidulafungin and micafungin thus indicating resistance. Conclusion: Up to date our multicenter study reveals no evidence of emerging azole or echinocandin resistance among invasive clinical isolates of Candida spp.
P023
Deep rare mycoses in the broader area of Athens, Greece; sensitivity to Amphotericin B, Posaconazole and Caspofungin alone and in combination using the checkerboard method A. Skiada1, F. D. Mantopoulou1, M. Drogari-Apiranthitou1, E. Cuenca-Estrella2, J. L. Rodriguez-Tudela2, K. Tzanetou3, E. Petrikkou1, A. Mitroussia-Ziouva4, G. L. Daikos4 and G.L. Petrikkos1 1 Laikon Hospital, University of Athens, Athens, Greece, 2Instituto de Salud Carlos III, Madrid, Spain, 3Gennimatas General Hospital, Athens, Greece, 4University of Athens, Athens, Greece Objectives: Fungi of the mucorales order (zygomycetes), previously
uncommon hyaline lamentous fungi as well as dematiaceous lamentous fungi are increasingly encountered as causing disease. They are capable of causing a wide variety of infections, particularly in immunocompromised hosts such as hematological patients and stem-cell and solid-organ transplant recipients, and are difcult to manage because of lack of specic therapeutic recommendations. All these emerging infections are associated with high morbidity and mortality, and with resistance to old antifungal agents. The aim of this prospective study was the isolation of moulds causing these infections, the identication of the isolates and the investigation of their in vitro susceptibility to Amphotericin B, Posaconazole and Caspofungin. Methods: During the period January 2005 to January 2009, 27 strains from equal number of patients with invasive infections were isolated, including isolates from collaborating hospitals of the broader Athens area. They were identied morphologically to genus and molecularly to species level. Some molecular results are pending. Of the 27 isolates 20 (19 of the Rhizopus genus and 1 Mucor circinelloides) were tested for their sensitivity to antifungals. The MICs were determined according to the methods proposed by the EUCAST with minor modications. Furthermore, antifungal combination testing was carried out by using the checkerboard broth microdilution method. Combinations studied were: amphotericin B - posaconazole, amphotericin B - caspofungin and caspofungin - posaconazole. Results were interpreted by calculating the fractional inhibitory concentration indexes (FIC). Results: Of the 27 strains 10 were Rhizopus arrhizus, three Rhizopus microsporus, ve Rhizopus spp., two Trichoderma spp., one Mucor circinelloides, one Mucor spp., one Lichtheimia ramosa (former names Absidia, Mycocladus), one Fusarium solani,one Fusarium spp, one Paecilomyces lilacinus and one Bipolaris spp. Of the 20 isolates, 17 were sensitive to Amphotericin B, with MICs ranging 0.251 lg ml-1, median 0.5 lg ml-1. The three resistant were two of the genus Rhizopus and one Mucor circinelloides. The MICs of posaconazole ranged between 0.2516 with a median value of 4 lg ml-1. Six out of 20 strains, all R. arrhizus had Posaconazole MICs lower or equal to 1 lg ml-1, indicative of susceptibility to this drug. All isolates tested were resistant to caspofungin (MIC range 3264 lg ml-1). When Amphotericin B and Posaconazole were combined, growth of 11 out of 20 strains was inhibited (FIC< 0.5, indicative of synergy). The combination amphotericin B - caspofungin resulted in growth inhibition of nine strains and the combination caspofungin - posaconazole inhibited the growth of 16 strains. Antagonism was in no case observed. Conclusions: Fungi causing rare infections are increasingly encountered in our area.Most of the strains tested were susceptible to Amphotericin B, the antifungal of choice for these infections, but resistant to posaconazole or caspofungin. However, when these drugs
P022
In vitro susceptibilities of invasive Candida spp. isolated from Austrian patients against echonocandins and the commonly used azoles uconazole and voriconazole B. Willinger, L. Sittenthaler, E. Steiner and A.M.H. Hirschl Institute of Hygiene and Medical Microbiology, Vienna, Austria Objective: The aim of the study was to determine the in vitro
susceptibilities of invasive Candida isolates collected since June 2008 by 20 different Austrian medical centres against commonly used azoles and echinocandins - caspofungin, anidulafungin and micafungin. Methods: The clinical samples yielding the growth of Candida spp. included blood cultures and other sterile specimens such as intravascular catheters, biopsies or aspirates, samples from the lower respiratory tract such as bronchoalveolar lavage (BAL), and swabs collected from infected wounds. Antifungal susceptibility was assessed using a broth microdilution method following the Clinical Laboratory Standards Institute M27-A2 guidelines. Results: So far 365 isolates have been collected and tested. Of these isolates, species distribution was 65% C. albicans, 16% C. glabrata, 7% C. parapsilosis, 5.5% C. tropicalis, and 2.2% C. krusei. The remaining 4% consisted of C. dubliniensis, C. lusitaniae, C. guilliermondii, C. kefyr, C. valida and C. pelliculosa. The MIC50 and MIC90 were 4 mg L-1 and 8 mg L-1 for uconazole, 0.03 mg L-1 and 0.25 mg L-1 for voriconazole, 0.5 mg L-1 and 1.0 mg L-1 for caspofungin, 0.06 mg L-1 and 0.5 mg L-1 for anidulafungin, 0.25 mg L-1 and 1 mg L-1 for micafungin, respectively. Thus, the agent with the best in vitro activities for the azoles was voriconazole and for the echinocandins anidulafungin. Only a low incidence of resistance was evident. 2.7% of Candida isolates were resistent to uconazole, 1.9% to voriconazole, 1.4% to anidulafungin and 1.5% to micafungin respectively. All strains were susceptible to caspofungin. 15.5% of C. glabrata strains were resistant to uconazole, and 10.9% to
37
were combined, synergy was observed. Clinical trials are needed to conrm these encouraging in vitro results in the clinical practice. Acknowledgements: This study was partially sponsored by the KapodistriasProgram of the National University of Athens.
P024
Survey of antifungal effects of Razak (humulus lupulus plant) on Fusarium sp.,penicillum sp. and Aspergillus sp. using of in vitro method N. Nasrollahi Omran1, B. Babakhani2, S. Mohammadi Nakhjiri1 and J. Hashemi3 1 Islamic Azad University of Tonekabon branch, Tonekabon, Iran, 2 Sciences of plant physilogy, Tonekabon, Jamaica, 3School of Public Health Insite of Research, Tehran, Iran
For this purpose,the hydroalcohlic extract of Razak were prepared by use of microdulation method in propyleneglical as solvent. Then sabauroud media (s) containg 1 mg ml, 2 mg ml, 3 mg ml, 4 mg ml, 5 mg ml, 6 mg ml, 7 mg ml, 10 mg ml of Razak extract were prepared. The fungal were grown on at 25 c for 3 and 7 days in sabouraud agar media. Six millimeter pluqs were cutout from fresly grown colonies by use of puncher, and then placed on the above mentiond media at sterile condition .Replicate culture were setup for each fungus.The mean colony diameters of each fungus was measures 3 and 7 days of incubation at 25 c and percentage of growth reduction was calculated. Discks contacting different concentration of Razak extract were placed on the surface of agar the mean diameter of the Zone of inhibition around each disck was measured after 3 and 7 days of incubation at 25 c. The results showed that the growth of Fusarium solani, Fusarium oxysporum,penicillum marneffei was complet inhibited by 7 mg ml of Razak extract.While the total growth inhibition of Aspergillus spp(fumigates,avus and niger) was observsed with 10 mg ml. Our ndings illustrate how membrane-active compounds can be effective fungicidals and may pave the way to developing membrane-selective agents.
the Candida species, the most prominent was C. albicans (65%) followed by C. glabrata (15.3%) and C. parapsilosis (6.2%). Notably, the distribution of the more frequent candidemia strains over the period 20062008 was: C. albicans 29.4%, C. glabrata 19.6% and C. parapsilosis 33.3%, whereas the respective percentages in the previous years were 63.2, 14.2 and 18.8. Of all yeasts tested, 87% were sensitive to uconazole and 90% were sensitive to voriconazole. Of all strains resistant to uconazole, 29.8% were sensitive to voriconazole. Of the Candida isolates, the most resistant were the C. krusei (80% and 30% resistant to uconazole and voriconazole respectively) but it represented only 2.7% of all yeasts. Of the C. glabrata strains 16.5% were resistant to both antifungals. Isolates from skin/soft tissue and biliary tract gave the highest sensitivity to both antifungals (100% of strains) whereas isolates from miscellaneous uids, upper respiratory, lower gastrointestinal tract and blood gave the lowest (78.6%, 82.9%, 84.6%, 80.6% and 78.6%, 82.9%, 84.6%, 88.7% for uconazole and voriconazole respectively). More resistant strains derived from the Internal Medicine Ward and the ICU, followed by the surgical department. Conclusions: Only a small proportion of yeasts isolated in our hospital were resistant to uconazole and even less were resistant to voriconazole. A shift towards non-albicans and more resistant strains were noted during the last 3 years compared to previous years when candidemia strains were analysed. These organisms could probably be a future threat to optimal antifungal therapy and this is why ongoing monitoring of the local epidemiology and susceptibility testing when appropriate is so important.
P026
Susceptible patterns of Candida species isolates from a Portuguese oncology population - changing strategies? C. Lameiras, F. Faria, P. Silva and M. A. Guimaraes Portuguese Oncology Institute, Porto, Portugal Introduction: The emergence of non-Candida species infections with
reduced susceptibilities to the uconazol have emphasized the need for investigate laboratory data to guide clinicians in selecting appropriate antifungal therapy, particularly in patients with prior azoles exposure. Objectives: The aim of the present study was to determine the antifungal susceptibility of Candida spp. isolates from immunocompromised and immunosuppressed cancer patients to new antifungal azoles (Voriconazol and Posaconazol) and echinocandin agents (Anidulafungin), in order to establish the best strategies for optimal management of patients with invasive candidiasis or Candida colonization within the critical setting. Methods: CLSI/NCCLS MICs of antifungal agents were determined for 94 Candida spp. isolates by the Etest using standard RPMI-1640. Six Candida spp ATCC were used. Candida spp. clinical isolates were recovered from various sites of infection (blood cultures, deep or supercial sites) from patient in intensive care unit, hematology department, bone marrow transplant department and surgical department during 2008. Results: In the sample studied, C. albicans was the most commonly isolated species, accounting for 50% (47/94) of the isolates followed by C. krusei (14.9%; 14/94), C. glabrata (13.8%; 13/94), C. parapsilosis (11.7%; 11/94), C. tropicalis (7.4%; 7/94), C. lusitanea (1.1%; 1/94) and C. guillermondi (1.1%; 1/94). All C. albicans isolates were sensitive to uconazole, voriconazole, posaconazole and anidulafungin. Resistance to uconazole was detected in 53.8% of C. glabrata and in all C. krusei isolates. In 3.2% of C. glabrata cases voriconazole was detected with a MICs of 4 lg ml-1 (n = 3) with the MIC50/90 of 0.25/25.6 (range 0.00832 lg ml-1). In seven cases of isolates (7.4%), posaconazole (POS) was found with a higher MIC. In ve C. glabrata isolates, POS MIC50/90 was of 1/32 (range 0.00832), in one C. tropicalis POS MIC50/90 0,047/12(range 0.01612) and in one C. guillermondi POS MIC = 1.5. C. parapsilosis was in 63,6% of the cases detected with a MIC 2 for anidulafungin (MIC50/90 of 8/32; range 0.3832). Anidulafungin was also observed with a MIC 2 in the only case of C. guillermondi isolated (MIC = 32).
P025
Results from the ARTEMIS antifungal surveillance study in Greece, 2001 to 2008: analysis of Yeast Species distribution and susceptibilities. A. Skiada1, I. Anyfantis1, M. Drogari-Apiranthitou1, L. Hadjihannas1, L. Kanioura1, I. Stefanou2, A. Avlami2, A. Mitroussia-Ziouva3 and G. L. Petrikkos1 1 Laikon Hospital, University of Athens, Athens, Greece, 2Laikon Hospital, Athens, Greece, 3University of Athens, Athens, Greece Objectives: The objectives of the study were to monitor the
epidemiology and sensitivity of yeast isolates in our hospital using a low cost, reproducible and accurate standard susceptibility in vitro test. Methods: The ARTEMIS Global Antifungal Susceptibility Program provides the collection of epidemiological data and the results of the uconazole and voriconazole susceptibility testing of yeast isolates worldwide. Our laboratory, as part of this program, tested the in vitro susceptibility of yeasts to these two antifungals using the CLSI disk diffusion methodology. The BIOMIC System was used to electronically read the test plates and to collect well controlled quantitative data. From January 2001 through December 2006, specimens of all types (blood, lower respiratory tract, skin/soft tissue, genital, urinary tract, miscellaneous uids etc.) were collected and analysed. To examine shifts in the strain distribution from cases with candidemia, 51 additional Candida strains isolated from blood cultures from January 2006 to December 2008 were analysed and compared to previous years. Results: A total of 733 different species/organism groups were isolated, of which 712 were Candida spp, (97.1%). The non-Candida yeasts were Saccharomyces cerevisiae (15 strains), three Rhodotorula spp. one Cryptococcus albidus, one Pichia spp. and one unidentied yeast. Of
38
Conclusion: In our study, Etest method showed to be rapid and easy

to perform and that can be used in our routine laboratory. Our results demonstrated that uconazole remains active against Candida albicans and some C. glabrata showed to be less susceptible to Posaconazol. Anidulafungin show to be a good choice for treatment of invasive candidiasis in cases of C. glabrata and C. krusei infections.
P027
In vitro dynamic model for studying the effect of delay exposure of antifungal drugs to Aspergillus avus conidia and hyphae using growth curves analysis J. Meletiadis, K. Krompa, L. Zerva Attikon University General Hospital, Athens, Greece Background: Aspergillus avus infections are the second most common Aspergillus infections and they are associated with signicant morbidity and mortality in immunocompromised patients. Delay administration and suboptimal exposure of antifungal drugs may be detrimental for infections caused by A. avus. Therefore, we study the pharmacodynamic characteristics of supra and sub MIC (minimal inhibitory concentrations) concentrations of amphotericin B, voriconazole and caspofungin exposed to A. avus conidia and hyphae of different growth stages with and without delay using growth curves analysis. Methods: Inocula of 104 CFU ml-1 from three clinical isolates of A. avus were prepared in 200 ll RPMI1640+MOPS and incubated inside the wells of a 96-well atbottom microplate at 37 C for 96 h. The MIC (complete visual growth inhibition) of amphotericin B and voriconazole was 1 and 0.251 mg L-1 for all three isolates, respectively. The minimal effective concentrations (MEC) of caspofungin were 0.5 1 mg L-1 for all isolates. Drugs were added into corresponding wells at nal concentrations of 0.25 , 1 , and 4 MIC (or MEC for caspofungin) after 0 h, 24 h, 48 h and 72 h of incubation. The turbidity of each well was monitored continuously by measuring the optical density at 630 nm every 15 min. Growth curves were constructed and fungal growth before and after addition of the drugs was compared at each time point and for each concentration. Results: Amphotericin B completely inhibited fungal growth at 4 and 1 MIC but not at 0,25 MIC when added at 0 h, as expected. When 0.25 MIC of amphotericin B was added at any time point, there was no signicant change in fungal growth curves compared to that of drug-free control. At 1 and 4 MIC of AMB, fungal growth was reduced by 7% (0%16%) and 10% (4%18%), respectively at any time-point. Notably, when amphotericin B was added after 24 h of incubation, regrowth was observed 34 h and 13 h after addition of 4 MIC and 1 MIC of amphotericin B, respectively. When amphotericin B was added at 48 h or 72 h, regrowth was observed < 5 h after drug addition. Regrowth rates were 50% higher than growth rates of drug-free control. Voriconazole completely inhibited fungal growth at 4 and 1 MIC but not at 0.25 MIC when added at 0 h, as expected. No signicant change was observed when added at later time points. Caspofungin did not have any effect in A. avus growth curves at any time-point and concentration except a slight reduction of growth rates when 4 MEC was added at 0 h. Conclusion: Growth curves analysis revealed important pharmacodynamic characteristics of amphotericin B, voriconazole and caspofungin against A. avus hyphae. Delay exposure of amphotericin B resulted in regrowth at 1 MIC and 4 MIC of amphotericin B. Voriconazole and caspofungin had a minimal effect against A. avus hyphae.
(HAEPAL) on 11 fungal strains (Candida albicans ATCC64548, C. krusei ATCC6258, C. glabrata ATCC90030, C. lusitaniae ATCC200951, C. parapsilosis ATCC22019, Saccharomyces cerevisiae ATCC9763, Rhodotorula mucilaginosa LMIPK0282, Trichosporom asahii LMIPK0293, Cryptococcus grubii LMIPK0291 and LMIPK0292). The antifungal effect against these species has not been reported before. Method: The in vitro antifungal activity of HAEPAL was evaluated by a dilution procedures. Final concentration of the strains in the medium (Sabouraud-dextrose broth plus HAEPAL at 0%, 0.5%, 2.5%, 5%, 7.5% and 10%) was 0.5 103 cells ml-1. After 72 h of incubation at 30 C, dilutions (1/10, 1/100 and 1/1000) in distilled water were made and 10 ll of each dilution per strain per HAEPAL concentration were inoculated on Sabouraud-dextrose agar and incubated 24 h at 30 C and the number of colonies per milliliter was determined. The minimal inhibitory concentration was dened as the lowest concentration of the extract that inhibited growth at least 50% compared with the growth control for each strain. Results: HAEPAL 10% completely inhibited all the studied strains except C. glabrata which was inhibited by 50%. Total inhibition in presence of the extract at 7.5% was achieved for C. lusitaniae, C. parapsilosis, S. cerevisiae, R. mucilaginosa and C. grubii. MIC50 for the last four species was reached with HAEPAL 5%. Inhibition activity of lower concentrations of the extract was very weak. Conclusions: A signicant inhibitory effect of P. alliacea extract on the studied yeasts was observed. These results suggest a potential use of the evaluated extract as antimycotic treatment.
P029
In vitro activities of eight antifungal drugs against 18 Apophysomyces elegans isolates A. Chakrabarti1, M. R. Shivaprakash1, H. Badali2, I. Curfs-Breuker3, C. H. Klaassen3 and J. F. Meis3 1 Mycological Reference Centre, Chandigarh, India, 2CBS Fungal Biodiversity Centre, Utrecht, The Netherlands, 3Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Objective: Invasive mould infections caused by zygomycetes are
increasingly recognized. Most infections are opportunistic in patients with underlying disease, but the species Apophysomyces elegans is commonly isolated from immunocompetent patients. Though A. elegans was earlier believed to cause only cutaneous and subcutaneous infections, it has more recently frequently isolated from deep-seated infections. Despite major surgical and antifungal therapy this infection is life-threatening for many patients. Antifungal therapy is based on the experience of isolated case reports of A. elegans infection mostly involving amphotericin B (AmB). We aimed to test a selection of existing and new antifungal drugs against a collection of isolates of this rare primary pathogenic fungus. Purpose: To determine the in vitro activity of eight existing and new antifungal drugs against A. elegans. Methods: A collection of 15 clinical isolates of A. elegans were obtained from the Mycological reference Centre in Chandigarh, India and three isolates (two environmental) from the Fungal Biodiversity Centre, Utrecht, The Netherlands. Identication of all isolates was performed by ITS1,four sequencing. MICs were determined for AmB, uconazole (FLU), ITC, voriconazole (VOR), posaconazole (POS), isavuconazole (ISA) or MECs for caspofungin (CAS) and anidulafungin (ANI). Microdilution testing was done in accordance with CLSI M38A2 guidelines. Quality control was ensured by including Paecilomyces variotii (ATCC 22319) and Candida krusei (ATCC 6258). Results: A. elegans (n = 18) gave MIC ranges and MIC50 and MIC90 values (mg L-1) as shown in table.
P028
Evaluation of the antimycotic effect of Petiveria alliacea L M.T. Illnait-Zaragoz1, J. Illnait-Ferrer2 and A. Blanco Garca2 1 Instituto Pedro Kouri, Havana, Cuba, 2National Center of Scientic Research, Havana, Cuba Objective: Petiveria alliaceas antibacterial and anthelmintic effect
has been reported by different authors. The aim of this work was to study the antifungal effect of a hydroalcoholic extract of this plant
AmB
FLU
ITC
VOR
POS
ISA
CAS
ANI
Range 0.254 8>64 0.252 0.5>16 0.1251 0.125>2 2>16 0.016>8 MIC50 2 > 64 1 > 16 0.5 2 > 16 >8 MIC90 4 > 64 2 > 16 1 >2 > 16 >8
39
Conclusions: POS was the most active drug against these A.

elegans isolates followed by ITC and ISA. The new azole ISA had a four-fold lower MIC compared to VOR whereas the echinocandins had no activity. AmB exhibited relatively high MICs against Apophysomyces.
demonstrated potential in vitro activity, These drugs might be useful for treating a range of severe fungal infections particularly CNS infections, either alone or as part of a combination therapy regimen. However their clinical effectiveness in the treatment of cerebral infection remains to be determined.
P030
Use of AFLP analysis for identication of 29 neurotrophic Cladophialophora isolates with in vitro activities of eight antifungal drugs H. Badali1,2, G. S. de Hoog1, I. Curfs-Breuker3, C. H. Klaassen3 and J. F. Meis3 1 CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands, 2 School of Medicine, Mazandaran University of Medical Sciences, Sari, India, 3Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Objective: Invasive mould infections caused by dematiaceous fungi
are rare but increasingly recognized in human disease. The majority of cerebral infections are associated with Cladophialophora bantiana, which are, despite surgical and antifungal therapy, still life-threatening conditions. Cladophialophoraspecies show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Amplied fragment length polymorphism (AFLP) analysis as an identication method for medically important C. bantiana was investigated. Antifungal therapy is based on the experience of isolated case reports which mostly involved amphotericin B (AmB), itraconazole (ITC) and 5-ucytosine.Therefore we have tested a total of eight new and established antifungal drugs against 29 clinical isolates of this rare neurotropic fungus. Methods: A collection of 24 clinical isolates of C. bantiana and ve clinical strains of other neurotropic Cladophialophora spp. were obtained from the CBS-KNAW Fungal Biodiversity Centre in Utrecht, The Netherlands. MICs were determined for AmB, uconazole (FLU), ITC, voriconazole (VOR), posaconazole (POS), isavuconazole (ISA) or MECs for caspofungin (CAS) and anidulafungin (ANI). Microdilution testing was done in accordance with CLSI M38-A2 guidelines. Inoculum was adjusted spectrophotometrically (530 nm) to optical densities that ranged from 0.170.15 in RPMI 1640 MOPS broth with L-glutamine without bicarbonate. Plates were incubated at 35 C for 72 h. The MIC was determined visually as the lowest concentration of drug showing absence of growth or for uconazole 50% reduction of growth compared with that of the growth control. For the echinocandins the MEC was microscopically determined as the lowest concentration of drug that leads to the growth of small, rounded, compact hyphal forms as compared with the long, unbranched hyphal clusters that were seen in the growth control (drug free). Drug and fungus free controls were included. Quality control was ensured by including Paecilomyces variotii (ATCC 22319) and Candida krusei (ATCC 6258). Results: AFLP patterns exhibited very clear differences between C. bantiana and other neurotropic strains. C. bantiana (n = 24) gave the following MIC ranges, MIC50 and MIC90 values (mg L-1).
P031
Microdilution in vitro susceptibility of agents of chromoblastomycosis, Fonsecaea pedrosoi and Fonsecaea monophora, for eight antifungal agents H. Badali1,2,3, M. J. Najafzadeh1,2, G. S. De Hoog1,2, I. Curfs-Breuker4 and J. F. Meis4 1 CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands, 2 Insitute of Biodiversity and Ecosystem Dynamics, University of Amsterdam, Amsterdam, The Netherlands, 3School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran, 4Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Objective: Chromoblastomycosis is a chronic, progressive disease of
cutaneous and subcutaneous tissues characterized by nodular and verrucous lesions. Proven causative agents include Cladophialophora carrionii, Phialophora verrucosa, Rhinocladiella aquaspersa, Fonsecaea pedrosoi and F. monophora. The latter two fungi are the most common agents of chromoblastomycosis in patients residing in a humid climate. As yet, limited standard therapy for chromoblastomycosis is available and relapses are often observed. The aim of the present study was to test the in vitro activity of eight conventional and new generations of antifungal agents against F. pedrosoi and F. monophora. Methods: The collection has been obtained from the CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands and consisted of the following isolates: 21 strains of F. pedrosoi and 28 isolates of F. monophora. MICs were determined for amphotericin B (AmB), uconazole (FLU), itraconazole (ITC), voriconazole (VOR), posaconazole (POS), isavuconazole (ISA), caspofungin (CAS) and anidulafungin (ANI). Susceptibility testing was done in accordance with CLSI M38A2 guidelines adjusted spectrophotometrically at a 530 nm wavelength to optical densities that ranged from (6871 T%) in RPMI 1640 MOPS broth with L-glutamine without bicarbonate. Plates were incubated at 35 C for 72 h. The MIC was determined visually as the lowest concentration of drug (mg L-1) either showing absence of growth or 50% reduction of growth (only for uconazole) compared with that of the growth control. For the echinocandins the MEC was microscopically determined as the lowest concentration of drug that leads to the growth of small, rounded, compact hyphal forms as compared with the long, unbranched hyphal clusters that were seen in the growth control (drug free). Quality control was performed by including Paecilomyces variotii (ATCC 22319), Candida parapsilosis (ATCC 22019), and Candida krusei ATCC 6258. Results: The most active drugs against were ITC, VOR, POS and ISA. Echinocandins exhibited high MICs against both F. pedrosoi and F. monophora. No signicant difference between the antifungal susceptibility of the two fungal species was recorded.
F. pedrosoi AmB FLU ITC VOR POS ISA CAS ANI
AmB
FLU
ITC
VOR
POS
ISA
CAS ANI Range MIC50 MIC90 0.52 1632 0.0310.25 0.1250.5 0.0310.063 0.0630.5 24 18 1 16 0.063 0.5 0.063 0.25 2 4 1 32 0.125 0.5 0.063 0.25 4 8
Range 0.1252 1664 < 0.0160.125 0.1252 < 0.0160.125 0.0081 18 0.0164 32 0.063 1 0.063 0.25 2 0.063 MIC50 1 64 0.125 4 0.125 0.5 8 2 MIC90 1
C. modesta (n = 1), C. devriesii (n = 3) and C. arxii (n = 1) gave similar MICs compared with C. bantiana. Conclusions: AFLP proved to be a reliable method for the identication of C. bantiana against other neurotropic strains. Posaconazole, itraconazole and isavuconazole were the most active drugs with high in vitro activity against neurotropic C. bantiana with MIC90s of 0.5 mg L-1. From the echinocandins tested anidulafungin also
F. pedrosoi AmB Range MIC50 MIC90
FLU
ITC
VOR
POS
ISA
CAS ANI 18 4 8
0.52 832 0.0310.25 0.1251 0.0160.063 0.0631 14 1 16 0.063 0.25 0.031 0.25 2 2 32 0.125 0.5 0.063 0.25 2
40
Discussion: ITC, VOR, POS and ISA are in vitro the most active
drugs against Fonsecaea spp. Although we did not investigate the relation between MIC and clinical response to treatment these new triazoles seem to be promising agents for the treatment of chromoblastomycosis.
P032
Susceptibility of micafungin in Candida strains isolated from patients with invasive Candida infections by EUCAST methodology J.W. Mouton, E. Geertsen, I. Curfs-Breuker, C. H. Claassen and J. F. Meis Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Objective: Micafungin is a new echinocandin recently approved in
Europe. During various clinical trials, all Candidastrains were collected for identication and susceptibility testing. The EUCAST antifungal susceptibility testing (AST) was recently nalized (EDef 7.1).We here describe the MIC distributions of micafungin and caspofungin of these clinical strains by species using EUCAST AST. Methods: Candidastrains were collected from patients entered into clinical trials, including patients with invasive infections. All strains were sent to a reference lab and stored at -70 C. For susceptibility testing, strains were revived and reidentied using molecular techniques, including AFLP and ITS where appropriate. Microdilution testing was performed following the EUCAST method (EDef 7.1) for micafungin, caspofungin and amphotericin B. Drugs were obtained from the manufacturers. Results: 569 C. albicans (CA), 81 C. glabrata (CG), 28 C. krusei (CK), 113 C. parapsilosis (CP) and 175 C. tropicalis (CT) strains were identied. The MIC50 and MIC90 (mg L-1) for micafungin were <0.008 and 0.16 (CA), 0.016 and 0.016 (CG), 0.125 and 25 (0.25??)_(CK), 1 and 2 (CP), 0.031 and 0.063 (CT) respectively. For caspofungin these were 0.5 and 0.5, 0.5 and 0.5, 1 and 1, 1 and 2, 0.5 and 1, respectively. The data suggest micafungin ECoff (voluit?)values of 0.031 (CA), 0.031 (CG), 0.25 (CK), 2 (CP) and 0.125 (CT) mg L-1 to delineate wildtype distributions. Conclusions: The activity of micafungin against clinical Candida strains was excellent, with the exception of C. parapsilosis, as has been reported for all echinocandins. The MIC distributions obtained help to dene the wild type MIC distribution for micafungin and caspofungin and add in dening the ECoffs by EUCAST methodology from this large collection for various species of Candida.
Methods: Candidastrains were collected from patients entered into clinical trials, including patients with invasive infections. All strains were sent to a reference lab and stored at -70 C. For susceptibility testing, strains were revived and re-identied using molecular techniques, including AFLP and ITS where appropriate. Microdilution testing of micafungin was performed following both the EUCAST method (EDef 7.1) and the CLSI M-27A method. The E-test was performed following instructions of the manufacturer and read after 24 h and 48 h. To compare methods, MIC values for each strain were transformed by taking the two log and substracted. This then yields the difference in two log dilution steps. The mean and standard deviation of differences were calculated both overall and by species to determine systematic differences between results as opposed to random differences. Results: In total, 349 strains were compared with each other, 100 C. albicans (CA), 36 C. glabrata (CG), 86 C. tropicalis (CT), 70 C. parapsilosis (CP) 11 C. krusei (CK) and 46 strains of various species (CV). In general, except for CT, the MICs obtained by the EUCAST method were one dilution higher than those obtained by CLSI method, 0.9, 1.1, 2.2, 1.2, 1.3 and 0.8 twofold dilutions for CA, CG, CT, CP, CK and CV respectively. The E-test MICs were half a dilution higher than the EUCAST method (0.5 for 24 h and 0.7 for 48 h reading) for CA, but 1.5 and 1 dilution lower for all other species, indicating signicant differences between E-test readings and the EUCAST method by species. Comparing the CLSI method with the E-test method, differences were observed as well: for CA 1.4 and 1.6 dilution, while there were hardly differences for all other species except CT, 1.0 and 1.3 dilution, for the 24 and 48 h readings, respectively. Conclusions: In contrast to azoles, there is a difference of approximately one dilutionstep between MICs as obtained with the EUCAST method compared to the CLSI method. The E-test shows systematic discrepancies with both methods and is species dependent. This warrants further investigation.
P034
Impact of correct identication on wild type distribution ranges of Candida spp J.W. Mouton, I. Curfs-Breuker, E. Geertsen, C. H. Claassen and J. F. Meis Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Objective: Micafungin is a new echinocandin recently approved in
Europe. During various clinical trials, all Candida strains were collected centrally for identication and susceptibility testing. Identication was originally performed using routine phenotypical techniques. However, MIC ranges for caspofungin and micafungin were relatively wide for some species. We hypothesized that, because routine phenotypic identication is not very reliable for some species, genotypic identication would better describe the Wild Type (WT) population. Methods: Candida strains were collected from patients included into clinical trials, including patients with invasive infections. All strains were sent to a reference laboratory and stored at -70 C. Identication was originally performed using phenotypic methods. For susceptibility testing, strains were revived and re-identied using molecular techniques, including AFLP and ITS where appropriate. Microdilution testing of micafungin, caspofungin, posaconazole and amphotericin B was performed following by both the EUCAST method (EDef 7.1) and the CLSI M-27A method. The MIC ranges were determined by species as identied using either phenotypical or genotypical methods. Results: The original dataset consisted of 590 C. albicans (CA), 85 C. glabrata (CG), 181 C. tropicalis (CT), 136 C. parapsilosis(CP) and 31 C. krusei (CK) strains as determined by phenotypic methods. The ranges (mg L-1) for micafungin as determined by the EUCAST methods were 0.0080.063 (CA), < 0.0080.031 (CG), 0.0161 (CT), 0.0164 (CP) and < 0.0080.25 (CK), corresponding to three, two, ve, eight and ve twofold dilutions, respectively. After re-identication using genotypic methods, twofold dilution ranges were reduced to three (CT), three (CK) and two (CP). For caspofungin, similar results were obtained and effects
P033
Comparison of four different methods to determine MICs of micafungin of Candida strains isolated from patients with invasive infections J.W. Mouton, I. Curfs-Breuker, E. Geertsen, C. H. Claassen and J. F. Meis Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Objective: Micafungin is a new echinocandin recently approved in
Europe. During various clinical trials, all isolated Candida strains were collected centrally for identication and susceptibility testing. For routine testing, the E-test is used by many laboratories. However, there are little comparative data showing the validation of the E-test against the CLSI method. In addition, the EUCAST recently published the denitive version of the EUCAST method (EDef 7.1). We therefore compared the results of E-test with both the CLSI method as well as the EUCAST method for micafungin. In particular, we were interested whether differences - if present - were species dependent. In addition, differences between EUCAST and CLSI methodology would impact the selection of breakpoints.
41
were also observed for posaconazole. For CA and CG ranges did not change. Similar results were obtained with the CLSI method. Conclusions: When determining WT ranges and Epidemiological Cut-off values, it is essential to identify Candida spp. to the species level as this has a major impact hereon. For species other than C. albicans and C. glabrata, this study showed that genotypic identication rather than phenotypic identication described the ranges more accurately. In routine practice one should be aware that unexpected MICs, even relatively mild deviations, may be due to a wrong identication rather than concluding the presence of a resistance mechanism.
P042
Prospective utility of (13)-B-D-Glucan (BG), galactomannan (GM) and anti-Candida albicans germ tube antibodies (CAGT) for the diagnosis of invasive fungal disease (IFD) in haemato-oncology adult patients A. Alhambra1, M. S. Cuetara2, J. M. Moreno1, A. Del Palcio Perez-Medel1, I. Moragues3, J. Ponton3 and A. Del Palacio1 1 Hospital Universitario Doce de Octubre, MADRID, Spain, 2Hospital Universitario Severo Ochoa, LEGANES, Spain, 3Universidad del Pais Vasco, BILBAO, Spain Objectives: BG (polysaccharide of the cell wall of all fungi), GM (cell
wall component of Aspergillus) and CAGT (antibodies against antigens expressed by Candida albicans germ tube surface, non-C. albicans species have cross reactivity) are non-invasive diagnostics tools that may help to establish the diagnosis of IFD. Conventional diagnostic methods are insensitive. The results of these biomarkers should be interpreted in the context of the presence of risk factors, signs, symptoms and radiologic imaging. The aims of this prospective study is to dene the diagnositic efciency [sensitivity (S), specicity (SP) and negative and positive predictive values (PPV, NPV)] of the three biomarkers and the relationship of IFD (proven/probable) with a risk stratication scheme in adult haemato-oncology patients. Methods: Patients were prospectively stratied as proposed by PrenticeHG (Br J Haematol 2000; 110:273) as high, intermediate (high and low) and low risk of developing IFD. IFD was dened as proven and probable according to the guidelines of De Pauw B (Clin Infect Dis 2008; 46:18). Bi-weekly BG (Fungitell cutoff 120pg ml-1), GM (Platelia Aspergillus cutoff 0.500) and CAGT (C. albicans IFA IgG, cutoff 1/160) were determined in serum. Results: 93 patients (173 episodes) received cytotoxic chemotherapy and some of them stem cell transplantation. The S, SP, PPV and NPV for BG (all IFD), GM and CAGT were 58%, 83%, 50%, 87% and 92%, 94%, 73%, 98% and 57%, 93%, 44%, 96% respectively. Table 1 shows the relationship of IFD and risk. Conclusions: For the diagnosis of IC, BG has a S, SP, PPV and NPV of 77%, 86%, 39% and 97% respectively, with higher sensitivity when compared with CAGT, sharing both high specicity and high negative predictive values. The diagnostic efciency of GM and BG for the diagnosis of IA was 85% and 73% respectively. For the diagnosis of IA BG has a S, SP, PPV and NPV of 57%, 84%, 42% and 91% respectively, with a higher sensitivity and specicity of GM when compared with BG, sharing both high negative predictive values. The incidence of IFD correlated directly and signicantly (C2 P = 0.0005) with risk stratication group, with the highest proportion (20.8%) in the high-risk group and the percentage falling directly and signicantly as the risk declined.
P041
Prospective pilot study of Pneumocystis Jiroveci Pneumonia (PJP) with (13) b-D-Glucan (BG) Assay (Fungitell) among patients with and without HIV infection with a conrmed diagnosis of PJP M.S. Cuetara1, J. Llenas2, A. Alhambra2, F. Chaves2, I. Moragues3, J. Ponton3 and A. Del Palacio2 1 Hospital Universitario Severo Ochoa, Leganes, Spain, 2Hospital Universitario 12 de Octubre, Madrid, Spain, 3Universidad del Pais Vasco, Bilbao, Spain Objectives: To report the results of serum BG testing assay among
patients with and without HIV infection with a conrmed diagnosis of PJP at our institutions. The diagnostic potential of BG test for the diagnosis of PJP was explored, including serial BG monitoring during the treatment course. Methods: Patients with pneumonia and known risk of Pneumocystis jiroveci (PJ) (HIV patients with 200 CD4/mm3 or either patients at risk with non PJ prophylaxis) and conrmed positive microscopy of respiratory samples and/or a positive real-time PCR for PJ were index cases. Control cases were HIV patients with 200 CD4/mm3 and pneumonia due to different etiologies. Results: Eighteen patients were included in the study: 11 with PJP (index cases) and seven control group patients. The index cases were: eight patients with (i) new diagnosis of HIV infection, (ii) or non compliant with antiretroviral therapy and PJP prophylaxis and three non HIV patients: one renal transplant patient, one with advanced follicular lymphoma and another patient with 81 CD4, diabetes and renal function impairment. All 11 patients with PJP had baseline BG positive serum testing ( 80 pg ml-1) with a median BG value greater than 1198 pg ml-1 (range, 1504409 pg ml-1). The seven control patients had Mycobacterium tuberculosis (three patients), Streptococcus pneumoniae (two patients), Aspergillus fumigatus invasive proven pneumonia (one patient) and a patient with a comatose condition and bronchoaspirative pneumonia. Two patients in the control group had positive BG baseline serum levels (one with a S. pneumoniae positive blood culture and another one with proven invasive A. fumigatus pulmonary infection. The sensitivity, specicity and positive and negative predictive values for BG were 100%, 71%, 85% and 100%, respectively. Serial monitoring during the treatment course showed declining levels of BG in patients with a favourable response and rising levels in patients with treatment failure. Conclusion: The diagnostic efciency for BG in our population was 89%. BG assay in serum is a non invasive diagnostic marker useful as an adjunct for the diagnosis of PJP with a 100% sensitivity and a 100% negative predictive value in patients at risk for PJP and a valuable tool for monitoring treatment course. Acknowledgments: This investigation was supported by grants n Fondo de Investigacio Sanitaria, Instituto de Salud Carlos III, Proyecto Investigacion PI 070134 (to MSC), PI 070107 (to A d P) n, and PI 070376 (to JP), grant IT-26407 of Departamento de Educacio n Universidades e Investigacio del Gobierno Vasco (to JP) and Saiotek from Departamento de Industria, Comercio y Turismo del Gobierno Vasco (to JP) and an Educational grant from Pzer (to A d P) and n Fundacion MM Investigacio Medica (to A d P).
Acknowledgments: This investigation was supported by grants

n Fondo de Investigacio Sanitaria, Instituto de Salud Carlos III, Proyecto Investigacion PI 070134 (to MSC), PI 070107 (to A d P) and PI 070376 (to JP), grant IT-26407 of Departamento de Educacion, Universidades e Investigacion del Gobierno Vasco (to JP) and Saiotek from Departamento de Industria, Comercio y Turismo del Gobierno Vasco (to JP) and an Educational grant from Pzer (to A d P) and n Fundacio MM Investigacion Medica (to A d P).
42
P043
False positivity of 1,3-beta-D-Glucan in patients with gram negative bacilli bacteraemia: presentation of two cases from a tertiary care hospital M. Metan and A. N. Koc Erciyes University, Kayseri, Turkey Objectives: Invasive pulmonary aspergillosis (IPA) is an important problem for patients with haematological malignancies. Detection of galactomannan (GM) and1,3-Beta-D-glucan (BDG) are promising tools for diagnosis. Since, antifungal treatment could be based on the results of these tests, it is good to know the potential causes of false positivity. We want to report two cases with false positive BDG due to Escherichia coli and Salmonella enteritidis bacteraemia who were recovered without any antifungal therapy. Case 1: A 79-year old man with myelodysplastic syndrome was admitted to emergency department with fever and cough. Physical examination was unremarkable except crepitant rales on the left thorax Bilateral ground-glass appearance was detected at the lower lobes in the high-resolution chest tomography (HRCT). Serum GM (Platelia Aspergillus EIA, BioRad) and BDG (Fungitell, Associates of Cape Cod) tests were ordered to rule out IPA. Moxioxacin 400 mg day-1 iv was started. Serum GM index was 0.37 (normal value 0.5) and BDG was 239 pg ml-1 (normal value 80 pg ml-1) which was performed at the day of admission. HRCT was repeated and there was no difference when compared with the previous one. Echerichia coli growth was reported in the blood cultures. The antibiotic treatment was changed to imipenem 500 mg q6h iv based on the antimicrobial susceptibility report. Serum GM index was 0.11 and BDG was 21 pg ml-1 which were repeated one week later. The patient was discharged in good condition after 14-days of imipenem treatment. Case 2: A 54-year old woman with aplastic anemia was admitted to emergency department with fever and diarrhea. She was treated for febril neutropenia with piperacillin/tazobactam for 10 days and discharged from heamotology clinic one month ago. Physical examination was unremarkable except fever of 38.6 C. White blood cell count 1.45109 L-1 and absolute neutrophil count was 420 mm-3. _ Imipenem 500 mg q6h was initiated with a diagnoss of febril neutropenia. The day after results of serum GM and BDG tests were available. GM index was 0.18 and BDG was 108 pg ml-1. The patient was still febrile and HRCT was performed to rule out IPA. There was no evidence of fungal pneumonia on HRCT. At the forth day fever resolved and S. enteritidis growth was reported from blood cultures. The antibiotic treatment was changed to ciprooxacin 200 mg q12h iv based on the antimicrobial susceptibility report. The therapy was completed to 14 days and she didnt have any evidence of IPA during follow-up visits. Conclusion: BDG positivity without evidence of fungal infection was reported in several clinical circumstances such as hemodialysis using cellulose membranes, intravenous administration of albumin and immunoglobulin, gauze packing of serosal surfaces and patients receving amoxicillin/clavulanci acid. When we evaluated the potential interfering factors that caused BDG positivity in our patients, E. coli and S. enteritidis bacteraemia was the only possible causative factor in the lights of the current literature. However, the interaction between gram negative bacilli bacteraemia and BDG is still conicting further studies are needed to evaluate potential BDG reactivity in patients with gram negative bacilli bacteraemia.
Methods: During a period of thirteen months blood samples taken

from patients were cultured simultaneously in Bactec mycosis and Bact/ALERT systems. The two systems were compared for culture positivity and time to detection (TDT). In total 3100 blood culture triplicates, i.e. Bactec mycosis, Bact/ALERT aerobic and anaerobic vials, taken simultaneously from 958 patients were analyzed. Results: In total 117 sample triplicates from 38 patients signalled positive for Candida spp. The mycosis vials from Bactec were positive in 89/117 samples (76.06%). The aerobic vials from Bact/ALERT were positive in 99/117 samples (84.62%). The difference between aerobic and mycosis vials were not signicant (P = 0.10). When paired comparison for TTD were made, no signicant difference were observed between Bactec mycosis and Bact/ALERT aerobic blood culture vials (P = 0.08). None of the anaerobic vials from Bact/ALERT signalled positive for Candida spp. Growth of Candida spp. in blood culture vials drawn before the initiation of therapy was analysed in 27 patients. There were no difference in detection of Candida positivity between the two systems. When TTD was taken into account Bactec mycosis vials signalled positive signicantly faster than Bact/ALERT vials (P = 0.01). Median TTD was 22 h for Bactec mycosis and 30 h for Bact/ALERT aerobic vials. In 30 triplicates with polymicrobial growth, (i.e. growth of another yeast or bacteria together with Candida spp.), detection of Candida spp was signicantly higher in Bactec mycosis vials than BacT/ALERT aerobic vials (P = 0.009). Growth was observed in 29/30 (96.66%) Bactec mycosis vials while BacT/ALERT aerobic vials detected 21/30 (70%). Conclusion: The present study shows that Bactec and BacT/ALERT have different characteristics in detection of candidemia. Both systems were able to detect monomicrobial candidemia similarly. Bactec mycosis vials were superior to Bact/ALERT aerobic vials in time to detection of candidemia in samples drawn prior to systemic antifungal therapy. Similar difference was also observed in detection of candidemia with polymicrobial sepsis where Bactec mycosis vials signalled signicantly faster than Bact/ALERT aerobic vials.
P045
Diagnostic and therapeutical aspects in a dog chronic rhinitis caused by Aspergillus Fumigatus and Cryptococcus Laurentii F. Agnetti1, M. B. Conti2, A. Moretti3, M. C. Marchesi2, S. Busechian2, L. Anzalone1, R. Cari1, I. Moretta3 and F. Rueca2 1 Istituto Zooprolattico Sperimentale Umbria e Marche, Terni, Italy, 2Diagnostica e Clinica Veterinaria, Perugia, Italy, 3 Dipartimento di Scienze Biopatologiche ed Igiene delle Produzioni Animali e Alim, Perugia, Italy Objectives: Mold Aspergillus spp. is a common contaminant of the
nasal mucosa in several animals and is the etiological agent of dog mycotic rhinitis. This disease, relatively recurrent in middle-aged dolicocephalic breeds, shows complicated and not always evident pathogenetic features; besides this, it evolves in chronic shape and sometimes it is associated to progressive osteolysis phenomena of the surrounding bone structure. The present work describes a particular clinical case, due to the young age of the dog and the fungal agents involved. Methods: An Epagneul Breton female one year old dog showed for several months sneezes attacks and muco-purulent discharge, sometimes with blood tracks, by the left nostril; it was treated unsuccessfully with antibiotics and non-steroid anti-inammatory drugs. After the clinical examination, an endoscopy of the upper airways was performed, and through it was visualized and removed a vegetal foreign body in the lower meatus of the left nostril. Furthermore, the endoscope showed a marked disarchitecture of the turbinates and a conchal atrophy, associated with yellow-greenish and simil-caseous consistency plaques on the mucosa, probably traceable to fungal colonies. Specimens of this material were collected for bacteriological (standard culture media) and mycological (culture on Sabouraud dextrose agar and CAFC media, biochemical identication by API ID32C system) tests, together with bioptic samples of the mucosa for
P044
Clinical comparison of the two blood culture systems for the detection of candidemia E. L. Ericson, L. Klingspor, M. Ullberg and V. Ozenci Karolinska University Hospital Huddinge, STOCKHOLM, Sweden Objectives: To compare the performance of Bactec mycosis and Bact/ALERT aerobic and anaerobic blood culture vials in detection of candidemia in patients.
43
histo-pathological examinations. A radiographic study of the skull, to conrm the bone integrity, was also realized. Results: Bacteriological examination was positive for Staphylococcus intermedius, while mycological examination showed the development of two fungal species, the mold Aspergillus fumigatus and the yeast Cryptococcus laurentii, respectively; branching septate hyphae were demonstrated on histologic samples. Therefore, a systemic therapy with itraconazole (5 mg kg-1 BID per os) was prescribed; than, the dog was submitted to a topic application of 1% solution of clotrimazole after general anesthesia. Progressive resolution of the clinical ndings was noticed, and an endoscopic investigation was performed after 3 weeks, showing the absence of fungal colonies. Moreover, a second topic treatment was made, while the itraconazole was suspended. One month after the end of the therapy, there were no relapses. Conclusions: The young age of the dog, as well as the positive response to the therapy, allow to hypothesize that the pathogenicity of A. fumigatus is related to the irritant action of the vegetal body, that has also brought the animal to cause a trauma to itself in the nostril region involved; this aspect could explain the fact that C. laurentii, a non pathogen yeast normally detectable on the mucosa of the rst respiratory tract, found the way to grow and produce colonies. In the absence of hard tissue lesions, the persistent inammatory stimulus expired with the extraction of the foreign body, increasing the effectiveness of the therapeutic protocol. Furthermore, the combinated systemic-topic treatment was useful to shortening the time of itraconazole administration (normally 67 months) and therefore to avoid its collateral effects.
Through the observation of the mycelia on the culture plate and the ultra structure of the mold, it was successively possible to classify it as Penicillium marneffei. Results reported were obtained from all examined shes. Conclusions: Skin lesions are a frequent drawback in discus farming. In addition to the tissue damage, they represent an antiaesthetic injury, with consequent impairment of the sh and troubles for the farmer or the owner. In many cases, the main aetiological agent is a protozoan, Hexamita/Spyronucleus spp., cause of the so called hole in the headsyndrome. In the case described, the copresence of two other agents, bacteria and fungi respectively, was demonstrated. A. hydrophila and A. sobria, as well as P. marneffei, are common aquatic micro-organisms, that probably nd favourable pathogenetic conditions to affect skin damages caused by the protozoan. In particular, it is important to point out that P. marneffei is able to cause systemic mycoses in human and other animals, while no data are available concerning ornamental sh.
P047
Identication of human pathogenic Candida species by MALDI-TOF mass spectrometry O. Petrini, C. Fragoso, S. De Respinis, M. Tonolla and C. Benagli Cant. institute of Microbiology, Bellinzona, Switzerland Objectives: Candida spp. have emerged as causal agents of human infections particularly among immunocompromised patients. In addition to C. albicans, several other species, including C. parapsilosis, C. krusei, C. glabrata, C. tropicalis and C. guilliermondii can be human pathogens. Species identication relied traditionally on morphological, physiological and biochemical characters. More recently molecular methods, including RFLP, internal transcribed spacer (ITS) analysis and multilocus sequence typing, have been used for the identication of clinical and non-clinical isolates. All these methods are relatively costly and time-consuming. We have therefore compared molecular genetic methods to the more rapid and inexpensive matrix-assisted laser desorption/ionisation-time of ight mass spectrometry (MALDI-TOF MS) for the identication of Candida isolates from human samples. Methods: More than 200 isolates of several Candida species were submitted to MALDI-TOF MS analysis after identication by biochemical and genetic (ITS sequencing) methods. MALDI-TOF mass spectra were obtained with an AXIMA-Condence Linear instrument (Shimadzu) in the linear mode. Spectra were analysed with SARAMIS (spectral archive and microbial identication system; Anagnostec, Germany). Results: Preliminary results of the taxonomic analysis are shown in Fig. 1. MALDI-TOF allowed to reliably identify C. albicans, C. parapsilosis, C. glabrata, C. krusei, C. lusitanica and C. tropicalis. The results were conrmed by genetic analysis. The identication by MALDI-TOF mass spectrometry was fast (approximately 23 min per sample), with minimal sample preparation time. Discussion: Clustering of Candida species obtained by MALDI-TOF was almost identical with that seen with sequence data. MALDI-TOF MS separates Candida species as well as DNA sequencing. Thanks to its robustness, simplicity, speed, and reliability, MALDI-TOF represents a valid alternative to single or multi gene sequencing for taxonomic studies of Candida. The big advantage of MALDI is the speed by which identications can be made; thus, diagnostic results produced by MALDI-TOF can be made available to clinicians almost immediately after growth of the pathogen in pure culture. We are currently investigating the use of MALDI-TOF on native samples.
P046
Skin lesions in symphysodon discus: a case of protozoan, bacterial and fungal agents co-presence. F. Agnetti1, L. Anzalone1, S. Borgami2, I. Moretta3, M. Latini1, A. Moretti3 and C. Ghittino1 1 Istituto Zooprolattico Sperimentale Umbria e Marche, Terni, Italy, 2Veterinarian, Terni, Italy, 3Dipartimento di Scienze Biopatologiche ed Igiene delle Produzioni Animali e Alim, Perugia, Italy Objectives: Ulcers, as other skin lesions, can be caused in sh by
different factors, including infectious agents, toxins, physical or immunological causes, nutritional or metabolic perturbations. Pathogenic or contaminant microorganisms are often associated with a variety of skin disease in sh, as well as in other animals. In this study we describe a syndrome observed in discus (Symphysodon discus), characterized by the presence of skin ulcers, that was caused by the contemporary presence of protozoa, bacteria and fungi. Methods: A group of 10 adult discus specimens, about 2 years old, was sent to our Fish Disease Lab for the presence of skin lesions located on the head region. Fishes belonged to a breeding farm located in Central Italy, supplied by water well, at a constant temperature of 2426 C; they were normally fed with a commercial feed, kept into aquarium of 500 L of capability and reared for the production of juveniles for pet shops. The observed lesions were distributed around the periocular and the nasal region, and, in some cases, along the junction of the dorsal n. They were ascribable to ulcers and characterized by: absence of scales, irregular perimeter and hyperaemia. Moderate anorexia and lethargy were also observed in the abovementioned shes. Specimens were sacriced and scrapings were carried out on the skin lesions, for light microscope observation and bacteriological and mycological examinations. Results: Light microscope observation allowed to notice the presence of agellated and oval shaped protozoa, presumably belonging to family Hexamitidae (genus Hexamita/Spyronucleus). Bacteriological exam was positive for Aeromonas hydrophila and Aeromonas sobria, while mycological exam was positive for a Penicillium spp. mold.
44
Figure 1. Denddrogram, MALDI-TOF identications
The S, SP, PPV and NPV for BG and GM were 100%, 38%, 24%, 100% and 75%, 80%, 27%, 97% respectively. The table shows the relationship of IFD and risk.
Conclusions: Both BG and GM are non-invasive tools for the

diagnosis of IFD and IA in LTR patients at risk, but although GM has a higher SP for the diagnosis of IA, the advantage of BG is that it is a panfungal marker. Since Mucorales have a low amount of BG, mucormycoses currently should be diagnosed with conventional invasive techniques. Both BG and GM share high NPV and can exclude reasonably IFD in populations at risk. A limitation of our work is the low number of patients included in the study; consequently the validation of BG and GM in LTR populations requires a sound and denitive prospective clinical study in which necropsies should be the cornerstone. Acknowledgments: This investigation was supported by grants Fondo de Investigacion Sanitaria, Instituto de Salud Carlos III, Proyecto Investigacion PI 070134 (to MSC), PI 070107 (to A d P) and PI 070376 n, (to JP), grant IT-26407 of Departamento de Educacio Universidades e n Investigacio del Gobierno Vasco (to JP) and Saiotek from Departamento de Industria, Comercio y Turismo del Gobierno Vasco (to JP) and n an Educational grant from Pzer (to A d P) and Fundacio MM n Investigacio Medica (to A d P).
P049 P048
Prospective pilot study in ICU adult liver transplant recipients (LTR): utility of (13)-B-D Glucan (BG) and galactomannan (GM) for the diagnosis of invasive fungal disease (IFD) A. Del Palacio1, M. E. Alvarez1, A. Alhambra1, M. S. Cuetara2, M. Catalan1, J. C. Montejo1, I. Moragues3 and J. Ponton3 1 Hospital Universitario Doce de Octubre, Madrid, Spain, 2Hospital s, Universitario Severo Ochoa, Legane Spain, 3Universidad del Pas Vasco, Bilbao, Spain Objectives: BG (polysaccharide of the cell wall of all fungi, Mucorales
however have a lower content of BG) and GM (cell wall component of Aspergillus) are non invasive diagnostic tools that may help to establish the diagnosis of IFD. Conventional diagnostic methods are insensitive for this purpose. The serological blood results with these biomarkers should be interpreted in the context of the presence of risk factors, signs, symptoms and radiologic imaging. The aim of this prospective study is to dene the sensitivity (S), specicity (SP) and positive and negative predictive values (PPV and NPV) of both biomarkers and the relationship of IFD (proven/probable) with a risk stratication scheme in ICU adult LTR. Methods: Patients were prospectively stratied (with modications) as proposed by Hellinger WC (Liver Transpl 2005;11:656662) as high, intermediate and low risk for IFD. IFD was dened as proven and probable according to the guidelines of De Pauw B (Clin Infect Dis 2008;46:48). Bi-weekly BG (Fungitell, cutoff 120 pg ml-1) and GM (Platelia Aspergillus, cutoff 0.500) were determined in serum. Results: 43 LTR patients were assessed prospectively: 20 patients died and there were nine necropsies. The rate of false antigenemia on the rst week posttransplantation was (34%) (three false positive per eight patients) and 59% (13 false positive per 22 patients) for GM (for invasive aspergillosis) and BG (all IFD except Mucorales) respectively.
Piperasilin-tazobactam treatment does not cause false-positivite result in < i Aspergillus galactomannan antigen detection of animal models A. Kalkanci, K. Hizel, A. Kalkanci, M. Dizbay, O. Guzel Tunckan, D. Arman and S. Kustimur Gazi University, Ankara, Turkey Objectives: The availability of the Platelia Aspergillus (Bio-Rad Laboratories, Marnes, France) has been a major advance in the diagnosis of aspergillosis because of the early detection of antigen. But, galactomannan may be detected in several drugs that originated from fungal organisms, including piperacillin/tazobactam. The aim of this study is the demonstration of galactomannan false positivity in neutropenic rats with aspergillosis receiving voriconazole or/with piperasilin-tazobactam treatment. Methods: Fourthy female Wistar albino rats, weighing initially (200 15 g) and 4 weeks of age, were obtained from Gazi University School of Medicine Experimental Animal Research center and divided into ve groups 8 rats in each; healthy control group, neutropenic control group, neutropenic aspergillosis group, neutropenic aspergillosis and treated with voriconazole group, neutropenic and treated with piperasilin - tazobactam prophylaxy group. Neutropenia was achieved by the intraperitoneal administration of 10 mg of 5uorourasil per kilogram before infection of the animals. Aspergillosis was performed with the inhalation of Aspergillus conidia in a respiration chamber. Voriconazole and piperasilin - tazobactactam treatments were performed intraperitonealy. Aspergillosis was conrmed by Real Time PCR assay using using the LightCycler instrument (Roche Diagnostics, Tenay, Turkey) and primers were derived from sequences of the A. fumigatus 18S rRNA gene. Two internal hybridization probes specic to A. fumigatus were used; the rst was labeled at the 5end with LC Red 640 (5-TGA GGT TCC CCA GAA GGA AAG GTC CAG C) and at the 3end (5-GTT CCC CCC ACA GCC AGT GAA GGC). The galactomannan antigen test was performed using the
45
Platelia Aspergillus sandwich enzymelinked immunosorbent assay (BioRad). A GM test was positive when the index was higher than 0.5. Results: Neither Aspergillus DNA nor galactomannan antigen was detected in healthy control and neutropenia control groups. Rats of the neutropenic aspergillosis and treated with voriconazole group were all positive for Aspergillus DNA and 37% positive for galactomannan antigen. No antigen positivity was found in neutropenic rats treated with piperasilin - tazobactam. The level of galactomannan antigen was determined for piperasilin-tazobactam by Platelia Aspergillus and it was not in the range of positivity. Galactomannan index was estimated with the ratio to cut-off value and evaluated as positive when index was found > 0.5. Conclusion: Galactomannan antigen detection is a valuable method for early diagnosis of aspergillosis. The reasons for the variation in performance are multifactorial. In the literature it was published that piperasilin - tazobactam treatment caused false positive result in galactomannan antigen test. But in our study, piperasilin-tazobactam treatment did not cause false-positivite results in galactomannan antigen detection in rat models of aspergillosis. With the respect of our results, it was thought that the knowledge of false positivity of galactomannan antigen test in the literature should be evaluated again.
P051
Diagnostic PCR assay for Microsporum and Trichophyton infections A. Brillowska-Dabrowska1, A. Swierkowska2, D. M. Saunte1 and M. C. Arendrup1 1 Statens Serum Institut, Copehagen, Denmark, 2Gdansk University of Technology, Gdansk, Poland Objectives: We have previously described a highly sensitive 5-hour
PCR test for the rapid diagnosis of onychomycosis which detects any dermatophyte and species-identify T. rubrum from patient specimens. We have subsequently developed and evaluated new PCR tests for detection of Trichophyton and Microsporum canis per audouinii infections. Methods: Fifty-eight dermatophyte isolates (21) Microsporum spp. (four different species), 35 Trichophyton spp (10 different species) and two were E. occosum) and 10 yeast, mould or human DNA controls samples were included. Twenty-ve patient specimens randomly selected among routine samples, 10 hair specimens from guinea pig experimentally infected with M. canis and two from un-infected control animals were included. The isolates were identied by microscopy and culture observation. DNA was prepared by a 10-min procedure from patient specimens, guinea pig specimens and fragments of dermatophyte colonies as previously described (1). Two pairs of primers were designed based on the alignment (VectorNTI, Informax) of dermatophytes rDNA sequences: Trich302for 5 TTG CTA AAC GCT CAG ACT GAC AGC 3 and Trich302rev 5 CGG AAG GAT CAT TAA CGC GCA GGC C 3 specic for any Trichophytos spp and Micr279for 5 CCT AAG CGG TGG GTG GTT ACT G 3 and Micr279rev 5 TGA AAG AAC ATA CCG TCT GAG CG 3 specic for M. canis and M. audouinii. PCR mixtures consisted of 10 ll of PCR Ready Mix (Sigma, Germany), 0.2 ll of each primer at 100 lmol L-1, and 2 ll of DNA in a volume of 20 ll. PCR was performed in an Eppendorf thermal cycler. The timetemperature prole for PCR was 35 cycles of 45 s at 94 C, 45 s at 70 C, and 45 s at 72 C, preceded by initial denaturation for 10 min at 95 C for the Trichophyton PCR and 35 cycles of 45 s at 94 C, 45 s at 55 C, and 45 s at 72 C, preceded by initial denaturation for 10 min at 95 C for the other. The presence of specic PCR products of approximately 302 bp and 279 bp, respectively, was examined using electrophoresis on a 2% and 1% agarose gel stained with ethidium bromide. Results: Using DNA prepared from dermatophytes cultures the 302 bp PCR product was obtained for 35/35 Trichophyton isolates (Fig 1) and the 279 bp for 3/3 M. canis and 4/4 M. audouinii samples. None of the two E. occosum, 14 Microsporum spp. other than M. canis and M. audouinii or control samples was positive with any of the two PCR tests. Among the patient specimens seven were T. rubrum positive, two T. mentagrophytes positive, one T. tonsurans positive and 15 dermatophyte negative by routine investigation. The PCR results were in agreement with this. Finally, the Microsporum PCR was positive for 10/10 guinea pig hair specimens from infected animals but for 0/2 of the control animal samples. Discussion: The evaluation of the two PCR tests indicated excellent sensitivity and specicity. Based upon the local epidemiology algorithms can now be designed for rapid and easy PCR-detection of dermatophytosis with a genus identication allowing optimal selection of antifungal treatment.
P050
Evaluation of two serologic test for diagnosis invasive Aspergillosis C. Castro, A. Romero, A. Aller, T. Gonzalez, A. Gonzalez and E. Martn-Mazuelos H. U. Valme, Sevilla, Spain Objective: Early diagnosis of invasive fungal infections (IFIs) is
essential, however diagnosis of most IFIs (especially of invasive aspergillosis (IA)) is difcult because classic test have low sensitivity and specicity. In our study new assays, detection of galactomannan (GM) by Platelia Aspergillus and the panfungalantigen 1,3-beta-Dglucan (BG) by Fungitell test are used for early diagnosis of invasive aspergillosis (IA). Methods: A total of 236 sera from 51 patients in risk of IA were tested for GM using Platelia Aspergillus kit (Bio-Rad, France) which 36 sera (10 patients) were tested for BG also using Fungitell kit (Associates of Cape Cod., USA). Patients were attended at the University Hospital of Valme from Seville from January of 2008 to December 2008. Patients with GM index 0.5 in two consecutive samples have been marked as GM positive and samples with results 80pg ml-1 were marked as BG positive. Antigens detection were performed to according to the manufacturers instructions. Other samples as blood culture, bronchoalveolar lavage, bronchoalveolar aspirates or others were taken following clinical criteria. Culture of these samples were carried out following the usual techniques of a mycological laboratory. All GM positive patients were classied according to EORTC/MSG criteria (2008) for probability of IA. Results: From 51 patient studied, 16 of them showed at least one GM positive specimen (33 sera). Only six patients showed two consecutive positive results ( 0.5 GM test) and they show clinical signs or microbiological criteria for AI proven (three patients) and probable (three patients). The BG assay were used in parallel with GM in 36 sera which 26 showed positive result from nine patients, (three with AI proven and six AI probable). Three patients showed positive results before for BG test (3.5 days) and 6 patients presented simultaneously both antigens. Never the GM test was the rst serological test to show a positive result. Conclusion: Calculating signicant sensitivity for both detection methods was not feasible due to a low number of proven/probable AI. BG detection showed positive results before GM test and present the great advantage to be a panfungalantigen. BG detection should be used with other techniques for detection of invasive Aspergillosis infections.
P052
Optimised 5-hour multiplex PCR test for the detection of Tinea ungium: performance in a routine PCR laboratory A. Brillowska-Dabrowska, H. V. Nielsen, S. S. Nielsen and M. C. Arendrup Statens Serum Institut, Copenhagen, Denmark Objectives: We recently published the development of a 5-hour multiplex PCR test for the detection of dermatophyte nail infection. We have optimized this test by inclusion of an inhibition control and
46
evaluated the test in a routine laboratory when compared to the conventional microscopy and culture. Methods: A total of 109 clinical samples received at the mycology reference lab at Statens Serum Institute were included. The samples were divided equally and tested by microscopy & culture and PCR. For PCR evaluation DNA from nail specimens was released by a 10-min incubation of the nail sample in 100 ll of extraction buffer in 95 C and subsequent addition of 100 ll anti-inhibition buffer. After vortex mixing, 4 ll of this DNA-containing solution was used for the multiplex PCR with: panDerm1 (5 GAAGAAGATTGTCGTTTGCATCGTCTC 3), panDerm2 (5 CTCGAGGTCAAAAGCACGCCAGAG 3) detecting dermatophyte DNA and Trubrum-for (5 TCTTTGAACGCACATTGCGCC 3) and Trubrum-rev (5 CGGTCCTGAGGGCGCTGAA 3) detecting Trichophyton rubrum DNA, 1 ll of inhibition control, 10 ll of PCR Ready Mix in a volume of 20 ll. The presence of specic PCR products of approximately 366 bp (dermatophyte band), 203 bp (T. rubrum band) or 500 bp (inhibition control band) was examined. Results: The performance of the multiplex PCR with inhibition control was tested prospectively in a PCR routine laboratory. In total 22 (20.2%) specimens grew a dermatophyte (16 of which were T. rubrum. Additionally 15 samples were microscopy positive but culture negative. Thus, 46.8% of the microscopy positive samples were negative by culture. By PCR using 4 ll DNA solution 35 of the samples were positive for either T. rubrum or a dermatophyte other than T. rubrum, 68 samples were negative and six samples were inhibited. Repeating these samples with 2 ll DNA allowed for detection dermatophyte DNA in two samples (both microscopy positive) and conrmed negative results of conventional diagnosis for the remaining four specimens. Thus in total 37 samples (33.9%) were PCR positive. T. rubrum was detected in 27 (73.0% of the PCR positive samples) and a dermatophyte other than T. rubrum in 10 samples (27.0% of the PCR positive samples). In ve (4.6%) cases the PCR was positive for T. rubrum despite negative microscopy and culture, and in two (1.8%) cases the PCR was negative despite positive culture. In the majority of cases of positive PCR and negative culture the microscopy was positive (11/16, 68.8%). Only 5/72 culture and microscopy negative samples were positive by PCR (6.7%) while the PCR positive rate was much higher among microscopy positive but culture negative samples 11/15 (73.3%) Discussion: The present study demonstrates that in a routine setting the PCR test is as sensitive as traditional diagnostics performed in a mycology reference lab if microscopy positive but culture negative samples are considered positive and far more sensitive if only culture positive samples are considered true positives. The introduction of an internal control demonstrated that 5% of the samples contained PCR inhibitors but this was overcome by re-running the samples with a 50% reduction of sample DNA solution.
colonies at rst white turned black. Fungal DNA was amplied and sequenced using the MicroSeq D2LSU rDNA Fungal PCR Kit and the MicroSeq D2LSU rDNA Fungal Sequencing Kit from Applied Biosystems. The consensus sequence was analysed using Blast program of NCBI and a 97% homology to S. schenckii was obtained. A test for antifungals susceptibility pattern was also performed and the strain exhibited in vitro resistance to Fluconazol, Voriconazol and Itraconazol.
P054
Direct detection of multi-azole resistant Aspergillus fumigatus in brain tissue S.M.T. Camps1, J.W.M. Van der Linden1, E. Snelders1, J. P. Arends2, S. M. Daenen2, W.J.G. Melchers1 and P. E. Verweij1 1 Radboud University Medical Center, Nijmegen, The Netherlands, 2 UMC Groningen, Groningen, The Netherlands Objectives: Aspergillus fumigatus is an opportunistic fungal pathogen causing severe disease in immunocompromised patients. Aspergillus infections are often treated with azole antifungal agents but patients infected with a resistant strain may not respond to the azole therapy. Recently, multi-azole resistance has emerged in The Netherlands and in our hospital up to 6% of patients harbor a multi-azole resistant A. fumigatus isolate. The resistance was mainly caused by a point mutation at t364a in the cyp51A gene (the target for azoles) leading to a substitution of leucine for histidine at codon 98 (L98H), in combination with a tandem repeat (TR) in the promoter region of this gene. The detection of azole-resistance delays the start of appropriate antifungal therapy due to time-consuming laboratory investigations (i.e. culturing and susceptibility testing), or even culture-negativity. This diagnostic delay should be reduced and therefore we investigated whether molecular tools can be applied to detect resistance in A. fumigatus directly in clinical specimens such as brain tissue. Methods: In a 60-year old man suffering from graft-versus-host disease after allogeneic stem cell transplantation for myelodysplastic syndrome which developed into acute myeloid leukemia, multiple nodular pulmonary inltrates and multiple brain lesions were detected. Aspergillus fumigatus was cultured from the sputum and in serum circulating galactomannan was detected. Histological examination showed septate hyphae from a brain biopsy, but cultures remained negative. The isolate cultured from the sputum showed high minimum inhibitory concentrations (MICs) for itraconazole, posaconazole and voriconazole. The resistance mechanism was determined by polymerase chain reaction (PCR) amplication and sequencing of the cyp51A gene and its promoter region. The parafnembedded brain tissue sections prepared from the biopsy were used to demonstrate Aspergillus infection as well as azole resistance directly. DNA was extracted using proteinase K and the Qiagen EZ1 robot. A real-time 28S PCR assay was used to detect Aspergillus and two realtime PCR assays were used to detect the TR and the L98H substitution, respectively. A 160 base pair (bp) fragment of the cyp51A gene was sequenced as additional conrmation for the L98H substitution. Results: The resistant A. fumigatus isolate from the sputum contained the TR/L98H mutations as was determined by sequencing. From the parafn-embedded brain biopsy tissue, Aspergillus was detected by a real-time 28S PCR assay. In addition, the resistance mechanism was detected by the two real-time PCR assays was the TR/ L98H. The L98H substitution was conrmed by sequencing of a 160 bp fragment. Conclusion: The real-time PCR method described here is a reliable and rapid method to detect TR/L98H mutations in resistant A. fumigatus. To our knowledge, it is shown for the rst time that it can be used for the direct detection of azole resistance in patient material such as brain tissue. This increases the possibility to detect azole resistance in case of culture negativity. In addition, diagnostic delay can be reduced as it is not necessary to wait until cultures are positive and in vitro susceptibility testing is performed.
P053
Sporotrix schenckii - clinical laboratory case C.M. Verssimo, H. Parada, A. C. Pinheiro, R. Sabino, J. Brandao and L. Rosado de Instituto Nacional de Sau Dr Ricardo Jorge, Lisbon, Portugal
Sporothrix schenckii is a dimorphic fungus usually found in soil and plant debris. It is the cause of sporotrichosis and can cause cutaneous or subcutaneous infection, usually following trauma of the skin with plant material or by contaminated animals. Although its more often reported from Central and South America, it has worldwide distribution and it is the most frequent subcutaneous mycosis reported in Portugal. We describe a laboratory case of S. schenckii isolated from a skin lesion of the right hand of an immunocompetent patient with localized linphocutaneous sporothrichosis. The laboratory procedures included direct microscopic examination and culture of the skin biopsy on Sabouraud cloranphenicol agar. After 5 days at 35 C yeast form culture consistent with S. schenckii were observed. Cultures were tested for dimorphism and converted to lamentous form at 27 C, the
47
P055
Histopathological diagnosis of onychomycosis using calcouor white (CW) stain: comparison with PAS staining of nail sections N. Dias1, F. Garcez1, M. Teixeira1, F. Ferreira1 and N. Lima2 1 de, Paredes, CITS - Centro de Investigaca em Tecnologias da Sau o Portugal, 2IBB - Institute for Biotechnology and Bioengineering, Braga, Portugal Objective: The aim of this work is to compare results from PAS
routine staining and CW stain on histopathological evaluation of onychomycosis. Methods: Ninety six nail clippings from patients clinically suspected of having onychomycosis were used. All patients were attending the Podology Service in the Hospital of Guimaraes (Centro Hospitalar do Alto Ave) between January and October 2008. Nail clippings were obtained by non-invasive means and were xed with 10% formalin, embedded in liquid parafn at 60 C, cut into 56 thin slices (3 lm) of the parafn blocks and dried onto slides. A fully automated embedding process provided histological slides within 24 h. After deparafnation and hydratation in descending alcohol solutions (100% 2, 95% 2, 80%, 70%, 50%) half of the slides were stained with periodic acid-Shiff (PAS) reagent for 10 min, washed in deionized water and stained with Shiff Reagent for another 5 min. Slides were washed with three exchanges of deionized water and dehydrated in ascending alcohol solutions (50%, 70%, 80%, 95% 2, 100% 2) before mounting in an organic mounting medium. The remaining slides were stained with one drop of Calcouor White Stain 1% (CW) for 35 min, followed by washing in deionized water to remove excess uorochrome. Slides were covered with Vectashield mounting medium for delay uorescence quenching. Histological diagnosis was performed using conventional methods. Samples were rst screened with a low magnication objective (10 ). Upon localization of a site suspicious of fungal infection a high magnication (40 or 100 ) was used to conrm the diagnosis. All randomized samples were observed twice in a blind assay. Results: Calcouor white (CW) stain is a uorescent brightener, with a high afnity for chitin and cellulose, which are major components in the cell walls of fungi, so is particularly useful in the detection of fungal elements in specimens. CW was used as an alternative of PAS staining in histological nail sections. On 96 samples analysed and stained with PAS, a percentage of 34.4% nails were found positive for fungi, 62.5% were negative and 3.1% gave an inconclusive diagnosis. Results from CW staining showed 46.9% of positive cases, 52.1% of negative cases, and it was not possible to establish a conclusive diagnosis in 1.0% of cases. Conclusion: Results of the present study indicate that the histological examination of nail clipping specimens with CW stain is an easily and rapid performed procedure that represents an alternative to routine periodic acid-Shiff (PAS) staining of nail clipping sections, principally in non-massive infection cases where fungal elements are scarce.
propagation of AFRS has been reported and these lesions may be mistaken for pituitary tumors. Objectives: We describe the histology and mycology ndings of S. commune AFRS followed by massive sellar propagation hyperprolactinemia and diplopia. A 44-year-old immunocompetent male presented with symptoms of nasal obstruction, diplopia and headache. Endocrinological evaluation of the pituitary function revealed normal pituitary function and hyperprolactinemia. The patient underwent transnasal transsphenoidal operation and the functional endoscopic sinus surgery. Methods: Histology examination of formalin-xed and parafnembedded tissue and mucin sample were performed staining by Hematoxylin and eosin (H&E) and Gomoris methenamine silver (GMS). For mycology examination the tissue was homogenized for direct Blankofor smear preparation and culturing. Sabouraud dextrose agar plates were incubated on 28 C and 37 C and followed daily for fungal growth. Subcultivation was done on Potato dextrose and Chapek agar. Results: Histologicaly pituitary gland adenoma was not detected but revealed clusters of eosinophilic granulocytes (H&E) and septate fungal hyphae within the allergic mucin (GMS). The hyphae seemed to be impacted or embedded within the clusters of eosinophils, proliferates as septate hyphae 2.54.5 lm in diameter with characteristic branching dichotomy (approximately 45 C angle), suggesting Aspergillus infection but a fungal invasion of the tissue was not observed. Tissue Blankophor staining revealed hyphae and on the plate the growing was observed after 3 days on both temperatures as white cottony mold colony with a yellow reverse and strong and disagreeable smell, reaching a diameter of 4 cm in 7 days labeled as sterile mycelium. Subcultivation on Potato dextrose and Chapek agar microscopically demonstrated hyphae with clamp connections and fruiting bodies suggesting S. commune. Identity of fungal strain was conrmed by sequencing analyze in the Centraalbuerau voor Schimmelcultures, Utrecht, The Nitherlands. Conclusion: This is the rst case of AFRS caused by S. commune in immunocompetent patient, complicated with formation of the large pseudotumor and its propagation to the sellar region followed with hyperprolactinemia and diplopia documented by histology, mycology and strain sequencing analyze. It is likely that AFRS caused by S. commune is not rear but are usually misdiagnosed or not recognized because of the lack familiarity of doctors with this fungus.
P057
Evaluation of Conda Candida chromogenic agar for the isolation and presumptive identication of Candida albicans and other clinically relevant yeasts E. Eraso, C. Marcos-Arias, I. Miranda-Zapico, M. Ortega-Riveros, A. Varona, J. M. Aguirre and G. Quindos Universidad del Pas Vasco, Leioa, Spain Introduction: Candida Chromogenic Agar (Conda, Spain) is a
chromogenic medium for the selective isolation of yeasts and the direct identication of Candida albicans (green colonies) and presumptive identication of some other Candida species, such as Candida tropicalis (dark blue) and Candida krusei (purple-pink). Objective: To evaluate the performance of the Candida Chromogenic Agar for the isolation and identication of Candida albicans and other clinically important Candida species. Patients and methods: Two hundred and sixty four stock strains from the Universidad del Pas Vasco and other culture collections (Table 1) and 112 fresh oral specimens were evaluated. The usefulness of Candida Chromogenic Agar with clinical specimens was compared with ChromID Candida (bioMerieux, France). The identity of clinical isolates was conrmed by conventional mycological methods, such as the germ tube test in serum, microscopic morphology and chlamyconidia formation in corn meal agar (Oxoid, UK) with Tween 80, and carbon source assimilation by ID 32C (bioMerieux). If necessary, identication was conrmed by PCR with specic primers. Stock collection strains were grown on Sabouraud glucose agar plates (Difco, USA) at 37 C for 2448 h, prior to inoculation onto chromogenic
P056
Schizophyllum commune allergic fungal rhinosinusitis with sellar propagation and hyperprolactinemia in immunocompetent man - histology and mycology ndings V. Arsic Arsenijevic1, S. Pekic2, M. Skender Gazibara3, A. Dzamic1, E. Ratkov1 and V. Popovic2 1 Institute of Microbiology and Immunology, Belgrade, Serbia, 2 Institute of Endocrinology University Clinical Center, Belgrade, Serbia, 3University of Belgrade, Belgrade, Serbia
Allergic fungal rhinosinusitis (AFRS) represents a hypersensitivity response in the sinus cavity usually caused with Aspergillus, Culvularia, Bipolaris or zygomycetes. Only in few cases Schizophyllum commune was reported manly because of difcultly to detect them with conventional mycological examinations. In rare case intracranial
48
media. Oral swabs were directly streaked onto chromogenic media agar plates. Media were incubated up to 10 days at 37 C (temperature recommended by manufacturers). Plates were checked daily for growth and read independently by two investigators. Results: Most yeast isolates grew well on both media after 24 h of incubation. However, colonies grew earlier with a faster and stronger colour on ChromID Candida. Table shows the main characteristics of yeast colonies grown on Candida Chromogenic Agar. Seventy two positive oral specimens yielded 91 isolates of different yeast species. The recovery rates were equivalent on both media. Candida albicans was the most frequent species isolated (65 isolates, 71.4%), followed by Candida glabrata (11 isolates, 12.1%), Candida parapsilosis (six isolates, 6.6%), C. tropicalis (three isolates, 3.3%), Candida dubliniensis and Candida guilliermondii (two isolates each, 2.2%), and Candida lusitaniae and Candida rugosa (one isolate each, 1.1%). In 17 specimens grew two or more yeast species. Candida Chromogenic Agar had excellent sensitivity and specicity values (100%) for the identication of germ tube positive species (C. albicans or C. dubliniensis). When colonies of C. tropicalis were observed, the colour of the colonies was gray-green, distinct from the referred by manufacturers but clearly distinguishable from that observed in colonies from other species. The differentiation of C. krusei was easy by the colour pink and downy appearance of colonies, with a sensitivity and specicity of 100%. However, C. parapsilosis and C. glabrata were not clearly differentiated from other species, such as C. guilliermondii, C. lusitaniae or Candida famata.
of Candida spp. were done using VITEK 2 Compact system (Bio-Merieux). During the 4 years between January 2005 and December 2008, there was growth of candida in 508 of 36.330 blood cultures. 315 (62%) were Candida albicans, 157 (31%) were non-albicans Candida and 36 (7%) were nontypeable. Among the non-albicans Candida the most frequent isolates were C. parapsilosis (104), C. tropicalis (17) and C. glabrata (12). Mean time to detect positivity in C. albicans was 1:14:00 days:hours:minutes (max: 5:14:03 and min: 00:02:11). In non-albicans Candida it was 2:00:56 (max: 5:05:40 and min: 00:03:22). 21.2% of Candida displayed growth alarm after 48 h. Mean isolation time was > 48 h in C. glabrata (12) and C. famata (6). Mean duration for positivity is higher in nonalbicans Candida. Even in C. albicans the time to positivity is still high to manage appropriate therapy. The subcultures and identication procedures will require at least 48 more hours. In each hospital there should be 24 h coordination of information between laboratory and clinics in term of early management of systemic Candida infections. Faster methods of detection is required for laboratory dependent therapy.
P059
Differentiation of intra-Section Aspergillus species with MALDI-TOF Mass Spectrometry in comparison to multi-locus sequencing A.A. Alanio1, J.L.B. Beretti1, B. D. Dauphin1, E. M. Mellado2, G. Q. Quesnes1, A. A. Amara1, X. N. Nassif1 and M.E.B. Bougnoux1 1 Hopital Necker-Enfants Malades, Paris, France, 2Centro Nacional de Microbiologia, Instituto de S. Carlo, Madrid, Spain Objectives: Based on phylogenetical studies, the taxonomy of
Aspergilli has been considerably modied using a multi-locus sequencing (MLS) approach, allowing better correlation between species and natural phenotype resistance. As a consequence, emerging species of Aspergillus causing invasive diseases, such as Aspergillus lentulus within section Fumigati, have been isolated in immunocompromised humans. Currently, MLS is recommended for identication of recently described Aspergillus species. We postulated that MALDI-TOF Mass Spectrometry (MS) can also discriminate intra-section species of Aspergillus, as in bacterial species identication. Methods: A set of reference strains belonging to 24 clinically relevant species from ve sections was used to build a reference database, as previously described (Carbonnelle E., J.Clinical.Microbiol., 45, 2156). To identify discriminating peaks, the prole of early (< 2 days) and late (> 4 days) spores obtained from 10 passages were analyzed for each referenced strain. The spectra of 112 clinical and 16 environmental isolates, identied with MLS (beta-tubulin and/or calmodulin) were then compared to those of each of the 24 reference strains including: 50 A. fumigatus, seven A. lentulus, ve Neosartorya pseudoscheri, two A. viridinutans and A. hiratsukae, A. fumigatiafnis, one A. fumisynnematus, N. scheri and N. udagawae (section Fumigati); 11 A. avus, two A. tamarii, one A. parvisclerotigenus (section Flavi), nine A. niger, two A. foetidus, one A. tubengensis (section Nigri); four Emericella nidulans, one E. quadrilineata, seven A. sydowii, three A. versicolor (section Nidulantes); 10 A. calidoustus, one A. pseudodeectus, one A. insuetus (section Usti). Results: Using our database, correct identication was obtained for 126 of 128 isolates (98,4%) including 69 of 71 (99%) from section Fumigati, 14 of 14 (100%) from Flavi, 12 of 12 (100%) from Nigri, 17 of 17 (94%) from Nidulantes, and 12 of 12 (100%) from Usti. Conclusion: These data demonstrate that MALDI-TOF-MS is a powerful and promising tool to discriminate clinically relevant intrasection species of Aspergillus. As MALDI-TOF ngerprint is speciesspecic, this technology could become a powerful tool for the description of new species within sections.
Conclusion: Candida Chromogenic Agar allows the easy and rapid identication and differentiation of C. albicans, C. tropicalis and C. krusei at 2448h and clearly shows the presence of mixed cultures. Funding: Projects GIC07 123-IT-222-07 (from the Departamento de n, Gobierno Vasco) and Educacion, Universidades e Investigacio PI061895/2006 (from the Fondo de Investigacion Sanitaria del Ministerio de Sanidad y Consumo de Espana).
P058
Time to blood culture positivity of Candida species O.A. Akan1 and S. Kilicel2 1 Ankara University Medical School, Ankara, Turkey, 2Ankara University, Ankara, Turkey
Since mortality is higher with delayed treatment (more than 48 h) in systemic Candida infections, early diagnosis is vitally important. The gold standard for the diagnosis of candidemia is a positive blood culture. Despite the availability of improved detection systems, time is still required to obatin a positive result. This study is performed to observe the time to detect positivity in the blood cultures in which Candida spp. were isolated. The retrospective analysis of records of blood cultures were done using Epi-Center (BD Diagnostics). The time of blood culture (BACTEC Plus + Aerobic/F) bottles loaded into the BACTEC 9240 (BD Diagnostics) systems and the time of positive alarm were recorded. All of the bottles were incubated for 5 days. The mean duration of incubation until positivity was calculated for both all Candida spp. and for different species individually. The isolation of the microorganisms were done according to the standard microbiological procedures and identication
49
P060
MycArray Yeast ID - A Novel Assay for Identifying Candida Species D.S. Tuckwell1, S. Cui1, D. Ireland1, A. Moody1 and C. B. Moore2 1 Myconostica Ltd, Manchester, UK, 2Wythenshawe Hospital, Manchester, UK Objectives: It is recognised that patient mortality from fungal
infections such as candidaemia can be reduced by early treatment. However, choice of antifungal may often be inuenced by the species of fungus causing the infection. Thus there is a need for a rapid and accurate means of identifying fungal species from patient samples, to inform treatment. Methods: The MycArray Yeast IDkit, can detect 18 Candida and yeast species [C. albicans, C. dubliniensis, C. famata (Debaryomyces hansenii), C. glabrata, C. guilliermondii, C. kefyr (Kluyveromyces marxianus), C. krusei (Issatchenkia orientalis), C. metapsilosis, C. orthopsilosis, C. parapsilosis, C. pelliculosa (Pichia anomala), C. rugosa, C. tropicalis, C. utilis, Saccharomyces sensu stricto, Histoplasma capsulatum, Cryptococcus neoformans, Rhodotorula mucilaginosa] from blood culture or culture plates. For most species multiple probes are present on the array covering observed intra-species genetic variation and ensuring sensitivity. The bound products are visualized by a colourimetric assay, and the assay can be completed in under 4 h. Results: PCR and hybridization conditions were established using multiple isolates of each species. The array was then further tested and optimised using 20 clinical isolates each of the ve major Candida species: C. albicans, C. glabrata, C. krusei, C. parapsilosis, and C. tropicalis, using colonies picked from agar plates. Conditions were established which led to the successful identication of approximately 95% of isolates. In addition, one C. parapsilosis isolate was further classied as C. metapsilosis using the array. The sensitivity and specicity of the array was subsequently tested using spiked blood cultures, using the ve main Candida species and the performance was comparable to culture plates. Preliminary studies indicated that mixed cultures can be successfully identied and the technique can be routinely applied to clinical samples where yeasts have been seen by Gram stain. Conclusion: MycArray Yeast ID is able to identify yeast species from colonies on agar plates and blood cultures with a rapid turnaround. This will assist in the clinical identication of yeasts and the prescription of appropriate anti-fungal therapy.
CHROMagar, morphology at corn meal agar and assimilation pattern (ID32C), were tested by PCR-RFLP and PNA-FISH. Results: The three species have nearly the same size of 26SrDNA (about 500 base pair (bp) by our primer) and ITS2 (about 430 bp), but both C. nivariensis and C. bracarensis can be differentiated from Candida glabrata by sizing of ITS1 (about 400 bp for the rst two species and 490 bp for latter). RFLP with the restriction enzyme TatI allowed us to easily differentiate the three species from each other. The RFLP fragments were about 280, 180 and 50 base pair for C. glabrata, 225, 200 and 80 base pair for C. nivariensis and 280 and 220 base pair for C. bracarensis. The results were conrmed by sequencing and PNAFISH. One hundred and thirty-three yeasts strains isolated from Danish patients with candidemia which already identied by phenotypical and physiological methods as C. glabrata were screened by ITS-PCR-RFLP and PNA-FISH methods, none were C. nivariensis or C. bracarensis. Conclusion: We recommend PCR-RFLP of ITS1-5.8S rDNA-TS2 region to differentiate the species within to Candida glabrata group. C. bracarensis and C. nivariensis are rare among Danish C. glabrata isolates blood isolates.
P062
Multiplexed molecular detection of Aspergillus fumigatus from BAL uid in a guinea pig model of invasive aspergillosis L.K. Najvar1, R. Bocanegra1, R. Janeczko2, F. Merante2, P. Pitsakis2, D. Himsworth2, W. R. Kirkpatrick1, N. P. Wiederhold1 and T. F. Patterson1 1 University TX Health Science Center @ San Antonio, San Antonio, TX, USA, 2Luminex Molecular Diagnostics, Toronto, Canada Objectives: Invasive aspergillosis is a leading cause of morbidity and
mortality in immunocompromised patients. Early diagnosis of invasive aspergillosis in these patients can improve outcomes when coupled with appropriate therapy. Methods: We examined bronchoalveolar lavage uid (BAL) in a standardized guinea pig model of invasive aspergillosis as a means of detecting early signal of infection using an enhanced PCR methodology. Male Hartley Guinea pigs were immunosuppressed with cortisone acetate and cyclophosphamide 2 days prior to and 3 days post infection. The animals were challenged with 108 conidia of Aspergillus fumigatus AF293 in an acrylic inhalation chamber. BAL samples were obtained from anaesthetized guinea pigs at days 0, 3, 5, and 7 post infection prior to termination. CFU from lung homogenates were obtained at the same time points for comparison. One milliliter BAL uid was mixed with 105 cells ml-1 Tremella, and was beaten twice for 30 s with 450 mg 1 mm glass beads prior to a 25-plex multiplex hot start PCR including internal controls and run controls. Fluorescence signal of the PCR product was expressed as mean uorescence units (m). Negatives by the assay showed < 150 m and positive assays showed > 300 m. Results: PCR of the controls showed a low level, non-specic detection of signal. Samples containing either Tremella or Aspergillus AF293 showed an approximate 100-fold signal increase over their
P061
Differentiating of Candida glabrata, C. bracarensis and C. nivariensis based on fragment length polymorphism of ITS1-ITS2 and restriction fragment length polymorphism (RFLP) of 26SrDNA(D1D2) regions H. Mirhendi1 and M. C. Arendrup2 1 Tehran University of Medical Sciences, Tehran, Iran, 2SSI, Copenhagen, Denmark Objectives: To evaluate different methods for the identication and
discrimination of C. glabrata, C. bracarensis and C. nivariensis. Furthermore to investigate the prevalence of C. bracarensis and C. nivariensis among Danish blood isolates of C. glabrata. The recently described fungal species Candida nivariensis and C. bracarensis differ somewhat from each other and from other known species C. glabrata. However, simple and reliable identication methods are still needed to correctly identify these pathogenic yeasts in clinical specimens. Materials and methods: Nine reference strains (C. nivariensis CBS 9904, CBS 10161, CBS 9903, CBS 10154 and CBS 9985) were included to established and evaluate the following molecular methods fragment length polymorphism and restriction fragment length polymorphism (RFLP) in internal transcribed spacer 1 (ITS1), ITS2 and 26SrDNA(D1/D2) regions in rDNA. The results were evaluated in comparison with sequencing and peptide nucleic acid- uorescent in situ hybridization (PNA-FISH). Subsequently, 133 Danish blood isolates, all had been identied as C. glabrata using colony-colour at
50
respective mock controls. Aspergillus CFU from BAL samples on day zero, taken at 1 h post-infection indicated consistent infection had occurred, which was substantiated by PCR data. CFU data from BAL taken over days three, ve and seven showed a uniform, steady infection, which compared favorably to the matched PCR results for the same time frame, as shown. Conclusions: Multiplexed PCR of BAL samples from our guinea pig model showed rapid, specic detection of Aspergillus conidia at day zero, and detected hyphal forms at later time points. The multiplexed PCR methodology may be useful in early detection of invasive aspergillosis in a clinical setting.
P064
Deep candidiasis and Intravenous Drug addiction; report of 2 cases E. Justinien1, Y. El Samad2, C. Damiani1, A. Smail3, S. Sid Idris3, J. Sudzinski4, C. Da costa1, S. Milazzo4, J.-L. Schmit2 and T. Chouaki1 1 Medical Mycology, 2Infectious and tropical diseases, 3Internal Medicine, 4Ophthalmology, CHU Amiens (France)
The deep localizations are exceptional at the time of the systemic candidiasis,. They occur 2 to 3 months after the septicaemia. The Intravenous Drug users constitute the main target and the contamination makes itself by the yeasts of the oral ora at the time of the preparation of the injection. Mr. L. aged 43 years, IV drug abuse treated by Subutex and the patients history included right ankles fracture having justied the pose of osteosynthesis material, consulted for right ankle arthritis and myodesopsia of the left eye. The puncture uid from the joint and a blood culture revealed a numerous strains of Candida albicans. The ophtalmologic examination showed a decrease of the visual acuteness (6/10), a previous uveitis associated to a hyalitis. Secondarily, he presented a inguinal right pain with effusions joint of the hip, whose analysis showed the presence of yeasts to the direct examination. Evolution was favourable with an antifungal therapy (Amphotericine B in eyewash and Fluconazole 600mg/jr during 3 months) and a reduction of the fungal inoculums by washing of the two joints and ablation of pins. A vitrectomy of the left eye was necessary because of the intervening of a retina detachment. Mr. D 29 years, IV abuse teated by Subutex, was referred to us for loss of vision acuity in the left eye back pain not relieved by NSAIDS leading and the corticotherapy. Because of the persistence of the pain, MRI was performed and this demonstrated infectious spondylodiscitis of two disc spaces (T8-T9 & T9-T10) without epiduritis or neurological lesions, associated with extensive aseptic osteonecrosis of the femoral heads undoubtedly worsened by the corticosteroids. The funduscopic examination showed a vast subretinal focus occupying the whole posterior pole associated with uveitis. Direct examination of the puncture uid from the vitreous body demonstrated numerous yeasts and numerous Candida albicans colonies were isolated after culture. Evaluation of the in vitro sensitivity by Etest methods showed that the strain was sensitive to azole derivatives, 5 uorocytosine and caspofungin (conrmed by the liquid medium method, Eucast Paris Pasteur Institute). Control examination after 5 days of treatment showed a clearing of the vitreous body, a regression of the inammation with, however, the persistence of a whitish focus in the upper pole. The vision of the left eye was limited to CFV (countnger vision) at 50 cm. Triucan was continued during 6 months by the oral route. These two atypical observations show us the diversity in the clinical presentation of the heroin addict syndrome. The hold in charge must associate an antifungal therapy and a reduction of the fungal inoculums. The choice of antifungal must hold account of the pharmacokinetics properties of the antimycotic and the existence of fungicidal activity. Theses localizations must be systematically researched especially at the drug addicts under Subutex because of risk of the intravenous injection of crushed and diluted Subutex tablets.
P063
Misidentication of the emerging pathogenic yeast species Candida nivariensis as Zygosaccharomyces sp. F. Grenouillet1, A. Richelet1, E. Scherer1, A. P. Bellanger1, J. B. Murat1, F. Poncet2 and L. Millon1 1 CHU Jean Minjoz, Besancon, France, 2Universite de , Franche-Comte IFR 133, Besancon, France Objectives: Development of nucleic acid-based techniques leds to
description of previously unrecognized crypticspecies in medical mycology. Candida nivariensis, a yeast species closely related to Candida glabrata with multidrug resistance to antifungal agents, were described in 2005. This species yielded white colonies on CHROMagar medium. As its identication requires molecular techniques, we retrospectively analyzed yeast isolates showing poor assimilation of carbohydrates, and identied as Zygosaccharomyces sp. by phenotypic methods. Methods: We performed a 5-year retrospective study (April 2004 April 2009) including clinical isolates identied as Zygosaccharomyces sp. using ID32 auxanogram (Bio Merieux, Marcy lEtoile, France). Moreover, atypical white C. glabrata isolates on CHROMagar medium (Becton Dickinson, Le Pont de Claix, France) were also included since August 2005 (date of rst C. nivariensis description). Morphology of colonies on CHROMagar medium was assessed after 48 h at 30 C and 37 C. Carbohydrate assimilation prole using ID32 strips was also reassessed. Isolates yielding white colonies at the two temperatures were further identied using a modied C. nivariensis-specic PCR and sequencing of D1/D2 region of large subunit rDNA. Results: Fifty-four isolates were reanalyzed. Twenty out of them did not yield white colonies on CHROMagar medium; none of them gave positive C. nivariensis specic-PCR and they were not assessed by sequencing. The 34 remaining isolates presented with white colonies on CHROMagar medium. Twenty-two isolates out of these 34, originating from 12 different patients, were identied as C. nivariensis by species-specic PCR and conrmed by sequencing. Only one C. nivariensis isolate was able to assimilate trehalose, showing assimilation prole identical to C. glabrata, whereas all except one had the ability to assimilate only glucose. One strain was isolated from deep site (peritoneal uid) whereas the others originated from mucosa. Among yeast isolates presenting with white colonies and assimilating only a few carbohydrates, other identied species were mainly Candida bracarensis (three isolates, originating from two patients) and Kazachstania bovina (ve isolates, originating from three patients). Conclusions: Candida nivariensis is underidentied in laboratory routine. Most isolates were unable to assimilate trehalose and were misidentied as Zygosaccharomyces sp. Our study underscore the utility of molecular techniques as a reference adjunct to conventional methods of yeast identication, especially for identication of clinically important emerging pathogenic fungi. Species-specic PCR should be considered for rapid diagnosis of C. nivariensis among yeast isolates assimilating only glucose.
P065
Bench to bedside: development and implementation of a clinical protocol for the early molecular detection for the improved diagnosis of invasive pulmonary aspergillosis and zygomycosis T.J. Walsh, V. Pyrgos, M. Kasai, S. M. Harrington, W. W. Hope, R. Wubneh, R. Petraitiene, V. Petraitis, L. Greene, T. Aghamolla, A. F. Suffredini, A. S. Wayne, J. Gea-Banacloche, S. M. Holland, H. L. Malech, R. Childs, G. Fahle, M. Kemp, Y. Shea and P. R. Murray National Cancer Institute and National Institutes of Health, Bethesda, MD, USA
51
Invasive fungal infections are an important cause of infectious morbidity and mortality in immunocompromised patients with cancer, hematopoietic stem cell transplantation and aplastic anemia. Amongst the more lethal of these infections are invasive pulmonary aspergillosis and zygomycosis. Diagnosis remains difcult for these infections, as clinical symptoms are non-specic, culture of respiratory and blood samples are often negative and radiologic ndings are only suggestive. The Immunocompromised Host Section has developed and validated, in vitro and in vivo, a series of sensitive and highly specic qPCR assays for the detection of invasive pulmonary aspergillosis and zygomycosis. Following development of the light cycler PCR systems, including sensitivity and specicity for detection of Aspergillus fumigatus and the key pathogens causing zygomycosis (Rhizopus oryzae, Rhizopus microsporus, and Mucor spp.), a series of studies were conducted in clinically applicable animal models of pulmonary aspergillosis and pulmonary zygomycosis. These studies showed that the qPCR assays for detection of Aspergillus and Zygomycetes were more sensitive than culture of bronchoalveolar lavage uid and correlated with tissue burden in the lungs. The qPCR system was the rst to detect circulating biomarkers for pulmonary zygomycosis. This new diagnostic system represents an important clinical opportunity for early detection of zygomycosis in its earlier stages. In parallel with development of these molecular diagnostic systems, we have also developed an experimental foundation for detection of plasma galactomannan and (1 3)-b-Dglucan in both serum and bronchoalveolar lavage (BAL) uid. These markers in serum of early clinical studies have, correlated well with early detection and therapeutic response. The more recent data identifying these markers in BAL uid further increased sensitivity. Instrumental to proceeding from bench-to-bedside, has been establishing validation between the Immunocompromised Host Sections research and laboratory procedures and the CLIA certied procedures in the clinical microbiology department of laboratory medicine. Proceeding from Bench to Bedsidehas been a multistep process including initial design of the assays, in vitro and in vivo validation of the assays and technological transfer of laboratory-developed methodologies to a CLIA-certied clinical microbiology laboratory. This process has culminated in the design, development and implementation of an NIH IRB-approved Clinical Center protocol with the ultimate objective of bringing these technological advances for earlier and more accurate detection of invasive pulmonary fungal infections in immunocompromised patients.
uconazole was only given in ve patients for a total time of 65 days. After implementation of the antifungal restriction policy, the overall use of empiric antifungal treatment was signicantly reduced in the ICU population (P = 0.004), and uconazole was administered as initial antifungal treatment in the majority of patients (27 out of 107 patients for a total time of 451 days), followed by caspofungin in seven patients for a total time of 131 days. In the second study period candidemia due to Candida albicans in four patients and Candida lusitaniae in one patient was detected in 4.7% of the ICU patients and the overall mortality rate was 20.6%. Costs of antifungals were reduced to 50% after implementation of the restriction program. Conclusion: Similar mortality rates were found in the cardiothoracic ICU population before and after restriction of systemic antifungal treatment. Fluconazole was still effective as early antifungal empiric and preemptive treatment in the ICU population because Candida albicans was the predominant species in candidemia and supercial sites.
P067
Pulmonary lesions as rst computed-tomography presentation of invasive candidiasis in neutropenic patients F. Tissot, F. L. Lamoth, S. S. Schmidt, L. S. Senn, V. E. Erard, J. B. Bille, B. D. Duvoisin, T. C. Calandra and O. M. Marchetti Centre Hospitalier Universitaire Vaudois (CHUV), Lausanne, Switzerland Objectives: Whereas pulmonary lesions have been described in neutropenic patients with invasive aspergillosis (IA), invasive candidiasis (IC) is associated with typical hepatosplenic CT features detected after recovery from neutropenia. In contrast, pulmonary manifestations of IC are not well dened. The goal of the present study was to assess the CT presentation of IC pulmonary lesions in neutropenic patients. Methods: Twenty-nine neutropenic patients with possible, probable or proven IC or IA according to 2008 EORTC-MSG criteria were retrospectively studied. CT ndings, size and number of lesions, as well as timing of appearance in IC and IA were compared. Results: Patients characteristics were: median age 58 years (range 2877), males/females 76%/24%, acute myeloid/lymphoblastic leukemia 96.5%/3.5%, median duration of neutropenia 26 days (12 71). Invasive fungal infections included 15 IC (three proven, seven probable, ve possible), 12 IA (ve proven, seven probable) and two mixed IC/IA. Median number of CT per patient was 3 (16). Median time between start of fever and rst CT was 2 days (031). In followup, the median interval between CTs was 10 days (483). Number and time sequence of CTs were similar for IC and IA. CT ndings of IC and IA are summarized in the Table.
P066
Prudent use of antifungals and incidence of candidemia and outcome at a cardiothoracic intensive care unit C.H.R. Kratzer, A. Lassnigg, S. Tobudic, W. Graninger and E. Presterl Medical University of Vienna, Wien, Austria Objectives: In recent years echinocandines were increasingly used
for empiric antifungal therapy in intensive care patients. However to reduce costs, the prescription of antifungal agents had to be authorized by infectious diseases specialists in the hospital. To compare the effect of antifungal restriction on the mortality rate and incidence of candidemia, a prospective study was performed at the cardiothoracic intensive care unit (ICU). Methods: All patients admitted at the cardiothoracic ICU between December 2006 and 2008 for at least 4 days were enrolled. Before the 25th of October 2007 the choice of any antifungal treatment was left to the discretion of the treating physicians at the cardiothoracic ICU. Thereafter the use of systemic antifungal treatment except for uconazole was restricted to the guidance by a specialist for infectious diseases. The outcome of the ICU patients and the incidence of candidemia were analyzed. Results: In the rst study period 23 (27.7%) and 4 (4.8%) out of 83 patients died or developed candidemia caused by Candida albicans in two patients and Candida parapsilosis in three patients during admittance at the ICU. Caspofungin was administered as predominant antifungal treatment in 42 patients for a total time of 669 days, whereas
Conclusions: In invasive candidiasis pulmonary signs are as frequent as and appear signicantly earlier than hepatosplenic lesions, before recovery from neutropenia. Major signs classically associated with aspergillosis are also observed in one fourth of patients with candidiasis. Nodules are the most common pulmonary ndings in candidiasis: smaller size and higher number differentiate lesions from those of aspergillosis. Lung CT may thus contribute to the early diagnosis of invasive candidiasis.
52
P068
Evaluation of nested-PCR and real-time PCR assays for the diagnosis of candidemia K. Mohamed, H. Sellami, A. Sellami, S. Neji, F. Cheikhrouhou, F. Makni and A. Ayadi HU Habib Bourguiba Sfax, Sfax, Tunisia
PCR assays have a very low theoretical detection threshold and are therefore advocated for the diagnosis of fungemia. However, their effectiveness in this setting remains to be assessed. This study compared real-time PCR (Can-G) and nested-PCR assays with blood culture for the diagnosis of Candida spp. blood stream infections. A total of 200 clinical blood sample specimens obtained from 110 patients at risk to develop systemic fungal infection hospitalized in the University Hospital of Sfax (Tunisia) were submitted to culture, nestedPCR and real-time PCR. Blood culture was positive in 36 patients. When compared to culture, the Can-G assay (81% sensitivity, 96% specicity) performed better than the nested-PCR assay (86% sensitivity, 54% specicity). Conclusion: The real-time PCR assay, which avoids both contamination hazard with amplicons that cause false positive results and the use of time-consuming post PCR steps, appears more suitable than the nested-PCR assay for the laboratory diagnosis of yeast blood stream infections. In this study, real-time PCR did not enhance the sensitivity of the diagnosis of Candida spp. blood stream infection when compared to the conventional blood culture; however, it might lead to earlier implementation of an adequately targeted antifungal treatment.
processing area so that to elucidate allergenic isolates, gardens, farms and processing houses were samplied by sattle plates and isolated species were conducted conventional mycological laboratory rules. Amongst totally more than 2240 mould colonies involving many species, randomly, practiced for conventional taxonomic and proteomic laboratory examinations. Finaly, some fully identied species; Acremonium spp., A. butryi, A. strictum, Alternaria spp., Al. alternaria, Al. alternate, Cladosporium spp., C. herbarum, C. macrocarpum, C. cladosporioides, Paecilomyces spp., Pa. varioti, Phialophora spp., P. fastigiata, Scopulariopsis spp., S. brevicaulis, S. fusca, Trichoderma spp., T. roseumdetected fairly at rst time report for Iran and so the all for such ecological niche mycobioms responsible for cultivation yards and food processing areas of the provinces.Of isolates many are in concern for food microbiology, some are in attention for a variety of matters spoilage and deterioration, any may play a role in consumer hazardus and infections in animals, man or plants., At last the prepared fungi proles are the greatest standard whole mycobiom patterns characterization for a variety and a large number genera and the number for every species in the state or could be in the Caspian sea region to date, in our concerns.
P073
A Report On Uncommon And Rare Genera Species Of Aerial Mycoora From Iranian Northern States(II); Some New Allied For Iranian Caspian Region Fungi A.C. Nosrati Islamic Azad University (I.A.U), Lahijan, Iran
Respecting to public health importance of fungal hazards and to determine aerial pollution of the Iranian cultivation yards and processing area so that to elucidate allergenic isolates, gardens, farms and processing houses were samplied by sattle plates and isolated species were conducted conventional mycological laboratory rules. Amongst totally more than 2240 mould colonies involving many species, randomly, practiced for conventional taxonomic and proteomic laboratory examinations. Finaly, some fully identied species; Botrytis spp., B. aclada, B. cinerea, Chaetomium spp., C. bglobosum, Chrysonilia spp., Ch. crassa, Ch. sitophila, Geomycess spp., Gm. pannorum, Geotrichum spp., Gt. candidum, Memnoniella spp., Me. echinata, Monascus spp., Mo. ruber, Phoma spp., Ph. glumerata, Ph. macrostoma, Stachybotrys spp., St. Chartarum, Wallemia spp., W. Sebi, Xeromyces spp., X. bisporus, Syncephalastrum spp., Sy. racemosum, Conninghamella spp., Co. bertholletia, Aureobasidium spp., Au. pullulans detected fairly at rst time report for Iran and so the all for such ecological niche mycobioms responsible for cultivation yards and food processing areas of the provinces.Of isolates many are in concern for food microbiology, some are in attention for a variety of matters spoilage and deterioration, any may play a role in consumer hazardus and infections in animals, man or plants., At last the prepared fungi proles are the greatest standard whole mycobiom patterns characterization for a variety and a large number genera and the number for every species in the state or could be in the Caspian sea region to date, in our concerns.
P071
Isolation and identication of Aspergillus species from tea gardens air in the north of Iran; the rst report of some new Aspergillus species for Iran A.R.A.S.H. Chaichi Nosrati Islamic Azad University, Lahijan, Iran
Respecting to public health importance of fungal hazards as food borns and to determine aerial pollution of the Iranian Tea (Camellia sinesis) cultivation and processing area so that to nd allergenic Aspergillus isolates, Tea gardens were samplied by sattle plates. Amongst totally more than 600 mould colonies involving by 300 Aspergilli, 150 isolates, randomly, practiced for conventional taxonomic laboratory examinations due to ICPA and CBS rules. Finaly, 24 fully identied species; A. fumigatus, S. ornata, A. unguis, A. terreus, A. niveus, A. wentii, A. avus, A. sojae, A. parasiticus, A. alliaceus, A. niger, A. awamori, A. carbonarius, A. foetidus, A. ochraceus, A. ostianus, A. melleus, A. candidus, A. penicillioides, A. ustus, A. versicolor, A. oryzae, A. nidulans, A. japonicus and VII isolates suspected as Aspergillus species reecting to the prospective area were obtaind including 11 isolate as the rst reports; S. ornate (4), A. Wentii (2), A. Sojae (4), A. Awamori (3), A. carbonarius (3), A. Foetidus (1), A. ostianus (5), A. Penicillioides (7), A. ustus (4), A. unguis (6), A. Japonicus (5) for Iran and so the all for such ecological niche mycobioms responsible for Tea plant (Camellia sinesis) cultivation and its processing areas of the northern states provinces and even the Caspian sea area.We recommend the area for more common and fastidious aspergilli to be notied as a risk factor.
P074
A qualitative investigation on tea garden air fungal pollution in the north of Iran, gilan province western region A.C. Nosrati Islamic Azad University (I.A.U), Lahijan, Iran
Fungi are obiquitous and infact account for at least 25% of the earths biomass so abundant in many area or spaces serving optimum temprature and humidity. Fungi have long been know to affect human life status in various efforts including soil habitation, plant/animal parasitism and food / drink decaying, with possible concomitant production of mycotoxins, tissue infections and immune stimulation or combat. Ecologic microbiota of fungi can grow in initial area even the region may play more improtant role than climatic forces such as
P072
A report on identication of uncommon and rare genera species as aerial Mycoora of tea gardens and tea processing houses air in the north of Iran (I); some new allied for Iran and Caspian region fungi A.C. Nosrati Islamic Azad University (I.A.U), Lahijan, Iran
Respecting to public health importance of fungal hazards and to determine aerial pollution of the Iranian cultivation yards and
53
seasonal uctuations on fungal ora. It must be pointed out that outdoor fungi concentrations are in relation to indoor counts but in different genera so the taxa identied is much more important than the absolute number of colony forming units. Occupational and environmental health professionals are confronted with issues concerning bioaerosol harmness regarding investigation both indoor and outdoor fungi in complaint and noncomplaint area. In this respect totally 62 regional typical tea gardens dust bioaerosols were sampelied and 1005 mold colonies were isolated due to driect microscopy and culture based inspective conventional mycologic methods, during May to August 2005. Finaly 26 different genera of habitate fungi were collected and conrmed from 194 conducted plates. Of dened geographic location, this is the largest study of air borne outdoor fungal species with rutine protocol to date. Related to nouniformity of any specic guide lines measuring outdoor environmental fungi and determine potentially outcoming deseases due to exposure making interpretation of existing data difcult, air testing methodology must be expanded and evaluated. To build a model to clarify determinants of airborne fungal populations and health assessment in public area within a dened geographic location and labor, additional studies are needed to document any suspected relations prospectivly as well as retrospectivly.
was seasonal with one peak in summer and one in autumn (Figure); the level of this contamination in each ward was inuenced by the meteorology: a high outdoor temperature increased the FF load in all three wards. However, outdoor factors more readily explain the variations of fungal load in hematology than in the conventional ward.
P075
Haematology wards: inuence of internal and outdoor factors on lamentous fungal ora in the environment M.P. Brenier-Pinchart1, B. Lebau1, J. L. Quesada1, M. R. Mallaret1, J. L. Borel2, A. Mollard1, F. Garban1, J. P. Brion1, L. Molina1, J. L. Bosson1, A. Thiebaut-Bertrand1, R. Grillot1 and H. Pelloux1 1 Centre Hospitalier Universitaire (CHU), Grenoble, France, 2 Universite J Fourier, Grenoble, France
A signicant relationship between the degree of fungal contamination in haematology wards and the incidence of Invasive Nosocomial Aspergillosis has been demonstrated and, also, a causal effect between the environmental fungal contamination and INA in non-epidemic situations (Alberti et al, 2001). However, the factors involved in environmental fungal contamination are not totally known. Objectives: The aim of our study was to evaluate which factors, both internal (administrative gures for activity, parameters of behavioral practices and cleaning work) and outdoor factors (meteorological parameters and outdoor fungal spores) could inuence the level of lamentous fungi (FF) in the environment of medical wards and if preventive measures were effective enough to reduce environmental fungal contamination. Methods: Three wards (with 85% opacimetric air ltration) were prospectively studied during 30 month: two haematology wards (WA & WB) with patients at risk of IFFI and one infectious disease ward (WCC). The general preventive measures differed from one ward to another. The FF load was evaluated every 15 days: six surface samples were performed in four rooms of each ward using countact plates (Merck, Germany). Air samples (1 m3) were collected using Air Ideal (bioMerieux, France) and incubated at 27 C during 7 days. Outdoor factors were the meteorological parameters (temperature, humidity, pluviometry, speed, direction wind) and the number of fungi spores in the outer air (Burkard air spores sampler). Moreover, the internal factors were the presence or not of agranulocytosis patient in the room, the administrative gures for activity, the parameters of behavioral practices (cleaning work) and several descriptive characteristics reported at the moment of sampling. Results: Filamentous fungi were found in 3083/6224 samples, the surfaces being signicantly less contaminated than air (P < 0.001). The haematology wards with lamentous fungi preventive measures were signicantly less contaminated than a conventional ward without specic measures. The inuence of internal factors was greater in the conventional ward than in haematology wards: in the WA & WB, no correlation was found between administrative gures for activity and the intensity of FF ora, whereas in WC there was a positive correlation between the FF on surface and in air and the occupancy rate (P = 0.02 and rho = 0.41). The variation of ora in the hospital environment
Conclusion: In a conventional ward, the level of FF ora is inuenced by both internal and outdoor factors. The specic preventive measures, already performed in haematology wards, participate signicantly to decreasing the fungal load and in the control of the internal factors. This study draws attention to the utility of partial air control associated with specic preventive measures to obtain low levels of fungal contamination. However, outdoor factors cannot be controlled by these measures, emphasizing the importance of HEPA ltration and LAF in high-risk wards.
P076
Environmental isolates of Cryptococcus neoformans in Saint Petersburg, Russia N.V. Vasilyeva, I. A. Bosak, T. S. Bogomolova and I. V. Vybornova Kashkin Research Institute of Medical Mycology SPb MAPE, St. Petersburg, Russia Objective: To investigate natural sources of Cryptococcus neoformans in Saint Petersburg and to characterize biological properties of the environmental isolates. Methods: Isolation. Samples of pigeon droppings (picked in garrets of houses), soil, plant debris, contents of the intestine of dead urban wild birds (crows Corvus cornix, magpieses Pica pica, sparrows Passer domesticus, blue tits Parus major, bullnches Pyrrhula pyrrhula), materials from mucous membranes of oral and nasal cavities of domestic animals (cats, dogs) were cultured on Sabouraud agar supplemented with chloramphenicol and gentamicin and incubated at 37 C for 10 days. Identication of yeast colonies was based on morphological and biochemical features (Auxacolor2test). Susceptibility of C. neoformans isolates to uconazole and voriconazole was determined according to CLSI M44-A document. Virulence of C. neoformans isolates was studied on an animal model. Outbred mice were inoculated intravenously with different doses of yeast cells and observed for mortality during 28 days, then LD 50 of each strain was calculated. Urease, phenoloxidase and phospholipase activities of the environmental C. neoformans isolates were studied by plate methods on Christensens urea agar, L-DOPA agar and egg-yolk agar accordingly. Cell diameter and capsule size of yeast cells of each isolate were
54
measured under the light microscope. Ability of C. neoformans environmental isolates to grow at elevated temperatures was also determined. Results: We have investigated 124 samples of pigeon droppings, 18 samples of soil and plant debris, 63 samples of materials from the intestine of dead birds and 47 samples from oral and nasal cavities of cats and dogs. C. neoformans isolates were obtained only from 4 (3.2%) samples of pigeon droppings. Cultures of other natural materials were negative for this yeast. All environmental isolates were susceptible to uconazole and voriconazole. Diameter of yeast cells of the C. neoformans environmental isolates on Sabouraud agar ranged from 5.2 to 5.7 lm, capsule width in Indian ink preparation varied from 0.6 to 0.8 lm. All four isolates grew on Sabouraud agar after incubation for 3 days at 40 C and failed to grow at 42 C. Environmental isolates produced urease and melanin on corresponding media, the enzymatic activity was more expressed at 37 C in comparison with incubation at 28 C. Phospholipase activity of the isolates after 3 days of incubation at 37 C varied from Pz 0.54 to Pz 0.62. LD50 of the C. neoformans environmental isolates ranged from 1 million to 10 millions of yeast cells per mice, so virulence of the isolates was estimated as low. Conclusions: (i) Frequency of C. neoformans isolation from pigeon droppings in Saint Petersburg was 3.2%. (ii) Environmental isolates of C. neoformans were low virulent on an animal model.
the anatomical origin of the strains. Biolm formation was higher in rough strains of C. parapsilosis. Funding: Projects GIC07 123-IT-222-07 (Departamento de Educa cion, Universidades e Investigacion, Gobierno Vasco), S-PE08UN35 (Saiotek 2008, Departamento de Industria, Comercio y Turismo, n Gobierno Vasco) and PI061895/2006 (Fondo de Investigacio Sanitaria del Ministerio de Sanidad y Consumo de Espana).
P078
Molecular characterization of environmental Cryptococcus isolates from Cuba M.T. Illnait-Zaragoz1, G. F. Martnez-Machn1, C. M. Fernandez-Andreu1, M. R. Perurena-Lancha1, T. Boekhout2, J. F. Meis3 and C. H. Klaassen3 1 Instituto Pedro Kouri, Havana, Cuba, 2CBS Fungal Biodiversity Centre, Utrecht, The Netherlands, 3Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Background: The genus Cryptococcuscontains at least 34 species, but
Cryptococcus neoformans complex has been associated most with human and animal diseases. Within this complex, C. neoformans var. grubii and C. gattii are most often found. Cryptococcusgrowth is associated with decaying wood and plants. We conducted an environmental survey for Cryptococcuson various trees in Cuba. Methods: One hundred and eighty seven Isolates were collected from Ficus retusa (Indian Laurel tree), Termalia catappa (Indian Almond tree), Casuarina equisetifolia (Casuarina tree) and Delonix regia (Flamboyant tree) from Havana, Cuba. Initial selection of the isolates involved growth on CAA medium. Further tests involved growth on CGB medium at 37 C, urease production and characteristic phenotypes. All isolates were analyzed using molecular techniques. DNA was isolated from freshly grown cultures by a MagNA Lyser/MagNA Pure protocol. AFLP analysis was performed using established procedures using restriction enzymes EcoRI and MseI. DNA sequence analysis was performed on the ITS1-5.8S-ITS2 region and the D1-D2 region using standard procedures. Results: In this collection, 21 different clusters of species were recognized, the most prevalent species being C. heveanensis (33%). Only one isolate involved C. neoformans serotype A. No C. gattii isolates were recovered. No less than 53 unidentiable isolates were found that segregate into seven potentially novel cryptococcal species. None of the isolates were obtained from Ficus retusa. Conclusion: CAA and CGB medium are poor selective media for C. neoformans and/or C. gattii from environmental sources. Numerous molecular and biochemical unidentiable isolates are found when sampling environmental sources. Molecular analyses need to be applied to conrm identication of environmental isolates as such. Further studies are necessary to identify the environmental origin of human Cryptococcus infections in Cuba.
P077
Biodiversity, virulence factors and antifungal susceptibility of clinical isolates of Candida parapsilosis sensu lato M. Ortega-Riveros, I. Miranda-Zapico, E. Eraso and G. Quindos Universidad del Pas Vasco, Leioa, Spain
Candida parapsilosis is an increasing cause of invasive candidiasis. However, this species has been recently split in at least three different species Candida parapsilosis sensu stricto, and the closely related Candida orthopsilosis, and Candida metapsilosis. Differences have been reported among these species in antifungal susceptibility and virulence characteristics. Objectives: To study the biodiversity, virulence factors and antifungal susceptibility patterns in clinical isolates of Candida parapsilosis sensu lato. Methods: Twenty-two clinical isolates randomly selected from our stock collection including 14 C. parapsilosis sensu stricto, ve C. metapsilosis and three C. orthopsilosis were studied. The clinical origins of isolates were blood (12 isolates), oral mucosa (three isolates), vagina (three isolates) and other different specimens (four isolates). In addition, C. parapsilosis ATCC 90018 and ATCC 22019, C. metapsilosis ATCC 96143 and ATCC 96144 and C. orthopsilosis ATCC 96139 and ATCC 96141 were included as reference strains. Phenotypic switching was evaluated onto a Lees medium with phloxine B and only three aminoacids (lysine, valine and alanine) agar, biolm formation on polystyrene by a colorimetric method (tetrazolium salt reduction), proteinase and phospholipase production by a plate agar method and antifungal susceptibility by Sensititre YeastOne 9 (Trek Diagnostics Systems, USA). Results: Only two strains of C. parapsilosis showed a phenotype switching in the texture and morphology of colonies. Of them, one remained morphological stable in successive subcultures. This strain, with smooth phenotype, produced a poor biolm and showed a decreased susceptibility to caspofungin (MIC 48 h = 8 lg ml-1). Five out of 14 C. parapsilosis (four with rough phenotype) were moderately producers of biolm on polystyrene. The rest of C. parapsilosis produce a poor biolm. Moreover, all isolates of C. metapsilosis and C. orthopsilosis were poor biolm producers. Most isolates were susceptible to the all antifungal agents tested, but ve isolates of C. parapsilosis (four with smooth phenotype) had a decreased susceptibility to anidulafungin (MIC 48 h = 4 lg ml-1). However micafungin was active against all C. parapsilosis isolates. Phospholipase and proteinase activities were not detected in any of the tested isolates. Conclusions: The smooth phenotype of C. parapsilosis was less susceptible in vitro to anidulafungin. Micafungin was active against C. parapsilosis. There was no relationship between virulence factors and
P081
Occupational fungal contamination in the professionals of gymnasiums with swimming pool C.V. Viegas1, C. V. Alves2, E. Carolino3, L. Rosado2 and C. S. Santos4 1 ESTeSL, Lisbon, Portugal, 2National Institute of Health Dr. Ricardo Jorge, Lisbon, Portugal, 3Higher School of Health Technologies of Lisbon Polytechnic Institute of Lisbon, Lisbon, Portugal, 4School of Public Health New University of Lisbon, Lisbon, Portugal Objectives: To describe the occupational fungal contamination
phenomenon in the feet of professionals of gymnasiums with swimming pools. Methods: Two hundred and fty-eight samples were collected from the feet of 124 professionals in order to asses the degree of fungal
55
contamination. The samples were taken with a sterile scalpel in cases where individuals had visible injuries, and with a swab where there were no macroscopically lesions were visible. Simultaneously, a grid with information on the injured part of the foot was lled out. Results: From the 124 professionals tested, 58 (47%) had visible injuries. Of those 24 (41.4%.) had injuries on the nails, 16 (27.6%) had injuries in the interstices of the toes, and the remaining 18 (31%) showed injuries in other locations of the feet. In 143 isolates, the frequency of isolation for yeasts and fungi was 58.7% and 41.3%, respectively. Yeasts were the most isolated in the 58 professionals with visible injuries (41.4%), followed by dermatophytes (24.1%) and other lamentous fungi (6.9%). There were also mixed infections (8.6%) and negative results (19.0%) from the same individuals. Candida parapsilosis and Rhodotorula sp. were yeasts most frequently isolated (20.2% for each species), from dermatophytes Trichophyton rubrum was the most frequently isolated (55.5%) and from other lamentous fungi besides dermatophytes Penicillium sp. were the most frequent ones (15.6%). There was signicant associations (P < 0.05) between visible injury and fungal species and between time of occupation and visible injury. Conclusion: The prevalence of tinea pedis and onychomycosis was similar to other international studies developed in athletes, swimmers, marathoners and judo players. Physical activity enhances the trauma of the nail, and probably is one of the justications for the greater frequency of injury in the nail. Studies have demonstrated the importance of moisture for the penetration of fungi and yeasts in skin. The fact that the skin of athletes and sports professionals remain wet for long periods can cause damage in that area and facilitated the fungal penetration. Prevention of cutaneous mycoses is crucial, especially because in some occupational groups, such as professionals of gymnasiums with swimming pool, the dermatomycosis and other mycoses can be considered work-related illnesses. Occupational exposure to fungi may hence be considered as risk factor for fungal infections.
61 cases (23.92%) in Surgical Wards (including General Surgery Units and Orthopedics) and 27 cases (10.6%) in adult ICU. Susceptibility data showed that all strains were sensitive to amphotericin B. The highest resistance rates were observed to azoles, especially itraconazole, uconazole and ketoconazole. C. glabrata and C. tropicalis demonstrated the higher resistance rates to azoles among all Candida.
Conclusions: Candidemia is predominantly caused by C. albicans

(64%).The frequency of candidemia due to Candida non-albicans is quite high (36%). Parenteral alimentation and use of central venous catheters at low-birth infants seems to be associated with high incidence of C. parapsilosis in Neonatal ICU. C. glabrata is the third more often Candida isolated and its identication is clinically important due to high resistance to azoles. All Candida isolates remain susceptible to amphotericin B, whereas, the highest degree of resistance was observed to itraconazole, uconazole and ketoconazole.
P082
Candidemia: retrospective analysis of eleven year experience M. Christodou, A. Spiliopoulou, S. Vamvacopoulou, C. Bartzavali, L. Picoula, E. D. Anastassiou and M. Christodou University of Patras, Patras, Greece Objectives: To investigate the isolation and distribution rate of
Candida spp. in blood cultures and to evaluate antifungal susceptibility during an 11-year period (19982008) at a tertiary care hospital. Methods: Positive blood cultures (BacT/Alert, Organon Teknika) were examined microscopically directly for yeasts or pseudohyphae and subcultured on Sabouraud dextrose agar (Difco). Candida isolates were screened by germ tubes test and identied using API 20CAUX (Biomerieux). Antifungal susceptibility was carried out by E-test (AB Biodisk) on RPMI 2% glucose agar. MIC was evaluated according to CLSI criteria for the following antifungal agents: amphotericin B (AM), 5-uorocytocin (FC), ketoconazole (KE), itraconazole (IT), uconazole (FL), voriconazole (VO), posaconazole (PO) and caspofungin (CF). According to European Organization for Research and Treatment of Cancer, an episode of candidaemia was dened as one or more positive blood cultures for Candida species isolated from patients with clinical signs of infection. Subsequent positive cultures from the same patient were dened as new episode, only if there was an interval of at least 12 weeks between the two episodes. Results: During the study period there were 255 candidemia cases. An increasing frequency of Candida bloodstream isolates during eleven-year analysis varying from 1.33% (eight cases) of all positive blood cultures in 1998 to 4.4% (47 cases) in 2008 was observed. All patients with fungemia were immunocompromised. The causative species were: C. albicans 163 strains (64%), C. parapsilosis 35 (13.7%) C. glabrata 25 (9.8%), C. tropicalis 19 (7.4%), other Candida spp 13 (5.1%). One hundred and six (106) candidemia cases (41.6%) were identied in Medical Wards (including Internal Medicine Ward, Haematology-Oncology Unit and Transplantation Center), 61 cases (23.92%) in Neonatal Intensive Care Unit (NICU),
P083
Fungal pathogens in the air at the Wroclaw Department of Dermatology, Venereology and Allergology R. Bialynicki-Birula1, E. Baran1, J. Szepietowski1, C. Lukaszuk2, E. Krajewska-Kulak2, W. Kulak2, H. Rolka2 and E. Oksiejczuk3 1 Wroclaw Medical University, Wroclaw, Poland, 2Medical University of Bialystok, Bialystok, Poland, 3Bialystok Technical University, Hajnowka, Poland Objectives: Analysis of incidence of fungal pathogens in the air at
the Wroclaw Department of Dermatology, Venereology and Allergology, Medical University of Wroclaw, Poland. Materials and methods: Materials for the tests were: the air samples in front of the building, the corridors, the library, the lecture hall, and the mycological laboratory. The air pollution were determined using SAS SUPER 100. Humidity and temperature were evaluated by a termohigrometr. Classication of the isolated fungi was made with an accordance to the current procedures. Results: From the air were isolated: in the library 69 colonies (mean CFU 138 41.5), from the book-stands 25 colonies (mean CFU -125 63.6), in the lecture hall 119 colonies (mean CFU 380 98.8), in the mason room 52 colonies (mean CFU 104 21.9), in the mycological laboratory 154 colonies (mean CFU -513 155.3). Temperature in the tested rooms ranged from 24.5 C (mason room) to 26.1 C (library), humidity ranged from 40.1% to 53.1%. Temperature outside of the building was 23.6 C, and humidity 51.6%. Moulds Peniciullim citricum and Aspergillus niger and the yeasts Candida albicans were isolated more frequently. Conclusions: The highest number of fungi colonies were isolated from the air sampled at the lecture hall and the mycological laboratory. Moulds were the most common airborne fungi. Temperature and huimidity in the tested rooms seems be a good conditions for the development of fungi.
56
P084
Evaluation of oral fungus diversity from patients with Anorexia Nervosa and Bulimia Nervosa by culture and molecular methods G.N. Back-Brito, A. J. Mota, S. S. Takamune, L.A.S. Bernardes, I. Balducci, E.F.G.B. Prado, T. A. Cordas, F. G. Nobrega and C. Y. Koga-Ito o o o Sa Paulo State University/UNESP, Sa Jose dos Campos Sa Paulo State, Brazil
Eating disorders (ED) as Anorexia Nervosa (AN) and Bulimia Nervosa (BN) can cause several systemic and oral alterations related to poor nutrition and induced-vomiting, although, no previous studies on the oral microora of these patients are available in the literature. In this way, the aim of this study was to evaluate fungal microora in the oral cavity of these patients by culture-dependent (CD) and cultureindependent (CI) methods. Fifty-six female and three male patients, aged from 19 to 58 (median = 26 years), with eating disorders (32 anorexic and 27 bulimic) were included in the study. These patients were under initial treatment at the Department and Institute of Psychiatry, Faculty of Medicine, University of Sao Paulo. Control group was constituted by 59 individuals, matched to the test group in relation to age (median = 26 years), gender and oral conditions. Patients with diabetes mellitus or other systemic diseases, pregnant women, total denture users and individuals under treatment with antibiotics/ antifungals/oral rinses during the last 45 days that preceded the sampling were excluded. Oral rinses and supragingival biolm samples were collected. Investigation by CD method was performed by plating oral rinses samples on Sabouraud dextrose agar with chloramphenicol, for evaluation of prevalence and phenotypic identication. Species of yeast were identied by Biomerieux API systems (API 20 C Aux). Identication of C. dubliniensis was conrmed by multiplex polymerase chain reaction (PCR) with a universal primer for Candida genus and a pair of C. dubliniensis-specic primers was used. Results expressed in cfu per millilitre were compared by ANOVA/MannWhitney test (5%). Five oral samples and dental biolm representative of each group of patients were selected for evaluation by CI method. Investigation CI method was performed by ribotyping analysis by sequencing of D1/D2 region of 28S rRNA. The region was amplied by PCR with universal primers, cloned and sequenced. About 1300 clones for ED group and 650 clones for control group were analyzed. The sequences obtained with at least 200 base-pairs were used to determine species identity matched to the GenBank database. More individuals from ED group were positive for yeast (74.6%) than to control group (47.45%). Candida genus yeasts were detected in signicantly higher number in the oral cavity of ED patients in relation to the controls (p-valor = 0.00001), and more species of Candida were identify in this group. C. albicans (total = 81.42%) was the prevalent specie in both groups, followed by C. dubliniensis (total = 5.23%). Molecular method demonstrated more diversity of genus and species for the groups studied. ED group had more different genus and species (n = 16) than control group (n = 1), only seven species were common to both groups (Pichia guilliermondii, C. albicans, C. parapsilosis, C. dubliniensis, C. glabrata, Issatchenkia orientalis and Saccharomyces cerevisiae). It could be conclude, that ED group showed a higher prevalence of yeast and more Candida species than control group. The investigation by the culture-independent method revealed a higher fungal diversity, some of these uncultured, besides species of Candida in the groups studied.
P085
The occurrence of the primary pathogenic yeast Cryptococcus gattii in Europe F. Hagen1, A. G. Burggraaf1, A. Kamermans1, J. Sweere1, K. Tintelnot2, D. Swinne3, F. Dromer4, R. Iatta5, M. T. Montagna5, J. M. Torres-Rodriguez6, M. A. Viviani7, A. Velegraki8, M. F. Colom Valiente9, M. Gari-Toussaint10 and T. Boekhout1 1 CBS Fungal Biodiversity Centre, Utrecht, The Netherlands, 2Robert Koch-Institut, Berlin, Germany, 3Institute of Public Health, Brussels, ` Belgium, 4Institut Pasteur, Paris, France, 5Universita degli Studi di Bari, Bari, Italy, 6IMIM Autonomous University of Barcelona, 7 ` Barcelona, Spain, Universita degli Studi di Milano, Milan, Italy, 8 University of Athens, Athens, Greece, 9Universidad Miguel `ndez, Alicante, Spain, 10Centre Hospitalier Universitaire, Herna Nice, France
Cryptococcosis is caused by the basidiomycetous yeasts Cryptococcus gattii (serotype B and C) and C. neoformans (serotype A, D and AD). Infections with C. gattii occur almost only in immunocompetent individuals, while C. neoformans var. grubii and var. neoformans have a predilection for immunodecient humans. Another major epidemiological difference between both species is the apparent restriction of C. gattii to tropical and sub-tropical regions, whereas both varieties of C. neoformans can be found worldwide. However, the distribution pattern of C. gattii has changed by an outbreak in the temperate climate of Vancouver Island (British Columbia, Canada). Recently, several case reports were published which suggests that C. gattii is becoming more prevalent in the temperate climate of Europe as well. This prompted us to set up an epidemiological study, in collaboration with the ECMM Cryptococcus and cryptococcosis workgroup, to investigate the occurrence of C. gattii in Europe. Amplied Fragment Length Polymorphism (AFLP) analysis was carried to genotype the C. gattii isolates and the mating- and serotype were determined using C. gattii specic primers for both the mating-type a and a STE12 locus. Also, seven loci were (partly) sequenced, namely the capsule related gene CAP10, glyceraldehyde-3-phosphate dehydrogenase (GPD1), Intergenic Spacer (IGS1), laccase (LAC1), mannitol-1-phosphate dehydrogenase (MPD1), phospholipase B (PLB1), and translation elongation factor 1a (TEF1a). We have investigated 97 C. gattii isolates, from which 62 were of clinical origin while 12 were isolated from the environment (water, soil and trees) and 23 had a veterinary origin (birds, camel, squirrel). Nine isolates showed phenotypic switching and harboured two phenotypic different colonies after pure culturing. Fifty-eight isolates were identied as genotype AFLP4/VGI, while the remaining isolates belongs to AFLP5/VGIII (n = 3), AFLP6/VGII (n = 26), AFLP7/VGIV (n = 2) and AFLP8 (n = 6). Two isolates belonged to a novel genotype, AFLP10. The majority of isolates was mating-type a (n = 66), 19 isolates were mating-type a, and 5 isolates harboured both mating-types. From seven isolates, the mating-type could not be determined. Fifteen mating-type a isolates fell into genotype AFLP4/ VGI, one in AFLP6/VGII and the remaining two isolates in AFLP10. Phylogenetic analyses, based on ten sequenced loci, conrmed the presence of ve different haploid AFLP genotypes of C. gattii in Europe. Most of the clinical cases were caused by isolates belonging to genotype AFLP4/VGI and AFLP6/VGII. It is possible that most of the patients acquired the infection with C. gattii during their stay in (subtropical and tropical) regions outside Europe. However, infections were also reported in patients who never travelled outside Europe. This indicates that C. gattii isolates of genotype AFLP4/VGI and AFLP6/VGII occur in the Mediterranean area.
P086
Invasive mold infections complicating acute falciparum malaria A.H. Groll1, J. Dabritz1, D. Holzinger1 and G. Just-Nubling2 1 Childrens University Hospital, Mu nster, Germany, 2University Hospital, Frankfurt/Main, Germany Objectives: Malaria is the most important parasitic infection in
people, affecting 510% of the worlds population with more than two
57
million deaths a year. Whereas invasive bacterial infections are not uncommon during severe Plasmodium falciparum malaria, only a few cases of opportunistic fungal infections have been reported. Methods: We report a fatal case of pulmonary and disseminated mould infection in a patient recovering from complicated P. falciparum malaria, review the cases reported in the literature and discuss factors that put patients with imported malaria tropica at risk to develop invasive mycoses. Results: Including the case presented here, invasive pulmonary mould infections have been reported in sufcient detail in ve nonimmune patients with severe imported P. falciparum malaria, including one case with concomitant isolation of Absidia spp. and four cases with dissemination beyond the respiratory tract. Although diagnosed and treated during lifetime in three patients, the infection was ultimately fatal in all. At presentation, the parasite count ranged from 15% to 100%, and all patients had clinical signs and symptoms associated with hyperparasitemia and multiorgan failure; pulmonary inltrates were present in three patients. All patients were previously healthy individuals and between 26 to 54 years. None was neutropenic, and only two patients had received a short course of corticosteroids. All patients had marked hemolysis, three were reported to have metabolic acidosis, and three developed acute respiratory distress syndrome during hospitalization. The majority of patients had cleared the parasites from the bloodstream within 72 h. Clinical signs and symptoms associated with development of invasive mould infection were persisting or new fever despite parasite clearance, new or changing pulmonary inltrates, and persistent, worsening or new neurological signs. Conclusions: While larger epidemiological data are lacking, anecdotal evidence suggests that non-immune patients with severe P. falciparum malaria are susceptible to opportunistic fungal infections. The availability of free iron, tissue damage and acidosis through the interaction of the parasite with the microcirculation, measures of advanced life support, as well as the organisms interference with innate cellular and specic cell-mediated immunity all provide a plausible foundation for an association between severe P. falciparum malaria and the occurrence of invasive mould infections.
observed for the mean of aatoxigenic fungi colony count in summer and winter seasons. Conclusion: The present study tested the hypothesis that differences exist between fresh forages used in summer and the ensiled form used in winter in terms of contamination with aatoxigenic fungi. Although the detection of toxigenic fungi in a substrate does not necessarily indicate that mycotoxins are naturally occurring in the feed, it alerts to the potential risk of contamination.
P088
ECMM-FIMUA survey of Candida deep-seated infections in ICU patients: use of the DiversiLab for C. parapsilosis characterization in an outbreak setting A.M. Tortorano1, G. Lo Cascio2, M. C. Esposto1, M. Ligozzi3, V. Cusumano4 and A. David5 1 University of Milan, Milano, Italy, 2Servizio Microbiologia Azienda ` Ospedaliera Verona, Verona, Italy, 3Universita di Verona, Verona, ` Italy, 4Universita di Messina, Messina, Italy, 5D.A.I. Anestesia, ` Rianimazione ed Emergenze Medico-Chirurgiche, Universita di Messina, Messina, Italy
During the 2-year ECMM-FIMUA survey of Candida deep-seated infections in Intensive Care Unit (ICU) patients, a participating centre emerged among the others because of the high rate of candidemia (70.40 per 1000 admissions compared to a median of 10.08) and an abnormal frequency of C. parapsilosis as cause of bloodstream infection (BSI), namely in 28 out of 42 episodes (66%) compared to 15.5% of the other participating 26 centres. This induced to suspect an outbreak of C. parapsilosis BSIs. Objectives: The aims of the present study were to review the epidemiological data concerning the BSI episodes occurred in this centre and to assess the genetic relatedness among C. parapsilosis isolates in order to distinguish a true outbreak from a pseudo-epidemic. Methods: Blood isolates from 25 patients were available for the analysis. The ITS1-5,8S-ITS2 region was sequenced to differentiate among the three closely related distinct species, C. metapsilosis, C. orthopsilosis, C. parapsilosis, and the DiversiLab semiauthomated rep-PCR was performed to type C. parapsilosis isolates. Results: C. parapsilosis BSI occurred in 13 medical and 15 surgical adult (mean age 60.2 years, range 2385) patients and all episodes were considered ICU acquired as diagnosed after a median of 21 days (range 8113) of stay in the ward. All the isolates were identied as C. parapsilosis. Three different genotypes were distinguished among 24 typed isolates. One genotype caused eight episodes of BSIs that were diagnosed from July 2006 to November 2007, another genotype caused only two episodes that occurred 1 year apart. Other two highly related genotypes (>95% of homology) were responsible for a total of 14 episodes and they circulated in the ICU mainly in a 7 month period, from August 2007 to February 2008. Conclusions: The DiversiLab System resulted useful in this epidemiological investigation supplying evidence of the circulation of three genotypes in the ICU. The conclusion that most of the BSIs were caused by epidemic strains justied the exclusion of the data concerning this centre from the analysis of Candida species causing infections in ICU patients in Italy and to stress recommendations for control measures focused on improving hand hygiene compliance.
P087
Fungal population and distribution of aatoxigenic aspergilii in feeds in Iran S. Ghiasian and A. H. Maghsood UMSHA, Hamadan, Iran Background: Aatoxins (AF) are secondary toxic metabolites produced mainly by Aspergillus avus and A. parasiticus that contaminate food and feed. Aatoxins cause aatoxicosis which primarily results in liver damage, immunosuppression, reduced milk and egg production, embryo toxicity and abortions. Objectives: As the high incidence of AFM1 in milk of Hamadan district was seen, identication of cow feed mycoora with special respect to aatoxigenic fungi (A. avus and A. parasiticus) in order to make aware of aatoxin hazards in livestock in this area was investigated. Methods: One hundred and eighty six cow feed samples (wheat bran, dried bread, alfalfa, straw, molasses, barley and concentrate feed) from traditional and industrial dairy farms of Hamadan district were examined in summer and winter seasons. The dilution plating technique a precise, rapid and reproducible method was used. Results were obtained as colony forming units (cfu) per gram based on average count of triplicate set. Results: The predominant fungi isolated were Aspergillus spp. (avus, parasiticus, fumigatus, niger, ochraceous, nidulans, terreus) followed by species of Penicillium, Fusarium, Alternaria and Rhizopus. The concentrate feed was the most contaminated feed with aatoxigenic Aspergilli, which the mean colony count for A. avus and A. parasiticus were, 7.25100 and 7.50100 cfu g-1, respectively. The most contaminated feed with these two Aspergilli in summer were mollases and dried bread and in winter was concentrate feed. The mean colony count of aatoxigenic fungi in industrial dairy farms (8.19100 cfu g-1) was signicantly different (P < 0.03) from traditional dairy farms (4.33 100 cfu g-1). Statistically signicant differences (P < 0.00001) were
P089
Comparative study of samples of Candida sp isolated from vaginal secretion from two states in Brazil: Sao Paulo and Rondonia F. Aparecida Fonseca, G.C.M. Carla Matuura de Batista, F. M. Marques Americo, D. Moreira and C. R. Rodrigues Paula o o Universidade de Sa Paulo, Sa Paulo, Brazil Background: Candida vaginitis is one of the most frequent infection
of the female genital tract with a high incidence present in sexually active women.
58
Objectives: The aim of this study was to compare the prevalence of species of Candida, the enzyme prole and sensitivity to antifungal agents produced by strains isolated from vaginal secretion of women in two regions of the country. Materials and methods: Samples of Candida sp were diagnosed according to traditional methods of identication by Kurtzman & Fell (1998) and proteinase activity by Ruchel et al. (1982), Price et al. (1982) and phospholipase according to Price et al. (1982). For susceptibility of drugs in vitro we applied diffusion agar method (ETEST), using RPMI 1640+MOPS medium. Results: In Sao Paulo, 68% of the samples were C. albicans, Candida glabrata 16%, 6% of C. kefyr, 4% of C. guilliermondii and C. krusei and 2% of C. tropicalis. In Rondonia were 66% of C. albicans, 12% of C. krusei, 10% of C. tropicalis and 2% of C. guilliermondii. Regarding enzymatic activity of yeasts, phospholipase was observed in 38% of samples from Rondonia and in 78% of the samples from Sao Paulo, the production of proteinase was observed in 80% of the isolates from Sao Paulo and in 58% of samples from Rondonia. Samples from Sao Paulo had demonstrated to be more sensible than samples from Rondonia. Conclusions: Although C. albicans is the specie of higher prevalence in both regions studied, the diversity of species was greater in Sao nia Paulo. The data show that the samples from Sao Paulo and Rondo have distinct phenotypic proles. Fact that can be associated with different social and environmental conditions experienced by women in these two regions.
The medico-surgical intensive care unit was the main hospitalization service (34 patients = 32%), followed by pneumology (19 patients = 16%), hematology (13 patients = 11%), surgery (10 patients = 9%). In vitro susceptibility to amphotericin B, uconazole and 5-urocytosine were determined for all 120 isolates, in vitro susceptibility to voriconazole and caspofungine respectively for 101 and 83 strains. The rate of uconazole-resistant or sensible-dose dependent Candida was 23% (27 of 120 isolates), 3% (2 for 67) for C. albicans, 74% (14 for 19) for C. glabrata, 8% (1 for 13) for C. parapsilosis, and 50% (10 for 20) for all other species. Conclusion: From this preliminary study, the following points must be retained. The majority of candidemias is mainly detected out of the intensive care unit. The percentage of C. albicans in candidemia seems to increase since last few years. It is an a anusual data, compared with recent international trends. The susceptibility to uconazole is under 80%, quiet low. This data justies using caspofungine as the rst antifungal therapy, which is a recent recommandation of IDSA guidelines.
P091
Fungal strains isolated from clinical specimens of patents with total parenteral nutrition (TPN) M. Sikora1, E. Swoboda-Kopec1, S. Blachnio1, I. Netsvyetayeva1, D. Kociszewska2, M. Pertkiewicz2 and G. Mlynarczyk1 1 Medical University of Warsaw, Warsaw, Poland, 2W. Orlowski Clinical Hospital, Warsaw, Poland Introduction: Infectious complication as well bacterial as fungal
concern all groups of patients with immune system deciency. Patients who receive total parenteral nutrition form group with high risk of infection. Fungal infection have a serious clinical importance in group of patients with parenteral nutrition support (TPN). Objective: Identication and occurrence analysis of fungal strains isolated from patients subjected for treatment of total parenteral (TPN) hospitalized in Department of Nutrition and Surgery in W. Orlowski Hospital in Warsaw. Materials and methods: Fungal strains were isolated from clinical samples of: blood, sputum, urea, bronchial discharge and swabs of: oral cavity, stoma, anus and cervix. Strains were cultured on Sabourauda agar plates (bioMerieux) with chloramphenicol addition. Identication of the isolates was performed on chromogenic agar ChromAgar (Becton Dickinson) and with use of microtest ID 32C (bioMerieux). Results: Fifty-ve yeastlike fungal strains were isolated from 37 patients. The most numerable group of isolates was Candida glabrata31 strains (56.4% out of all cultures) mainly from urea samples- 9 (29%), anus- 7 (22.6%), stoma- 6 (19.4%), and from other samples- 9 (29%). The other cultured species were Candida albicans- 13 isolates (23.6%), Candida tropicalis- 3 (5.5%), Candida parapsilosis- 3 (5.5%), Candida krusei- 2 (3.6%), Candida lusitaniae- 2 (3.6%) and Candida inconspicua- 1 (1.8%). C. albicans was the most often isolated from blood- three strains (23%), sputum- 3 (23%) and from other specimens- 7 (54%). Strains of C. parapsilosis were cultured from catheter blood- 3 isolates and C. tropicalis from blood and stoma- three isolates. Conclusion: (i) The most often isolated strain from Candida genus was C. glabrata- 56.4% from all isolates, and Candida albicans- 23.6% of isolates. (ii) Fungal strains were cultured mostly from urea samples- 12 isolates, stoma- 10, anus- 9, blood samples- 8, sputum- 8 and from other specimens- 8. Acknowledgment: Supported by Polish State Committee for Scientic Research (grant No. N N404 093735).
P090
Candidemia in a French tertiary care hospital: frequency of different species and antifungal susceptibility E. Mazars1, A. Panaque-Zulueta1, C. Cattoen1, F. Canis1 and N. Seguy2 1 Hospital, Valenciennes, France, 2University of Burgundy, Dijon, France Objectives: Invasive Candida infections are associated with high
mortality, especially in intensive care units. The changes in epidemiology and the emergence of antifungal resistance lead to permanent changes in medical practice. The knowledge of recent local epidemiologic trends and susceptibility to antifungals is critical in this context. Therefore, we reported preliminary epidemiologic characteristics of candidemia during 6 years. Methods: Our study is a retrospective, local, observational survey, from January 2003 to December 2008. All patients admitted in the tertiary hospital of Valenciennes, with candidemia, were included. It is a 1850-bed centre with an intensive care unit (19 beds), and haematology-oncology units. Clinical data is the current hospitalization. Mycological data are the identication and in vitro antifungal susceptibility of Candida isolates. The identication process was performed with a latex test, AuxacolorR test and chromogenic medium. The antifungal susceptibility testing were evaluated with E-testR for ve antifungal molecules (amphotericin B, uconazole, 5-urocytosine, voriconazole and caspofungine). Results: During these 6 years, 117 candidemia were detected in our tertiary hospital. Three patients (2.5%) developed a fungemia with two yeats : two with C. albicans and C. glabrata, one with C. albicans and Geotrichum capitatum. The numbers of candidemia and the C. albicans isolates are described for each year in the following table.
Years Number of candidemia N of C. albicans (%) 2003 15 7 (47) 2004 13 6 (46) 2005 19 11 (58) 2006 15 8 (53) 2007 20 12 (57) 2008 35 23 (62) Total 117 67 (57)
C. albicans was the most common pathogen (n = 67; 57%), followed by C. glabrata (n = 19; 16%), then C. parapsilosis (n = 14; 11%), C. tropicalis (n = 9; 7.5%), C. krusei (n = 5; 4%), etc.
59
P092
Fungal microbiota in sickle cell anemia patients under antibiotic prophylaxis C.Y. Koga-Ito1, M. S. Figueiredo2, J.A.P. Braga2, G. N. Back-Brito1, A. J. Mota1 and B. M. Matos1 1 o o Sa Paulo State University, Sa Jose dos Campos, Brazil, 2Paulista o Medical School, Sa Paulo, Brazil Objective: Sickle cell anemia is the most frequently observed
hereditary disease in Brazil. A total of 3500 new cases are registered every year, and prevalence studies reported that 2.1% of the blacks and their descendents are affected by the disease. Nowadays, early diagnosis is frequent due to neonatal trial exams. Because there is high susceptibility to infections and high mortality/morbidity rates associated to septicemia or secondary meningitis, these children receive prophylactic antibiotic therapy with penicillin, started just after the diagnosis. Antibacterials are cited as a predisposing factor to the development of oral candidosis, however no previous studies on the effect of this treatment on the oral fungal microbiota are found in the literature. Moreover, the oral mucosal tissues can be considered a primary entry portal for all opportunistic pathogens and, particularly in immunocompromised hosts, these infections may lead to lifethreatening systemic disease. The aim of this study was to evaluate the fungal microbiota in the oral cavity of sickle cell anemia children. Methods: Twenty-ve children, 13 female and 12 male, with ages between 4 to 11 years with sickle cell anemia (genotype SS) and under antibiotic therapy with penicillin for at least 6 months were included in the study. Age/sex/oral conditions paired-control group were composed by 25 healthy children with no oral or systemic diseases. Exclusion criteria were use of orthodontic appliances, paciers or mouthrinses and diabetic patients. Oral rinses were collected and the identication was performed by API 20 AUX. The conrmation of C. dubliniensis identication was performed using a validated multiplex PCR assay. The results were expressed as values of colony-forming units per milliliter (cfu/ml). Results: Salivary levels of yeasts were signicantly higher among sickle-cell anemia patients in relation to controls (median values 1455 and 5, respectively; P = 0.017). A total of 117 isolates were identied. Candida albicans was the most frequently isolated species in both groups. In the sickle cell anemia group, C. dubliniensis, C. famata, C. rugosa, C. sphaerica, and C. tropicalis were also detected. In the control group, C. albicans, C. famata, C. parapsilosis, C. tropicalis and Saccharomyces cerevisiae we additionally identied. All the ve isolates identied as C. dubliniensis by API 20C AUX were conrmed by PCR. Conclusions: Fungal oral levels were signicantly higher among patients with sickle cell anemia in relation to controls. This result suggests that more attention should be given to the risk of the development of fungal infections among these patients.
Methods: Environmental samples are collected prospectively over a

12 month period once a week inside (hematological wards) and outside the UHC. Samples are incubated and fungal colonies identied and quantied. At the same time, patients are screened for nasal colonization with Aspergillus spp. via nasal swab sampling. We aim to determine frequency and distribution of these fungi and demonstrate any relationship of their epidemiology with seasonal conditions. Genotyping of A. terreus isolates will be performed to demonstrate whether there is a strain similarity or rather a genomic diversity of A. terreus. Results: A total of 4919 air samples were collected over a 12 month period, 2707 from inside and 2212 from outside the UHC. The outdoor density of Aspergillus spp. ranged from 4.4 CFU m-3 to 37.4 CFU m-3 (mean 17.5 CFU m-3), reaching its peak in November. Nine A. terreus strains were detected; three strains from outside and six from inside the hospital. Inside the UHC, an average of 4.6 CFU m-3 was measured. A. fumigatus (92.9%) was predominant both inside and outside of the hospital, followed by A. niger (5.3%), A. avus (2.1%), and A. terreus (0.2%). A total of 855 nasal swabs from 240 patients have been analyzed, a single one was positive for Aspergillus spp. Conclusions: Aspergillus spp. are routinely detected in samples from the environment of the University Hospital of Cologne. The most frequently detected fungus was A. fumigatus. A. terreus was rare. These ndings differ from other hospitals, possibly caused by different seasonal and environmental conditions. The average of 4.6 CFU m-3 inside the hospital may be of concern, but was much lower than the outdoor density of Aspergillus spp. at all times. Nasal swabs are not helpful in identifying patients with Aspergillus spp. colonization of the upper respiratory tract.
P094
Yeasts from mygratory birds and birds of prey as marker of environmental fungi P. Danesi1, L. Biasion1, R. De Nardi1, C. Salvatore1, C. Cafarchia2, A. Peano3 and G. Capelli1 1 Istituto Zooprolattico Sperimentale delle Venezie, Legnaro (PD), Italy, 2Faculty of Veterinary Medicine, University of Bari, Bari, Italy, 3 Faculty of Veterinary Medicine University of Torino, TORINO, Italy Objectives: The aim of this work was to study the prevalence of
yeast ora in the upper respiratory tract and in the cloaca of different species of migratory birds and birds of pray as marker of environmental fungi and to evaluate their possible role as carriers of pathogens for humans and animals. Methods: Birds representing 19 species of Anseriformes, Pelecaniformes, Strigiformes and Falconiformes orders were sampled. Cloacal and pharyngeal swabs were obtained from each bird. Swabs were cultivated in Sabouraud agar and incubated at 25 and 37 C. Yeasts identication was made by macroscopic observations, microscopic morphology and API ID32C (Biomerieux). Differences in yeast frequency were tested by the Chi-square test (v2). Results: Yeasts were isolated from 187 (33%) out of 557 sampled birds with the highest percentage in Strigiformes (52.6%) and Falconiformes (47.2%). A total of 239 yeasts belonging to Candida spp. (45.2%), Cryptococcus spp.(25.9%), Rhodotorula spp. (28%) and Geotrichum spp. (0.80%) were isolated both from cloaca and pharynx as reported in Table 1. Eleven Candida species and three Cryptococcus species were identied. Among Candida species, C. famata (44.4%), C. albicans (17.6%) and C. guilliermondii (15.7%) were the most frequently isolated ones. Among Cryptococcus species, Cryptococcus laurentii (14.7%) and C. uniguttulatus (16.4%) were the most frequently isolated from pharynx and cloaca respectively. Yeasts were isolated only from cloaca in 94 (16.9%) birds and only from respiratory tract in 118 (21.2%) (Table 2). Cloacal and pharyngeal prevalence of yeasts were signicantly different in Anseriformes, Pelecaniformes and Strigiformes orders (P < 0.05) but not in Falconiformes (Table 2). Comparison between Anseriformes prevalence (30.9%) and the others three orders of birds indicated that there was a tendency towards a lower prevalence in Anseriformes yeast isolates (P = 0.052).
P093
One year Aspergillus spp. Surveillance study at the University Hospital of Cologne S. Gerlach1, J. J. Vehreschild1, M.J.G.T. Ruping1, P. Hartmann1, C. Lass-Florl2, K. Grif2, G. Fischer3 and O.A. Cornely1 1 Uniklinik Ko Ko Germany, 2Medizinische Universita ln, ln, t Innsbruck, Innsbruck, Austria, 3RWTH-Aachen, Aachen, Germany Objectives: Environmental contamination with Aspergillus spp.
plays a key role in infection transmission of invasive aspergillosis (IA). High environmental conidia loads have been associated with outbreaks of IA. High-efciency particulate air (HEPA) ltration was shown to reduce incidence of the disease. Still, the relation between environmental contamination and patient colonization with these pathogenic fungi remains uncertain. In this study, we evaluate the epidemiology of A. terreus, A. fumigatus, A. niger, and A. avus strains collected from air samples at the University Hospital of Cologne (UHC), and correlate ndings with colonization of the upper respiratory tract of inpatients.
60
Conclusions: Our data conrm the presence of Cryptococcus nonneoformans species in cloaca and upper respiratory tract of wild and domestic birds as reported by different authors (Cafarchia et al., 2006, Rosario, 2005). C. uniguttulatus and C. laurentii are generally considered relative thermotolerant and unable to multiply in birds digestive tract. Their presence in the cloaca is probably due to the survival of a limited number of cryptococci coming from the crop. In general the number of isolates from pharynx was higher than cloacal isolates. In particular we found a higher prevalence of Candida famata in comparison to C. albicans and the other Candida species reported in literature. According to Garcia et al. (2007) nocturnal and diurnal birds of prey (Strigiformes and Falconiformes) seem to be more efcient carriers of yeasts compared with other orders of birds, likely due to the different physiology of feeding characterized by regurgitation of undigest part of pray like bones, feathers etc. Birds may be host and possibly long-range carriers of different types of pathogens and their implication from an epidemiological point of view is very important. Furthermore, there is the need of improving our diagnostic techniques considering that a large number of yeast isolated from wild species are still unknown and very difcult to identify.
P095
Prevalence of candidaemia in University College Hospital Ibadan R.O. Oladele1, M. A. Petrou2 and R. A. Bakare1 1 University College Hospital Ibadan, Ibadan, Nigeria, 2 Hammersmith Hospital, London, United Kingdom Objectives: Candidaemia is a widely studied and reviewed in the
developed world, however there is lack of information on nosocomial candidaemia in Nigeria despite the increasing use of more therapeutic modalities in patient management and the increasing incidence of immunosuppression due to HIV/AIDS, neoplastic disease and use of immunosuppressive agents. The objective of this study was to determine the prevalence of candidaemia, estimate the mortality rates and identify factors associated with candidaemia amongst immunosuppressed patients with persistent fever admitted in University College Hospital, Ibadan. Methods: Venous blood was collected following standard protocols from 230 immunosuppressed patients with persistent fever while receiving adequate antibacterial coverage and incubated at 37 C using BACTEC 9050. Positive samples were examined microscopically using direct gram staining; those showing yeasts were cultured onto Sabourauds agar and CHROMagar Candida. Germ tube was performed on all yeasts for the presumptive identication of C. albicans and all isolates were identied to species level using API20AUX and API32C. The susceptibility of all isolates to Amphotericin B, Flucytosine, Fluconazole, Itraconazole, Voriconazole, Posaconazole and Caspofungin was performed by both the CLSI and EUCAST method. Clinical details of the patients were entered into a semi-structured pro-forma form incorporating socio-demographic data, medical/surgical history of known risk factors for candidaemia and other laboratory ndings for Candida and analysed using SPSS 13.0 software. Results: Candidaemia, the 3rd most common isolate recovered from blood was detected in twelve patients, a prevalence of 5.2%. Time to positive culture was 17 (mean 3.5) days. The species isolated were C. parapsilosis4 (33.3%); C. tropicalis 6 (50.0%); C. albicans 1 (8.3%); and mixed infection of C. albicans and C. tropicalis 1 (8.3%). CHROMagar Candida failed to identify all the species whereas both API20AUX and API32C gave the same result. The susceptibility data were similar between the two methods and in accordance to published data for each drug and species. Multivariate analysis using logistic regression and correlation revealed that apart from blood and stool Candida spp isolated from intravenous cut down (P = 0.040), mucositis (P = 0.019) and diarrhoea (P = 0.017) were signicantly associated with increased risk of development of candidaemia, while univariate analysis showed that old age, multiple surgeries and long term hospitalisation were signicant contributing factors. There was 91.7% crude (11/12 patients) and 50% attributable mortality.
Conclusion: These ndings prove that Candidaemia may be the cause of persistent fever in immunosuppressed patients that are not on prophylaxis or empiric antifungal therapy. The high mortality rate which must be directly related to the delay in commencing treatment should facilitate development of rational approaches for prevention, early identication and appropriate management of those patients at risk of developing this life-threatening condition. Furthermore it highlights the importance of prompt antifungal treatment and the availability of new oral and intravenous drug in hospital pharmacies, as at present our patients can only be treated with oral Fluconazole as no other drug is available, and the need for further studies in these susceptible populations
P096
Evaluation of species distribution and risk factors of candidemia: a multicenter case-control study N. Yapar1, H. Pullukcu2, V. Avkan-Oguz3, S. Sayin-Kutlu4, B. Ertugrul5, S. Sacar4, B. Cetin6 and O. Kaya7 1 Dokuz Eylul University Medical School, Izmir, Turkey, 2Ege University, Izmir, Turkey, 3Dokuz Eylul University, Izmir, Turkey, 4 Pamukkale University, Denizli, Turkey, 5Adnan Menderes University, Aydin, Turkey, 6Celal Bayar University, Manisa, Turkey, 7 Suleyman Demirel University, Isparta, Turkey Objectives: In recent years, an increase in the frequency of candidemia, especially due to more resistant non-albicans Candida, has been observed. This multicenter study was planned to determine the risk factors of candidemia, and the mostly encountered Candida species causing to bloodstream infections. Methods: A case-control study at six university hospitals was conducted in 1 year period. Candidemia was dened as isolation of any species of Candida from at least one blood culture of patients older than 16 years. At least two controls were randomly selected per cases from patients without candidemia matching according to the age groups and gender and hospitalized in the same department of hospital during the same period. For cases and controls, demographic and clinical data were collected Eastern Cooperative Oncology Group
61
(ECOG) Performance Status was used for asses how the disease affects the daily living abilities of the patient. For statistical analyses, chisquare, chi-square for trend and Fishers Exact tests were used and p values of <0.05 were considered as signicant. All statistical analyses were performed with Statistical Package for the Social Sciences (SPSS, Version 15.0, Chicago, IL, USA) and CDC software EPI INFO (version 6.0, Atlanta, GA, USA).
Results: In the study period, 83 candidemia episodes were identied.

Of the cases 36 (43.4%) were female and 47 (56.6%) were male. Mean age was 55.0 17.12 (min. 18max. 84) in case group and 55.8 16.58 (min.17max.90) in control group. Patient characteristics and risk factors for candidemia were shown in Table 1. Candida albicans was the most common species among isolates (38 of the patients-45.8%) followed by C. tropicalis (20 of the patients-24.1%) and C. parapsilosis (12 of the patients-14.5%). Candida glabrata was isolated only from four (4.8%) patients. Risk factors of candidemia due to albicans and non-albicans Candida spp were given in Table 2. Conclusions: In this study, we observed that non-albicans Candida strains were common in our patient group. But strains known to be more resistant to antifungal agents such as C. glabrata were rare. For that reason uconazole is still a good choice for non-neutropenic patients. Important risk factors for candidemia were length of hospitalization, urinary and central venous catheterization, thoracic, central nervous system or abdominal surgery, erythrocyte transfusion, total parenteral nutrition and use of systemic antibiotics or antifungals. Neutropenia, intubation and mechanical ventilation were identied as additional risk factors for C. albicans candidemia. Most of the risk factors were invasive procedures and medications. We concluded that a great number of candidemias were preventable infections by reducing of unnecessary invasive procedures or antimicrobials.
P097
Tinea capitis in central tunisia: prevalence and etiologic agents over a 30 years period A. Fathallah Mili1,2, S. Gaied Meksi2, A. Yaakoub2, F. Saghrouni2, S. Ghaith2, I. Bougmiza2, N. Berrjab2, N. Ben Hassine2 and M. Ben Said2 1 Institut Pasteur de Tunis, Tunis, Tunisia, 2CHU Farhat Hached, Tunisia Faculty of Medicine of Sousse, Sousse, Tunisia Background: The aim of this study was to determine the prevalence
of tinea capitis, to identify the causative agents of dermatophytosis and to study their evolution over time. Materials and methods: Our study was conducted retrospectively from 1979 to 2008 (30 years). During this period, we analysed 10902 scalps from suspected individuals. All samples were submitted to both direct examination and culture onto Sabouraud medium. The results were analyzed according to age, sex and etiological agent. Results: Out of 10 902 patients examined, 5858 (53.7%) were affected by tinea capitis. The age varied from 1 to 86 years. Trichophytic tinea was observed in 3894 (35.9%) patients including 2313 (59.4%) female and 1581 (40.6%) male. The age varied from 1 to 74 years. The 110 years was the most susceptible age group with a median of 7 years. The agents isolated were Trichophyton violaceum in 3884 (99.7%) cases and Trichophyton tonsurans in 10 (0.3%) cases. Microsporic tinea was reported in 1670 patients including 1059 (63.4%) male and 611 (36.6%) female. The age ranged between 1 and 56 years, most cases occuring between 1 and 10 years (median: 6 years). The main etiologic agents were: Microsporum canis in 1666 (99.7%); whereas Microsporum audouinii occurred in 3 (0.17%) cases and Microsporum nanum in 1 (0.03%) case. Favus tinea was recorded in 100 patients, among them, they were 56 (56%) were male and 44 (44%) female.The age varied from 3 to 45 years with a median of 10 years. 18 were observed in adults. Inammatory tinea capitis : During the study period, 106 (0.9%) inammatory tinea capitis were detected in 70 (66%) male and 36 (34%) female.The distribution of cases according the causative species was as follows: 65 (61.3%) Trichophyton mentagrophytes, 35 (33%)Trichophyton ochraceum and 6 (5.7%) Microsporum gypseum. Trichophyton rubrum tinea capitis was identied in 11(0.1%) cases: 6 (54.5%) male and 5 (45.5%) female, aged between 2 and 47 years and a median of 13 years. Conclusion: The incidence of tinea capitis varied over the 30 years period with an obvious decrease from the beginning of the 1990 s. The decrease was more signicant in trichophytic tinea caused by antropophilic dermatophytes and favus tinea which became exceptional since1998. In the meanwhile an increase in incidence of the
62
zoophilic M. canis was observed, and tended to exceed that of T. violaceum.
P098
Paracoccidioidomycosis: a case report B.C.A. Zoppas, G. S. Spader, M. De Liz, H. O. Oliveira and J.C.B. Bertotto Universidade de Caxias do Sul, Caxias do Sul, Brazil
Paracoccidioidomycosis, caused by Paracoccidioides brasiliensis, is the most common systemic mycosis in Latin America. Brazil accounts for about 70% of cases reported worldwide and the disease is the eighth leading cause of death among predominantly chronic infectious and parasitic diseases. The prole of the disease features a high prevalence and morbidity and affects the proportion of the population with less ability to have medical care. The clinical manifestation is the most common chronic disease in males, the proportion of 10 men to one woman, between 30 and 50 years of age, smokers and/or nutritional conditions of chronic alcoholism and poor socioeconomic, as the low immunity promotes the advancement of the disease. The disease is acquired by inhalation of conidia, causing a primary pulmonary infection that can spread to the oropharyngeal mucosa, suprarenal gland, central nervous system, testicles and prostate, among other tissues. The delay in diagnosis determines the depletion of the general state of the patient. This paper aims to report a case of Paracoccidioidomycosis as a chronic form, adult type of a 50-year-old male patient helped at the Central Clinic of the Universidade de Caxias, Caucasian, mechanical turner, smoker, living in Flores da Cunha, RS, Brazil, he sought medical care due to painful lesions present in the oral mucosa and ear, about 4 months ago. The clinical examination presented erosive lesions, erythematous, with bleeding points, diffusely distributed in the oral cavity, especially on the right side, invading the upper and lower lip, median sulcus of the tongue, sublingual mucosa ulceration in addition to apex of left external ear. The tests requested included: direct and mycological culture, chest X-ray and histological examination. The results found by direct mycological examination and culture were consistent with Paracoccidioides brasiliensis, and histopathological examination revealed chronic inammation with giant-cell reaction. The X-ray showed no changes. Itraconazole 100 mg 12/12 h was given. The lesions regressed in about 2 months. The patient is being monitored. The epidemiology, clinical signs and symptoms, diagnosis and treatment of this mycosis are presented and discussed.
C. albicans, 16 C. tropicalis, 13 C. glabrata and 10 C. krusei. Two reference strains, C. albicans ATCC 90028 and C. glabrata ATCC 90030, were used as quality controls. At rst, DNA from all cultures was isolated as intact chromosomes in agarose plugs. Furthermore, DNA from nine isolates of C. krusei and eight of C. tropicalis were then subjected to restriction using S I and BssH II endonucleases, respectively. The chromosomes were separated using the CHEF Mapper system (Bio-Rad Laboratories) in 0.81.0% agarose under conditions specic for each species. The karyotypes were compared using the GelCompar II software (Applied Maths). Simpsons diversity index (D) was applied to evaluate the discriminatory power of karyotyping for all species tested. Results and discussion: Thirty-eight karyotypes were dened among 65 isolates of C. parapsilosis (D = 0.945), 44 among 53 C. albicans (D = 0.994), 9 among 16 C. tropicalis (D = 0.806), 12 among 13 C. glabrata (D = 1.000) and three karyotypes among 10 isolates of C. krusei (D = 0.667). A combination of PFGE and restriction analysis (PFGE-REA) markedly increased the discriminatory power of C. tropicalis and C. krusei karyotyping. Moreover, two strains of a new species, C. orthopsilosis, were distinguished in the group of C. parapsilosis isolates based on the lowest degree of similarity. Moderate changes in karyotypes of subsequent isolates of the same species obtained from the same patients suggest frequent microevolutionary changes of strains in the course of infection. No specic karyotypes were found related to the patients sex, age group or diagnosis or type of the ward. Some C. albicans isolates obtained from patients in the same hospital tend to generate groups with slightly higher degrees of relationship suggesting potential geographical differences. Eight C. parapsilosis isolates obtained from eight patients in the Military Hospital Olomouc over a 5-month period had very high degrees of relationship (70100%), suggesting a possible nosocomial source of infection. Conclusion: Our results demonstrate that karyotyping of whole chromosomes has high discriminatory power for C. albicans, C. glabrata and C. parapsilosis strains. For C. tropicalis and C. krusei, a combination of PFGE and restriction analysis has markedly higher inter-strain discrimination. High karyotype variability is in agreement with the expectation that the source of bloodstream infections is usually endogenous. Acknowledgement: This work was supported by the Czech Ministry of Education (research grant MSM6198959233).
P100
Unusual risk factors in emerging clinical entity of primary cutaneous zygomycosis in tertiary care health services J. Chander, N. Gulati, A. Attri and H. Mohan Government Medical College Hospital, Chandigarh, India Background: Zygomycosis (mucormycosis) is extensively invasive
fungal infection with high mortality rate if not detected and treated well in time. Various clinical types of infections caused by this group of fungi i.e. zygomycetes belonging to order Mucorales, are becoming increasingly common. The chances of survival of patients remain grim, when full-edged infections are established. In most of patients suffering from zygomycetes, diabetes mellitus may be underlying factor but in primary cutaneous zygomycosis, clinical presentation may be without it. Objectives: To increase awareness among medical/surgical staff of this group of emerging infections and to emphasize importance of an early diagnosis and treatment of primary cutaneous zygomycosis. Patients: The patients diagnosed with primary cutaneous zygomycosis at the tertiary care hospital between 2001 and 2009 are being reviewed. These patients presented with diagnosis of necrotizing fasciitis. The patients, who presented with bacterial causes of necrotising fasciitis like Streptococcus pyogenes and Pseudomonas aeruginosa, were not included in this study. Methods: Detailed history of each patient was taken, clinical presentation, site of involvement, underlying illness and risk factor, if any, were noted. The diagnosis was established by direct microscopic evidence of broad, aseptate or sparsely septate ribbon-like hyphae with
P099
Karyotyping of Candida bloodstream isolates: an epidemiologic study P. Hamal1, A. Jedlickova2, S. Dobiasova3, V. Buchta4, N. Mallatova5 and V. Raclavsky6 1 Palacky University, Olomouc, Czech Republic, 2General Teaching Hospital, Prague, Czech Republic, 3Institute of Public Health, Ostrava, Czech Republic, 4Charles University, Hradec Kralove, Czech Republic, 5Regional Hospital, Ceske Budejovice, Czech Republic, 6University Hospital, Olomouc, Czech Republic Background and objectives: Systemic Candida infections are of
increasing medical importance. Although the source is usually endogenous, nosocomial patient-to-patient transmission is also possible, mostly by the hands of hospital staff. At present, molecular genetic methods are usually used for determining the identity or diversity of strains. This study aimed at karyotyping of bloodstream isolates belonging to the ve most frequent Candida species using pulsed-eld gel electrophoresis (PFGE). The following criteria were evaluated: (i) discriminatory power of the method, (ii) rate of relationship of the isolates and (iii) patient data related to the genetic prole of the strains. Materials and methods: One hundred and fty-seven isolates from 123 patients were included in the study: 65 C. parapsilosis, 53
63
right angle branching in KOH wet mount and histopathological examination of stained sections with H&E, PAS and GMS stainings. Fungal cultures were put up on standard media like Sabouraud dextrose agar for isolation and species identication. In case there was no sporulation on routine cultures, agar oatation technique was used for induction of spores. Molecular techniques were used in case there was no sporulation even by oatation method particularly in case of Apophysomyces elegans and Saksenaea vasiformis. An extensive debridement of the infected wound was done, which was followed by systemic amphotericin B and topical liposomal amphotericin B. The outcome of medical and/or surgical therapy was analysed in all these patients. Results: Out of ten patients reviewed, underlying illness i.e. diabetes mellitus was present only in two. The commonest risk factor was found to be injection abscess i.e. among four patients. In one case plaster of Paris (POP) cast was the precipitating factor. Apophysomyces elegans was isolated in ve cases, Saksenaea vasiformis in one and Absidia corymbifera (Mycocladus corymbiferus) in one. The fungal culture turned out to be sterile in three cases despite the fact that direct ndings of KOH wet mount and stainings being positive. Mortality rate was very high as only four patients responded well to medical and/or surgical treatment.
P101
Molecular typing of Malassezia spp. isolated from ear canal of dogs and cats with and without otitis using PFGE, RFLP and RAPD S.D. Coutinho1, M. C. Melhem2, M. A. Martins2 and G. H. Nardi1 1 o Paulista University UNIP, Sa Paulo, Brazil, 2Instituto Adolfo Lutz, o Sa Paulo, Brazil
Malassezia pachydermatis is an aetiological agent of supercial mycosis in animals, causing otitis and dermatitis. Since M. pachydermatis is the only non-lipodependent species in the genus, veterinary laboratories usually employ mycological culture medium without lipids to isolate this microrganism. Nevertheless, at the research level, lipodependent Malassezia species have been isolated from both healthy and diseased animals. The objective of this work was to determine the presence of lipo-and-non-lipodependent Malassezia species in the external ear canal of dogs and cats with and without otitis, characterizing strains using phenotypic and genotypic techniques. Fifty dogs, 25 with and 25 without otitis, and 71 cats, 28 with and 43 without otitis were studied. A total of 242 samples were studied 104 of otic secretion (otitis) and 138 of cerumen (without otitis). Samples were harvested on Mycosel agar supplemented with glycerol, malt extract and olive oil. Isolates were characterized phenotypically by means of macro-and micromorphology, catalase and esculin tests, and growth on Tween 20, 40, 60 and 80, and Cremophor-EL. Cariotyping was performed via PFGE and RFLP, genetic diversity was researched by RAPD. Malassezia spp. were isolated respectively from 28/52 (54%) and 33/48 (69%) of the cerumen and otic secretion samples originated in dogs. M. pachydermatis was the most prevalent species, having been isolated from 100% and 89% of the strains obtained from cerumen and otic secretion. Four lipodependent M. pachydermatis strains (4/3311%) were isolated from dogs with otitis. Malassezia spp. were isolated respectively from 19/86 (22%) and 42/56 (75%) of the cerumen and otic secretion in cats. M. pachydermatis was the most prevalent species isolated in cats, having been isolated from 65% (13/20) and 51% (22/ 43) of the strains originated from cerumen and otic secretion. Lipodependent species (M. furfur and M. sympodialis) were isolated respectively from 21/43 (49%) and 7/20 (35%) of the cats with and without otitis; percentual of isolation of M. pachydermatis and Malasssezia lipodependent in cats with otitis was similar. Through both genetic molecular methods employed in this research (PFGE and RFLP), strains were identied as M. pachydermatis, M. furfur and M. sympodialis. Concordance between phenotypical and genotypical techniques was 89%. It concludes that phenotypic methods permit an acceptable identication scheme for Malassezia spp., but if commercial veterinary laboratories do not use media with the addition of lipids for isolation of these yeasts, it might yield false-negative results in veterinary clinical samples. By means of RAPD were observed 29 and 22 different proles, respectively for dogs and cats. The most prevalent proles for M. pachydermatis were III (77%) and II (73%), respectively in dogs with and without otitis; in cats the most prevalent prole was I, in animals with (68%) and without otitis (42%). In M. sympodialis strains isolated from cats, prole XV was predominant (35%). These results conrm that there is genetic diversity among Malassezia spp. strains, and it is important to research if any of these subpopulations could express some genes related with virulence factors and pathogenicity. Grant: FAPESP-2006/61171-3; Capes-Prosup.
Figure 1 Primary cutaneous zygomycosis of right abdomen.
P102
Marine birds Malassezia isolation from Sao Paulo south cost, Brazil F.C. Viani1, M. C. Di Gregorio2, G.C.M. Batista1, C.C.N. Nascimento2 and C.R.P. Paula1 1 o Biomedical Science Institute-USP, Sa Paulo, Brazil, 2Universidade Monte Serrat, Santos, Brazil
The genus Malassezia include lipolic and lipodependent yeasts where the only exception is M. pachydermatis. The taxonomic of the genus Malassezia was revised recently, being recognized seven
Conclusion: There is an urgent need for high index of clinical

suspicion of zygomycosis thereby taking early biopsy of affected site so that benets of prompt diagnosis and therapy may be achieved. Injection abscess is one of the signicant precipitating factors in the development of primary cutaneous zygomycosis. The key to survival among these patients is establishment of an early diagnosis, correction of underlying disease process and prompt antifungal therapy combined with extensive surgical debridement of infected site including the healthy areas.
64
species: M. furfur, M. pachydermatis, M. sympodialis, M. globosa, M. obtuse, M. restricta and M. sloofae. Species of lipodependent Malassezia, considered previously exclusive of the man, they have been found in domestic and wild animals. It is known that the genus Malassezia can be found in wild animals and it is not limited the occurrence in tecidual lesions, being considered part of the microbiota of several species. It was objective of this work to isolate yeasts of marine birds found in the south coast of Sao Paulo, Brazil. After the imobilization of each bird, it was collected samples of the skin of the birds legs. They were analyzed three species of birds with a total of seven animals. They were isolated the following species of Malassezia for each animal species: Sula leucogaster, Malassezia sympodialis and M. furfur; Larus dominicanus, Malassezia sympodialis; Spheniscus magellanicus, Malassezia sympodialis. It is the rst isolation of yeasts of the genus Malassezia of these birds. The genus Malassezia can be found thoroughly distributed between mammals and wild birds besides the domestic animals and the man, being part of the normal microbiota. Its importance as pathogen should be discussed showing that ecological alterations of the host should be the main cause of the tecidual alterations associated to Malassezia species.
mortality rate was 13.2% in 10 days, 34.5% in 30 days, 43.6% in 180 days.
P103
Epidemiologic analysis and antifungal susceptibility of septicaemia due to Candida parapsilosis Y. Hirai, A. Y. Ainoda, T. S. Shoji and K. T. Totsuka Tokyo Womens Medical University, Tokyo, Japan Objectives: The availability of immunosuppressive and aggressive chemotherapeutic agents as well as broad-spectrum antimicrobacterial agents has created a large population of patients with fungal organisms such as Candida species.We analyzed nosocomial candidemia from 2004 to 2007 in Tokyo Womens Medical University Hospital. Notably Candida parapsilosis is the second pathogen of candidemia.We evaluate the epidemiologic analysis and antifungal susceptibility include micafungin of C. parapsilosis in the patients with candidemia. Methods: We merged two databases with electric medical record and microbacterial laboratory for enrollment of patients with nosocomial candidemia. All of C. parapsilosis isolates from blood culture were identied by routine microbacterial techniques with Walk Away 96SI plus (Siemens, German). Additionally they were measured antifungal susceptibility to amphotericin B, uconazole, voriconazole, micafungin by ASTY (Kyokuto Pharmaceutical Industrial Co.,Ltd) colorimetric microdilution system, adopted with CLSI method. We estimated the correlation of antifungal MICs between voriconazole and uconazole, micafungin and uconazole, micafungin and amphotericin B. We reviewed the background of patients, such as underlying disease and antibiotic use, vascular catheterization, parental nutrition at diagnosis, from electric medical chart. And we plot the survival curve in 30 and 180 days by Kaplan-Meier method. Statistic analysis was performed with the R (freeware version 2.8.1). Results: In our result of surveillance from 2004 to 2007,All the 189 episodes of candidemia had the following distribution: Candida albicans (43%), C. parapsilosis (26%), C. grabrata (13%), C. tropicalis (6%), C. guilliemondii (3%), C. lusitaniae (2%), C. krusei (1%). We enrolled total 46 episodes of C. parapsilosis nosocomial candidemia. All the 38 Candida parapsilosis isolates were identied.Resistance to amphotericin B and uconazole and voriconazole was not detected. Resistant to micafungin was detected in one of 38 isolates. But C. parapsilosis has wide range of antifungal susceptibility to micafungin (MIC 0.516 mcg ml-1).S-DD(MIC 2 mcg ml-1) were detected in 3 of 38 isolates. The correlations of antifungal MICs was detected between uconazole and voriconazole by spearmans rank correlation coefcient (P = 0.01,R = 0.819). On the other hand, no correrations was detected in micafungin. Risk factors for septicaemia due to C. parapsilosis were broad spectrum antibiotic use at septicaemia (98%), vascular catheterization (98%), parental nutrition (93%), cancer (57%), diabetes (39%), corticosteroid (24%), prothetic valve (15%), pancreatitis (11%), inammatory bowel disease (9%). The overall
Figure 1 Candidemia in TWMU 20042007.
Figure 2 Antifungal susceptibility.
Figure 3 MIC correration of antifungal agents.
65
Figure 4 Survival curve.
Conclusion: C. parapsilosis is the second or third pathogen of candidemia in the world. In our investigation, it was responsible for 26% of all candidemia as same as previous report from Spain(Benito et al. JCM 44;5:16811685,2006). We conrirmed that antifungal susceptibility to micafungin was almost favorable but extended.We found 2% of resistant to micafungin. C. parapsilosis is frequently transmitted horizontally via contaminated external sources such as medical devices and the hands of health care workers. Major risk factors for septicaemia due to C. parapsilosis were broad spectrum antibiotic use, vascular catheterization, parental nutrition in hospital environments.We emphasized that the standard precaution such as hand hygiene is effective for prevention against septicaemia due to C. parapsilosis. Because we suspect that C. parapsilosis is responsible for nosocomial infection.
nase) gene was amplied, and digested with BanI. C. parapsilosis, C. metapsilosis, and C. orthopsilosis SADH amplicons contained, respectively, one, three, and zero BanI restriction sites. Results: One hundred and seventy-nine isolates were C. parapsilosis sensu stricto (92.27%), 10 C. metapsilosis (5.15%) and ve C. orthopsilosis (2.58%). Two isolates of C. metapsilosis were from genitalia (7.69% of the total isolates from genitalia), one from blood (1.22% of total isolates from blood and other from sterile uids), three from skin (27.27% of the total isolates from skin), and four from other unknown clinical specimens (17.39% of the total isolates from unknown clinical specimens). C. metapsilosis was signicantly isolated with major frequency in skin than other different anatomic origin (P = 0.0003). C. orthopsilosis was isolated in one specimen from genitalia (3.85% of the total isolates from genitalia), one from blood (1.22% of total isolates from blood and other from sterile uids), one from oral-pharynx mucosa (1.92% of the total isolates from mucosa), and two from other unknown clinical specimens (8.70% of the total isolates from unknown clinical specimens). Conclusion: C. metapsilosis and C. orthopsilosis were identied as the cause of 2.44% (1.22% and 1.22%, respectively) of the invasive candidiasis previously attributed to C. parapsilosis. C. metapsilosis and C. orthopsilosis were also implicated in cases of supercial candidiasis, with a signicant association of C. metapsilosis to skin infections. Funding: Projects GIC07 123-IT-222-07 (Departamento de n, Universidades e Investigacio n, Gobierno Vasco), SEducacio PE08UN35 (Saiotek 2008, Departamento de Industria, Comercio y Turismo, Gobierno Vasco) and PI061895/2006 (Fondo de Investigacion Sanitaria del Ministerio de Sanidad y Consumo de Espana).
P105
Candidemia in Norway: a 5 year follow-up of a nationwide study I. Nordy1, P. Gaustad1,2, P. Sandven3 and Norwegian Yeast Study Group 1 Institute of Microbiology, Oslo University Hospital, Rikshospitalet, Oslo, Norway, 2University of Oslo, Oslo, Norway, 3Norwegian Institue of Public Health, Oslo, Norway Objectives: A nationwide, prospective candidemia study has been
ongoing in Norway since 1991. The specic objectives of the study are: (i) to dene the incidence of Candida bloodstream infections in Norway; (ii) to identify the spectrum of pathogens causing Candida bloodstream infections; and (iii) to obtain antifungal susceptibility data for Norwegian bloodstream isolates. The results for the years 19912003 have been published previously. This report presents the data for the period 20042008. Methods: Candida blood culture isolates from all microbiological laboratories in Norway (population 4.74 million) have been sent to the national mycology reference laboratory for identication and, with three exceptions susceptibility testing. Results: From 2004 to 2008 a total of 960 episodes of candidemia in 913 patients (43.5% women) were reported. The annual incidence of candidemia increased from 2.5 episodes/100 000 inhabitants (1991) to 3 (2003) to 4 in 2008. The incidence was highest in patients <1 years of age and in patients 60 years of age. In patients 80 years the incidence has increased from an annual average of 7.5/ 100 000 (1991) to 15.6 (2003) to 17 in 2008. Also in the age group 7079 years a marked increase was observed from 6.4 (1991) to 17/ 100 000 (2008). A total of 12 different Candida species were identied. The dominant yeast species were:
P104
Prevalence of Candida metapsilosis and Candida orthopsilosis among Candida parapsilosis clinical isolates from a Spanish yeast stock collection during 12 years I. Miranda Zapico1, E. Eraso1, J. L. Hernandez Almaraz2, A. J. Carrillo Munoz3, J. M. Hernandez Molina4 and G. Guillermo Quindos1 1 Universidad del Pas Vasco, Leioa, Spain, 2Hospital de Cruces, 3 Barakaldo, Spain, ACIA-Microbiologa, Barcelona, Spain, 4Hospital laga, Spain Carlos Haya, Ma
Candida metapsilosis and Candida orthopsilosis are newly described yeast species closely related to Candida parapsilosis. These new species can not be differentiated by conventional methods. There is an increasing interest in knowing the etiological role of these species as C. parapsilosis is reported as the second most frequently Candida isolated from blood in Spain. Objectives: To study the prevalence of Candida metapsilosis and Candida orthopsilosis among clinical isolates previously identied as Candida parapsilosis. Methods: One hundred and ninety-four clinical isolates from our stock collection of yeasts (from 1996 to 2007) were studied, including 82 from blood and other sterile uids, 26 from genitalia, 52 from mucosa, 11 from skin and 23 from other clinical specimens. C. parapsilosis ATCC 22019 and ATCC 90018, C. metapsilosis ATCC 96143 and ATCC 96144 and C. orthopsilosis ATCC 96139 and ATCC 96141, were included as reference strains. Isolates were identied as C. parapsilosis by conventional mycological methods. These species were differentiated by a twostep DNA-based identication test and AFLP described by Tavanti et al. (Candida orthopsilosis and Candida metapsilosis spp. nov. to replace Candida parapsilosis groups II and III. J. Clin. Microbiol. 2005; 43: 284292). Briey, a 716-bp fragment of the SADH (secondary alcohol dehydroge-
Species Candida albicans Candida glabrata Candida tropicalis Candida parapsilosis
2004 (%) 67.8 11.7 7.7 3.9
2005 (%) 63.7 19.2 5.6 2
2006 (%) 64.5 16.5 8.5 4
2007 (%) 73.8 11.9 5.7 4.3
2008 (%) 66 15.7 6.7 5.6
66
Conclusion: The candidemia incidence in Norway has increased

from 3 to 4 episodes/100 000 inhabitants from 2003 to 2008. The species distribution seems stable over all. C. glabrata is still common in the elderly, but now occur more frequently in younger age groups. We have not seen an increase of strains with reduced susceptibility to antifungal drugs.
P107
Survival frequency after treatment of invasive candida and Aspergillus infections in hospitalised patients in Germany, Austria and Switzerland (DACH-region) in 2006 M.H. Wernitz1, F. W. Leverkus1, C. Lenz1 and U. Gross2 1 Pzer Pharma GmbH, Berlin, Germany, 2National Reference Centre for Systemic Mycosis, Go ttingen, Germany Objectives: Ofcial statistics about the diagnosis of acute hospital
inpatients seems to be more valid to reect the public health impact of invasive fungal infections compared to ofcial statistics about the reasons for death for many reasons. We used the statistics about the diagnosis of hospital inpatients from Germany, Austria and Switzerland (DACH-region) to calculate the frequency of acute hospital inpatients with invasive Candida or Aspergillus infections that would have hypothetically survived in the after treatment with either conventional Amphotericin B or Fluconazole as standard antimycotic drugs or with voriconazole or echinocandins as new generation antimycotic drugs. Methods: Frequency of inpatients with invasive fungal infections were multiplied with survival rates of the systemic antimycotic drugs which were observed in prospective double-blinded or open-label randomized clinical trials about the treatment of proven/probable invasive Candida or Aspergillus infections (extrapolation). Trials were identied by systematic MEDLINE and EMBASE literature search using the key words survival, mortality, lethality and death in combination with the international nonproprietary names of the systemic drugs respectively. Literature search was done in the 50th week of 2008 and last updated on December 30, 2008. Inverse variance method was used to pool survival data if there was more than one study for one drug available and to calculate 95% condence intervals for all survival frequencies. Calculations were performed using SAS version 9.1 and RevMan 5.0. Frequencies of hospital inpatients with invasive fungal infections were provided by the federal statistical ofces of the corresponding countries. For this, special
P106
Oral and denture colonization by Candida and Staphylococcus in denture wearers C. Marcos-Arias, A. Varona, E. Eraso, J. Lopez-Vicente, A. Egua, A. De Juan, J. M. Aguirre and G. Quindos Universidad del Pas Vasco, Leioa, Spain Introduction: Denture stomatitis (DS) is a common recurring oral disease, observed in many denture wearers (DW). The aetiology of the disease is multifactorial (denture, smoking, dietary factors, pH) but Candida is a relevant cofactor. Candida adheres and colonizes oral surfaces including mucosa and acrylic dentures and co-aggregate with oral bacteria, developing biolms, which can resist antimicrobials and immune system. This resistance is higher in mixed biolms of Candida and Staphylococcus. Objective: To describe the frequency of oral Candida and Staphylococcus colonization in DW. Patients and methods: One hundred DW were randomly recruited from our Odontology Clinics, 45 of them were suffering from DS. Swabs were taken from the denture and the underlying mucosa. Microbiological cultures were performed in Columbia blood agar, and ChromID Candida and ChromID S. aureus chromogenic agar plates (Biomerieux, France). Clinical isolates were identied by conventional methods. Identication of Candida dubliniensis was conrmed by PCR with specic primers. Slidex MRSA detection test (Biomerieux) was used for the evaluation of methicillin resistance (MR). Results: Seventy nine isolates were yielded from 40 patients suffering from DS. C. albicans was the most frequent species (58 isolates, 73.4%), followed by C. glabrata and C. tropicalis (seven isolates each, 8.9%), C. parapsilosis (2, 2.5%), Saccharomyces cerevisiae (2, 2.5%), and one isolate (1.3%) each of C. dubliniensis, C. guilliermondii and C. krusei. 55 Staphylococci isolates were yielded from 21 patients suffering from DS. Staphylococcus aureus was isolated from three patients, S. epidermidis from 14 (two isolates were MR) and S. warneri from 8 (one was MR). In 19 patients with DS there was a mixed colonization by Candida and Staphylococcus. The most frequent combination was C. albicans with S. epidermidis (four patients), followed by C. albicans with S. warneri (three patients). One patient was colonized by C. dubliniensis, C. krusei and S. aureus. Seventy three Candida isolates were recovered from 38 DW without DS. C. albicans was the predominant species (43 isolates, 58.9%), followed by C. tropicalis (11, 15.1%), C. guilliermondii (10, 13.7%), C. glabrata (7, 9.6%), and C. parapsilosis (2, 2.7%). From 25 DW without DS, 59 Staphylococci isolates were recovered: S. aureus from four patients, S. epidermidis from 10, S. warneri from 11, and S. capitis and S. saprophyticus from two each. Thirteen patients were colonized by Candida and Staphylococcus. C. albicans was most frequently isolated from DS patients (P = 0.0016) and was present in all patients with type III DS. Conversely, C. guilliermondii was associated to DW without DS (P = 0.0444). Conclusions: There is a high colonization with Candida and Staphylococci in DW. There is a close association between C. albicans and DS. DS could be a potential reservoir for MR Staphylococci as one S. epidermidis and two S. warneri isolates were MR. Funding: Projects GIC07 123-IT-222-07 (Departamento de Educa cion, Universidades e Investigacion, Gobierno Vasco), and PI061895/ 2006 (Fondo de Investigacion Sanitaria del Ministerio de Sanidad y Consumo de Espana).
67
analysis were performed using the ICD-10 codes B37.1 and B37.5 B37.7 for systemic Candida infections and B44 for systemic aspergillosis. As the survival frequency depends on the follow-up period, only studies with follow-up period of 68 weeks were considered for primary analysis whenever possible. Results: In 2006, there was a total of 65 494 inpatients with invasive Candida infection and 6864 inpatients with invasive Aspergillus infection. There were 19 056 hits in the literature search and 13 studies were found to be relevant. For Candida infections, six studies were excluded from primary analysis as the timeframe of follow-up period was too different compared to the other studies. For aspergillosis, there were only studies with a follow-up period of 12 weeks available and therefore all studies were considered for primary analysis. As only adults and adolescents were included in the clinical trials for Candida infections, 2339 inpatients 15 years of age with invasive Candida infection in the DACH region were excluded from the basis for extrapolation. For invasive aspergillosis, survival frequency was 3707 (CI95% 32664187, Amhotericin B) to 4873 (CI95% 43245354, Voriconazole). For invasive candidosis, survival frequency was 41 682 (CI95% 37 89344 840, Amphotericin B) to 48 629 (CI95% 44 20953 050, Anidulafungin). Considering of excluded studies (sensitivity analysis) would reduce the lower bound of survival frequency in patients with Candida infections by 631 patients to 41 051 patients (CI95% 37 26144 209, Voriconazole). Conclusions: Our analysis demonstrates the public health impact of invasive Candida and Aspergillus infections in acute hospital inpatients in 2006 in the DACH region.
P108
Identication of Malassezia species isolated from scalp skin of patients with seborrhoeic dermatitis and healthy subjects A. Prohic, E. Kasumagic-Halilovic and N. Hadzigrahic University Clinical center, Sarajevo, Bosnia-Herzegovina
Malassezia yeasts are the causative agents of pityriasis versicolor and are implicated in the pathogenesis of various dermatoses including seborrhoeic dermatitis (SD). With the recent taxonomic revisions of the genus Malassezia identication of the species are needed to clarify the involvement of each individual species in the aetiology of disease. The aim of our study was to analyse the distribution of Malassezia species in lesions of SD and in skin of healthy subjects. Forty SD patients with scalp involvement and the same number of clinically healthy individuals were included in the study. The samples were obtained by scraping the skin surface of the scalp of all subjects and then incubated on modied Dixon agar. The yeasts isolated were identied by their morphological and physiological properties according to Guillot et al. method. The most common isolated species from SD lesions was M. restricta (27.5%), followed by M. globosa (17.5%) and M. sloofae (15%). The predominant species from healthy scalp skin was M. rrestricta, found in 12 (30%) patients and the prevalence of other species was 17.5% for M. globosa, 10% for M. sympodialis, 5% for M. sloofae, and 2.5% for M. furfur. We found no signicant difference in the distribution of Malassezia species between lesional skin in patients with SD and healthy skin.
this study was to analyze the epidemiological characteristics, the microbiology, treatment practices and outcome of zygomycosis in Greece. The study is part of the on-going European Zygomycosis Study, which is under the auspices of ECMM. Methods: Each case of zygomycosis is prospectively recorded in a Case Report Form and sent, either by mail or e-mail, to the department of the study co-ordinator (Prof. G. Petrikkos). Data collected include demographic, clinical and microbiological characteristics. Identication of zygomycetes is performed by culture, molecular sequencing and/or histology. We present here the results of the rst 5 years. Results: In 5 years, starting from January 2001, 45 cases were reported. Mean age of the patients was 55 years (range 187) and 24 (53%) were male. The most common (80%) underlying diseases and predisposing factors were hematological malignancies (38%), trauma (24%) and diabetes mellitus (18%). The other 20% included other malignancies, autoimmune diseases and use of deferroxamine. The clinical presentation was soft tissue infection in 16, rhinocerebral in 11 patients, sinusitis in 9, pulmonary in 6 and disseminated in 3. The large number of soft tissue infections was mainly due to an outbreak of surgical infections which occurred in a single hospital. Cultures were positive in 31 (69%) cases (Rhizopus sp 58%, Mucor sp. 30%, Rhizomucor 3%, Apophysomyces elegans 3%, Myocladus ramosus 3%, Sakseanae vasiformis 3%). Most cultures were also conrmed by molecular methods. Histology was performed in 26 (58%) cases. Medical treatment was given in 38 patients (84%) and 18 of these also received surgical treatment. The drugs used were predominantly liposomal amphotericin B either alone or in combination with posaconazole. Mortality was 55%. Conclusions: Zygomycosis in Greece is reported to be mainly due to Rhizopus and Mucor spp. The percentage of positive cultures is relatively high, though this may be due to reporting bias. Mortality is above 50%. The index of suspicion should remain high in order to diagnose all cases as soon and as accurately as possible in order to increase the chance of survival. Acknowledgement: This study was partially supported by the KapodistriasNational Program.
P110
Is invasive fungal infection changing? Epidemiological portrait from a portuguese oncology hospital C. Lameiras, A. Martins, P. Silva and M. A. Guimaraes Portuguese Institute Oncology of Porto, Porto, Portugal Introduction: Progress in the management of invasive mycoses in
cancer patients will be achieved from a better knowledge of the epidemiology of fungal infections, awareness of risk factors for fungal infections in certain sub settings of patients, availability of improved diagnostic tools and a more comprehensive approach to combination antifungal treatment. Objectives: To survey epidemiological changes regarding systemic fungal infection agents in cancer patients, due to the introduction of new azole and candine antifungal treatment in our hospital during the last 5 years. Methods: Epidemiological data of fungal blood isolates from cancer patients admitted at the Oncology Institute of Oporto (IPO-OPORTO) (300 beds) was reviewed from January 2004 to December 2008. Clinical isolates were identied by use of Vitek 1 (Biomerieux), and Microscan (Dade Behringer). Clinical data from patients admitted at different departments and the respective underlying diseases were also investigated. Results: From January 2004 to December 2008 a total of 6953 blood specimens were received at the Microbiology laboratory: 185 fungaemia episodes (2.7% of total positive blood cultures) were diagnosed. From these, 98.9% were identied as yeast and 1.1% due to lamentous fungi. Candida albicans was the major pathogen (45%) followed by C. parapsilosis, accounting for 40% of the episodes; C. krusei, C. glabrata, C. famata and C. tropicalis were less prevalent, corresponding to 3.8%, 3.2%, 2.2% and 1.1%, respectively. Conclusion: Our results show a decrease in the incidence of systemic fungal infection over the past 4 years. The most common
P109
Zygomycosis in Greece: report of 45 cases A. Skiada1, A. Mitroussia-Ziouva2, A. Antoniadou3, E. Trikka-Graphakos4, N. Sypsas1, M. Aggelopoulou2, L. Hadjihannas1, J. L. Rodriguez-Tudela5 and G. L. Petrikkos1 1 Laikon Hospital, Athens, Greece, 2University of Athens, Athens, Greece, 3Attikon Hospital, University of Athens, Athens, Greece, 4 Thriassion Hospital, Athens, Greece, 5Instituto de Salud Carlos III, Madrid, Spain Objectives: Zygomycosis has emerged as an important pathogen,
resulting in systemic fungal infections with a high mortality. The aim of
68
non-albicans species was C. parapsilosis, particularly in patients with central intravenous catheter and receiving large-spectrum antibiotics. Very few mould pathogens were responsible for fungaemia cases: two single strains, one of Acremonium spp and other of Fusarium spp. grew from blood culture. In spite of the decrease of incidence of haematogeneous infections, in general fungi have increased in the hospital, especially non-albicans yeasts and non-Aspergillus moulds, mainly from respiratory infections. During the last 5 years, C. albicans and C. parapsilosis were the main fungal pathogens responsible for fungal haematogeneous infection; most patients were admitted at the Hematology Unit, Pediatric Unit and Intensive Care Unit. This data provides epidemiological knowledge supporting the application of enhanced infection control measures, like improvement of staff hygiene protocols, monitoring of catheters and other medical indwelling devices, and monitoring of potential sources of fungal contamination. Moreover, it can help in therapeutic strategy for antifungal treatment of invasive infections in cancer patients.
P111
Fungus ball sinusitis due to Fusarium proliferatum. Report of a case and review of the literature D.C. Damiani, T. Chouaki, B. Guichard, Y. El Samad, S. Sid Idris, S. Blanpain, S. Testelin and C. Hennequin CHU DAmiens, Amiens, France
Fungus balls are the predominant clinical form of non-invasive sinusitis. Typically, they occur in immunocompetent patients with an unilateral involvement of a maxillary sinus, Aspergillus fumigatus being the most frequent etiologic agent. We report the clinical case of a 47-year old immunocompetent female who was diagnosed with a left maxillary sinusitis due to F. proliferatum. Four years ago she had received a root canal therapy. CT-scan showed a granulomatous and heterogeneous thickness of the mucosa organized around a foreign body. Fusarium was demonstrated in the direct microscopic examination and isolated in heavy growth from the materials collected during a Caldwell-Luc operation. Morphologic characteristics and TEF1 gene sequence identied the strain as F. proliferatum. In vitro susceptibility testing (EUCAST method performed at the Centre National de Reference des Mycoses et des Antifongiques, Pasteur Institute, Paris) revealed high MIC against -1 amphotericin B (8 lg ml ), Flucytosine (64 lg ml-1), Voriconazole (8 lg ml-1), Itraconazole (8 lg ml-1) and Caspofungin (8 lg ml-1). The patient was successfully treated with oral ketoconazole (200 mg day-1) for 2 weeks. Review of the literature reveals six additional cases of Fusarium sinusitis. Two immunocmpromised patients died with an uncontrolled infection. Characteristics imaging features and direct examination demonstrating fungal elements associated with negative cultures are common features of fungal sinusitis. However, identication of the etiologic agent is important for therapeutic adaptation. New antifungal agents should be tested as they could represented alternative therapeutic strategies.
diagnosed at the interval of 1 year in an endemic area and discuss the climatic anomalies associated with this occurrence. Methods and results: The endemic area of Botucatu study area is located in the central-western region of Sao Paulo State, Brazil. From 1966 to 2006, 96 cases presenting the AF PCM were registered. We then performed a cluster detection test to verify if an excess of cases in time and/or space occurred. Calculations were performed with the software SaTScan v7.0.3. Cluster analysis results include temporal and space-time clusters with no geographic overlap of clusters allowed and a maximum allowable cluster size of 50% of the population. The scan test was set to nd clusters for the maximum temporal period of 1 year. Mean cases by year was 2.37 (SD: 1.74) for the entire series; mean incidence was 0.4 annual cases/100 000 inhabitants. The temporal test indicated a signicant cluster in 1985 (P < 0.005). This cluster comprised 10 cases when 2.19 were expected for this year, with a relative risk of 4.98. Their clinical presentation was typical of the AF PCM. The space-time cluster included eight cases when 0.89 was expected for that location, with a relative risk of 9.77. The cluster suggests that some particularities took place in the antecedent years in those localities. Diagnostic or reporting methods of PCM could explain variation in incidence. However, practices of the UH were reviewed and it was not detected any modication in the diagnostic methods or reporting methodology. Evolution of land use showed that no abrupt change occurred which could also explain this cluster. Instead, we observed a signicant close relationship of climatic factors with incidence of AF in the entire series of data. Previous modeling study showed that the most signicant required climatic factors are increase of soil water storage 2 years before the probable year of infection combined with higher absolute air humidity in the year of infection. Soil water storage was atypically high in the years of 1982/83 (~2.11 and 2.5 above mean), especially in the cluster area, and the absolute air humidity in 1984, the year preceding the cluster, was much higher than normal (~1.6 standard deviations above mean), conditions that favored, respectively, antecedent fungal growth in the soil and conidia liberation in 1984, the probable year of exposure. Discussion: PCM still poses several challenges especially regarding the identication of P. brasiliensis ecological niche. Identifying clusters of PCM in different geographical areas is important because it may help to clarify the conditions that favor P. brasiliensis survival and growth in the environment and enhance human exposure, thus allowing the development of preventive measures. Acknowledgement: Financial support, FAPESP, CNPQ, LIM.
P113
Molecular diversity of Cryptococcus neoformans var. grubii in patients with recurrent cryptococcosis from central to west London M.A. Petrou1, J. F. Meis2 and C. H. Klaassen2 1 Imperial College Healthcare NHS Trust, London, United Kingdom, 2 Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Objectives: Cryptococcosis in immunocompromized patients usually
P112
First description of a cluster of acute/subacute paracoccidioidomycosis cases and its association with a climatic anomaly G. Benard1, L.V.B. Vizeu Barrozo2, M. E. Siqueira Silva2, E. Bagagli3, S. A. Alencar Marques3 and R. P. Poncio Mendes3 1 o Laboratory of Dermatology and Immunodeciencies, Sa Paulo, o o o Brazil, 2University of Sa Paulo, Sa Paulo, Brazil, 3Sa Paulo State University, Botucatu, Brazil Introduction: PCM is the most important endemic deep mycosis in
Latin America. Differently from most endemic mycoses (e.g., blastomycosis, coccidioidomycosis, and histoplasmosis), there are no published reports on outbreaks of PCM. We describe here a cluster of AF PCM cases
involves Cryptococcus neoformans var. grubii. Even after treatment, recurrent cryptococcosis may occur as the result of unsuccessful treatment (possibly as the result of acquired resistance) or by reinfection with another isolate. We examined C. neoformans var. grubii isolates from HIV patients from central to west London who suffered from recurrent cryptococcosis. Materials and methods: A total of 32 clinical isolates from 10 patients were included in the analysis. The time interval between the episodes was >2 months. DNA was isolated from freshly grown cells using a MagNA Lyser/MagNA Pure protocol. MLVA typing was performed using a previously reported panel of nine species specic microsatellite markers. Amplication products were analyzed on a MegaBACE 500 using established procedures. Data was analyzed using the multistate categorical similarity coefcient. Results: In eight patients, the obtained genotypes from different episodes were very different from each other. In two patients, identical or very similar genotype were found in more than one episode.
69
Interestingly, within an episode (ve episodes involving four patients) the patients were infected by more than one genotype. In two cases, this could be the result of genotypic microvariations as the result of microsatellite instability, but in the other cases, the genotypes were too different from each other to be considered related. A similar observation was made in several patients with a single episode of cryptococcosis. Conclusions: Our results show that recurrent cryptococcosis usually is the result of reinfection of the patient by a different isolate. Within an episode, immunocompromized patients may be infected by more than one isolate.
P114
Mucormycosis: about 11 cases in Sfax (Tunisia) S. Neji, F. Cheikhrouhou, F. Makni, A. Sellami, H. Sellami and A. Ayadi HU Habib Bourguiba Sfax, Sfax, Tunisia Introduction: Mucormycosis is a potentially fatal, rapidly destructive, opportunistic infection. It is rarely described in Tunisia in spite of the conjunction of various supporting factors. Methods and results: We report 11 cases of mucormycosis during 19982009. The patterns of mucormycosis were rhinocerebral (eight cases) and pulmonary (three cases). The mean age was 51.1 years (range: 1476 years). Sex ratio was 2.67. All patients were diabetics. For rhinocerebral cases, symptoms were dominated by a facial (50%) or periorbital (37.5%) swelling, a fever (50%), an exophtalmia (12.5%). Ophtalmoplegia was present in three cases. Hemiplegia was noted in two cases. The radiological investigation showed a cellulitis with sinusal and ethmoidal attack (six cases) with an extension of necrotic lesions towards the base of cranium and orbital area in ve cases. The parotid gland was affected in one case. For pulmonary mucormycosis, clinical ndings were non-specic with cough and chest pain. On imaging, an excavated opacity was seen in the three cases. For all ours patients, the diagnosis of mucormycosis was conrmed by anatomopathologic and mycologic investigation. Culture was positive for ve cases (Rhizopus oryzae). All the patients were treated with Amphotericine B (1 mg/kg/day). A surgical excision was associated for rhinocerebral cases. Conclusions: Mucormycosis is a fulminant affection, concerning the vital prognosis. It is due in majority of cases to the Rhizopus. The prognosis depends mainly on the precocity of anatomopathologic and mycologic diagnosis, enabling appropriate treatment. It is important to suspect mucormycosis in immunocompromised host suffering from non-specic lesions.
Hedi Chaker Hospital. Suspected Invasive aspergillosis cases were classied using the EORTC criteria. We collected weekly environmental samples (patients rooms, tables and acclimatisers) and clinical samples from each patient (nasal, expectoration and auricular). A total of seven microsatellites markers were selected. Primers were designed with the software Primer 3, and their specicity was veried by BLASTn. Results: One hundred and sixty-three neutropenic patients were hospitalized. One proven, 31 probable and 15 possible IA were diagnosed. Clinical sampling revealed that A. avus was the most frequent species (79.2%). From 690 environnemental samples, A. avus was isolated in the forth rang after Penicillium, Cladosporium and Alternaria. The molecular study of 48 A. avus isolates detected from clinical and environmental samples conrmed the mycological identication. For the typing of A. avus isolates, we found a variation from 2 to 7 alleles for each marker. The combination of ve markers yielded a Simpsons diversity index of 0.952 and using 12 microsatellites this index was 0.97. Conclusion: Our ndings underline the importance of environmental surveillance and strict application of preventive measures. The microsatellites approach is very suitable tool for large scale epidemiological studies.
P121
Fungemia with Saccharomyces cerevisiae three cases A. Gloeckner1, P. Abel2 and K. Zimmermann3 1 BDH Klinik Greifswald, Greifswald, Germany, 2University of Greifswald, Greifswald, Germany, 3Friedrich-Loefer-Institute for Medical Microbiology, University of Greifswald, Greifswald, Germany Background: Invasive mycoses in intensive care patients are commonly due to yeasts. During the past years, fungemia with nonalbicans species and uncommon yeasts has gained importance. Saccharomyces cerevisiae, a supposedly apathogenic yeast used in human food production is indistinguishable from Saccharomyces boulardii which has a role in the treatment of persistent diarrhea. We present three cases of fungemia with Saccharomyces cerevisiae. Two of these cases occurred during treatment with Saccharomyces boulardii. Cases: (i) A 61 years old male was treated with Saccharomyces boulardii for diarrhea because of complicated hemicolectomy. On day 24, a septic shock with acute renal failure occurred. On this same day, Saccharomyces cerevisiae was isolated from three arterial blood cultures. Therapy with uconazole for 13 days was successful. (ii) A 69 years old female who had been admitted for septic agranulocytosis, was treated with Saccharomyces boulardii for diarrhea. On day 15 of this therapy, a sepsis occurred and Saccharomyces cerevisiae was cultured from several blood specimens. Therapy with uconazole led to defervescence and stabilisation. (iii) Seven days after the onset of Saccharomyces sepsis in the second case, a 76 years old female who was in intensive care after cardiopulmonary resuscitation, became septic. As the causal agent, Saccharomyces cerevisiae was identied in a blood culture and from the central venous line. This patient had not been treated with Saccharomyces boulardii. After initial application of uconazole which turned out to have an increased MIC, therapy was changed to voriconazole and the patient improved. Conclusions: In each case, a bloodstream infection with Saccharomyces cerevisiae was proven by several cultures. A causal relation to the therapy with Saccharomyces boulardi i is plausible in two cases. In the third case, there must have been another source of infection. Given the temporal association with the second case, a transmission by health care personnel appears possible. Susceptibility testing of Saccharomyces cerevisiae seems necessary. The use of probiotic agents in critically ill patients should be considered carefully.
P115
Aspergillus avus: epidemiological study and molecular typing in invasive aspergillosis patients I. Hadrich1, F. Makni1, S. Neji1, F. Cheikhrouhou1, A. Sellami1, H. Sellami1, M. Elloumi2 and A. Ayadi1 1 Laboratory of Parasitology-Mycology, HU Habib Bourguiba Sfax, Sfax, Tunisia, 2HU Hedi-Chaker Sfax, Sfax, Tunisia Introduction: Invasive aspergillosis (IA) is a major opportunistic
infection in haematology patients. Preventive measures are important to control IA because diagnosis is difcult and the outcome of treatment is poor. Objectives: We prospectively and evaluate the prevalence of invasive aspergillosis in the protect unit of haematology and examined the environmental contamination by Aspergillus. We describe a new panel of microsatellites for typing A. avus isolates. Materials and methods: Three year prospective study (September 2004September 2007) were carried out in the haematology ward of
70
P122
Fungal hospital-acquired infections etiological factors in intensive care unit E. Swoboda-Kopec1, I. Netsvyetayeva1, B. Sulik-Tyszka2, E. Stelmach1, M. Sikora1, S. Blachnio1, M. Dabkowska1, M. Dabkowska1 and G. Mlynarczyk1 1 Medical University of Warsaw, Warsaw, Poland, 2Central Clinical Hospital, Warsaw, Poland
The aim of study was to assess species distribution and antifungal susceptibility Candida and Candida-related strains isolated from a group of non-neutropenic adult critically ill patients. Materials and methods: The study was conducted prospectively from January 2008 to December 2008 in the Central Clinical Hospital in Warsaw, Poland. Candida and Candida -related isolates were detected from blood, intravascular catheter, bronchoalveolar lavage, tracheal aspirate, swabs taken from mouth lesions, throat swabs, urine and fecal samples. Candida species were identied using API ID 32 System. Susceptibility testing was done for amfotericin B, uconosole, itraconasole, voriconazole, posaconasole and caspofungin using E-test. The signicance of results (MIC values) has been evaluated according to CLSI recommendations. Results: There were 1726 clinical samples analyses and among them 77 (4.46%) were positive for fungi. Candida albicans was the predominant species and accounted for 50.6% (39/77 isolates), followed by Candida parapsilosis 18.18% (14/77), Candida glabrata 16.88% (13/77), Candida krusei 9.09% (7/77), Candida tropicalis 7.79% (6/77 isolates). Candida parapsilosis was signicantly more common as etiological agent of fungemia and catheter-related fungemia (8/10 cases). All strains Candida albicans, Candida parapsilosis, Candida tropicalis were susceptible to uconasole. The percent of resistance varied as follow: 0% for amfotericin B, posaconasole and caspofungin; 25.97% for uconasole; 16.88% for itraconasole. Three isolates of Candida glabrata were resistant to voriconasole. Conclusions: (i) This study has shown a signicantly higher presence of non-albicans Candida as fungemia etiological agents in non-neutropenic critically ill patients. (ii) Naturally resistance for uconasole non-albicans Candida species reach almost one fourth of the Candida and Candida-related isolates. Acknowledgement: Supported by Polish State Committee for Scientic Research (grant No. N N404 093735).
same genotypic prole; i.e., a single strain was the causative agent of 10 cases of fungemia over a short period of time in different patients in the same hospital unit. Conclusion: Thus, the ndings suggest that an outbreak of C. parapsilosis occurred in the neonatal ICU during the period cited.
P124
Fungal pathogen epidemiology and susceptibility to seven antifungals in West London Hospitals ICU patients M.A. Petrou Imperial College Healthcare NHS Trust, London, United Kingdom
Candida infections are the fourth most common cause of bloodstream infection whereas in ICU bloodstream yeast infections have been reported to rank third. There is no general consensus regarding the clinical symptoms, the ideal method for proving a fungal infection or the best antifungal to use in ICU, thus identication and susceptibility of fungi recovered from ICU patients as early as possible will permit an efcient and safe treatment to commence without delay as it is acknowledged that when a patient is treated with life support procedures, immunosuppressive drugs and depending on the underlying disease the otherwise harmless fungi can cause severe and fatal infections. Specimens routinely received for microbiological investigation from ICU patients were also plated onto Sabourauds Dextrose Agar at 30 and 37 C; a 45 C plate was included for uids and respiratory samples which were concentrated by centrifugation. The rst yeast for each patient, yeasts suspected or proven to be the cause of infection as well as all lamentous fungi, 1849 isolates from 1128 patients during their stay in ICU were identied to species level; these were 1695 yeasts, 255 from blood [Candida albicans (40%), C. glabrata (29%), C. tropicalis (11%) and C. parapsilosis (8%), 13 other Candida spp. and nine other Yeast spp] and 154 lamentous fungi (FF) from 11% of patients [Aspergillus fumigatus (77%), ve other Aspergillus spp. and six other types of FF]. The MICs of these isolates were performed according to CLSI for Amphotericin B (AB), Flucytosine (FC), Fluconazole (FZ), Itraconazole (IZ), Posaconazole (PZ), Voriconazole (VZ) and Caspofungin (CF). A total of 28 different fungal species were recovered from these patients. The MICs of all isolates were 1 mg L-1 for AB. Applying the published break-points the activity of the other drugs was: FC- extremely active against all the yeasts with very few resistant, most but not all FF had MICs >32 mg L-1; FZ- very active against most yeasts but not C. glabrata, C. krusei, Rhodotorula and Trichosporon and the FF; IZ, PZ and VZ- extremely active against the yeasts and FF, FZ yeast resistance was not necessarily seen with IZ, PZ and VZ; overall CF was the most active drug against Candida spp. but not the other yeasts, no activity against Cryptococcus, Trichosporon and with the exception of A. versicolor, Fusarium, Fonseca and Mucor it showed good activity against FF, however no isolate was fully inhibited at 8 mg L-1. PZ activity was the mirror image to that of IZ except for Aspergillus spp. where PZ was the most active drug. In conclusion the ICU patient is colonised or infected by a large number of opportunistic fungi. Candida spp. and other yeasts were found to be the cause of severe infections however 11% of these patients were either colonised or infected with A. fumigatus and other FF, most of which required treatment. All seven drugs showed excellent activity against most of these potentially lethal pathogens however only the activity spectrum of AB covered 100% of the isolates recovered and tested.
P123
Fungemia by Candida parapsilosis: outbreak in a neonatal intensive care unit of the public hospital in Botucatu, Sao Paulo, Brazil C.R.P Paula1, L. S. Ruiz2, G.C.M. Batista2, E. G. Da Silva1, M. de F. Sugizaki1 and A. C. Montelli3 1 o Biomedical Science Institute-USP, Sa Paulo, Brazil, 2Universidade o o de Sa Paulo, Sa Paulo, Brazil, 3Universidade Estadual Paulista, Botucatu, Brazil Background: Nosocomial infections by Candida albicans, have become the major cause of mortality in neonates admitted to neonatal intensive care units (ICUs). C. parapsilosis is the second most frequently isolated yeast species in neonatal ICUs, is frequently the cause of clusters and a common source of outbreaks in these units. To determine hospital outbreaks, the use of phenotypic or molecular markers has become an important epidemiological tool. In the Neonatal ICU of the Public Hospital in Botucatu, SP, during the period from 21/09/1998 to 03/11/ 1998, a total of 11 patients admitted to the unit developed fungemia and the etiological agent in all cases was C. parapsilosis. Objective: The objective of this work was to detect the presence of a possible outbreak of hospital infection by C. parapsilosis in this unit. To achieve this, the microsatelite technique was used as a molecular marker. Results: Comparison of the genotypes of the 11 samples of C. parapsilosis obtained by molecular technique revealed that 10 showed the
P125
Acute respiratory distress syndrome caused by disseminated acute aracoccidioidomycosis: rst case report G. Benard1, A. N. Costa2, J. Ravanini2, S. G. Goulart3 and L. F. Ferraz da Silva2 1 o Laboratory of Dermatology and Immunodeciencies, Sa Paulo, o o Brazil, 2University of Sa Paulo Medical School, Sa Paulo, Brazil, 3 o o University of Sa Paulo, Sa Paulo, Brazil Introduction: Paracoccidioidomycosis (PCM) is a systemic mycosis
endemic in South America. This infection may appear in acute-
71
subacute or chronic forms. Acute-subacute presentations shows reticuloendothelial system involvement but spares the lungs. Acute respiratory distress syndrome (ARDS), has occasionally been described in other endemic mycoses. We describe the rst patient with acute PCM who developed fatal ARDS accompanied by multiple organ injuries. The basis of the rarity of this entity in patients with PCM, as well as the reasons that may have lead to the development of ARDS in this patient are discussed. Case report: A previously healthy 22 years old men presented with a 5-months history of weakness, myalgia, adenopathy, night sweats, weight loss and cough. On admission he was febrile and tachycardic, with normal blood pressure and generalized supercial adenopathy and hepatosplenomegaly. Lungs x-ray was normal, but a chest CT showed inconspicuous diffuse ground glass micronodular inltrate and septal thickening, mediastinal and axilar adenomegaly, and several lytic bone lesions; abdominal CT scan revealed hepatosplenomegaly, multiple adenopathy and several lytic bone lesions. A cervical lymph node biopsy demonstrated a chronic granulomatous process but no specic agent on usual stains. He evolved with rapidly progressive dyspnea, which progressed to respiratory insufciency that required mechanical ventilation, with a PaO2/FIO2 ratio of 152 and diffuse bilateral inltrates at ICU admission. Rare Paracoccidioides brasiliensis yeast cells were identied in a sputum sample. Other infectious agents were discarded by blood and sputum cultures, serology or anamnesis. Pulmonary artery catheterization ruled out cardiac dysfunction. The diagnosis of ARDS secondary to PCM was made, and amphotericin B was initiated. He evolved with respiratory failure followed by refractory shock and, despite vasoactive drugs administration and ventilation protective strategy, he died on the 4th day of ICU. Autopsy showed vast areas of necrosis and massive inltration of P. brasiliensis of the reticuloendothelial system. Liver hystopathology showed granulomatous inammation mainly in portaltract, and numerous yeast cells and large areas of necrosis with large amount of inammatory cells. In the lungs there were granulomas with rare yeast cells and a miliary distribution,. In addition, there was a diffuse alveolar damage consisting of edema, intra-alveolar hemorrhage, brin deposition, hyaline membrane formation and diffuse interstitial polimorphonuclear inltrate and reactive type II pneumocytes, characteristic of the exsudative phase of ARDS. Foci of bronchopneumonia were absent and active search for other infectious etiologic agents in the lung were negative. Discussion: The contrast between the massive infestation of P. brasiliensis with its consequences to the reticuloendothelial system and the small and apparently controlled inammatory response to the scarce fungal elements in the lung suggests that the ARDS was triggered by the systemic inammatory response rather than by the lung infection itself, opposite to the ARDS described in other deep endemic mycoses. Studies are needed to better understand the local and systemic response in severe and disseminated PCM cases, and the possible correlation with the inammatory status that potentially leads to ALI/ARDS. This would provide means to alert for the possibility of developing such lethal outcome. Financial support, FAPESP, CNPQ, LIM
P127
Abstract withdrawn.
P131
Occurrence of fungi in a neonatal intensive care unit G.C.M. Carla Matuura de Batista1, V.L.J. Lucia Jornada Krebs2, L. S. Silva Ruiz1, E. H. Helena Silva1, E. G. Goncalves da Silva1, D. Moreira1 and C. R. Rodrigues Paula1 1 ncias Biome dicas, University of Sa Paulo, Sa o o Instituto de Cie o Paulo, Brazil, 2Instituto da Crianca, Sa Paulo, Brazil Objectives: The study investigated the presence of fungi in the
neonatal intensive care unit (NICU) at a Tertiary Hospital in Sao Paulo, Brazil. Methods: Samples were collected from the hands of medical staff, hospital materials and equipment and the physical environment. Samples were also collected from insertions in the neonates, such as catheters and urinary and gastric probes. The samples of Candida isolated from the hands of the medical staff were analyzed molecularly using the PFGE technique. Results: Positivity for fungi occurred in 22.2% (14/63) of the samples. The anemophilous species were Aspergillus sp. and Penicillium (100%); Cladosporium (62.5%), Mycelia sterilia (25%). Samples taken from the medical staff yielded Candida albicans from the hand of one of the six participants (16.7%); while the samples from medical equipment yielded C. glabrata from the extension of an aspirator linked to the respirator of a neonate. During sample collection, two neonates were isolated due to fungemia (one by Candida albicans, the other by C. parapsilosis associated with C. tropicalis). From the hands of a nurse, C. albicans was isolated prior to washing and after drying demonstrated from PFGE techinique. Conclusions: PFGE typing can discriminate species of Candida and assist in the investigation of sources of hospital outbreaks. This study environmental indicate the need for elementary prophylactic measures to be undertaken in NICUs before outbreaks such as wash hands and reduce the dissemination of fungal particles in the air.
P132
Candida albicans isolated from human fungemia induce apoptosis in experimental endocarditis O.F.J.K. Olague1, D.H.M.A. Domnguez-Hernandez1, H.C.I. Hernandez Canaveral1, P.H.A. Plascencia Hernandez1, 2 1 O. M. Meilhac and V.R.F. Velarde Rivera 1 University of Guadalajara, Guadalajara, Mexico, 2Inserm, Paris, France Objective: To determine the ability of a C. albicans isolated from a
pediatric patient to induce myocardial tissue apoptosis. Methods and results: Nonbacterial thrombotic endocarditis was induced using a catheter left indwelling through the aortic or tricuspid valve, and animals were injected with a fungi inoculum. 1.56 CFU of C. albicans (HO7/116), in 1 ml 0.9% saline. Histological and immunohistochemical investigations were performed 5 days later. Representative samples of left sided endocarditis vegetations in rats, including aortic tissue, aortic valves, and left ventricles were xed in paraformaldehyde for 24 h, embedded in parafn for morphological analysis. In the present study, Alcian blue staining revealed the presence of large positive areas of mucoide substance in the valvular, aortic, and
P126
Abstract withdrawn.
72
myocardial tissue in close contact with the vegetations. These areas were the site in which TUNEL positivity was localized suggesting that mesenchymatous cell disappearance was topographically linked to vegetation activities.
Picture 3.
Picture 1.
Picture 4.
Conclusions: In endocarditis, apoptosis could be linked to the ability

of intrinsic host and yeast factors. Further studies are needed to determine the role of proteases released by septic vegetation to induce detachment and death of myocytes.
P133
Tinea capitis in a newborn infected by Trichophyton soudanense A. Rezusta, M. P. Palacian, M. L. Zubiri, M. J. Hernandez, M. L. Garca and M. J. Revillo Hospital Universitario Miguel Servet, Zaragoza, Spain Objectives: To describe the case report of a 12 days old black boy, born in Spain and seemingly healthy who presented a lesion in the scalp, with some hair loss and pustules. Methods: Clinical examination revealed a lesion of three circular eczematous lesions in scalp and face. Skin scrapings and hair samples were obtained after cleaning the lesions. Laboratory contacted the rest of the family and samples of hair and scales were taken. The material collected was microscopically examined in 20% KOH and Calcoour whithe stain for the presence of fungal hyphae and arthrospores, and inoculated on Sabouraud glucose agar (SDA) and potato dextrose agar
Picture 2.
73
(PDA) both added with chloramphenicol, and dermatophyte test medium (DTM). Identication of fungal cultures was made on the basis of both macroscopic and microscopic appearance according to Summerbell 2007. Results: Microscopic and cultural examination were positive for T. soudanense. The family members showed positive culture for the same dermatophyte fungus. Previously, the mother and one brother were studied in 2003, and T. soudanense was isolated in both patients. Conclusions: When the dermatophyte isolated is antropophilic, like T. soudanense, all family members need to be diagnosed and treated if it was necessary Its necessary to insist in the correct treatment and control to avoid relapses and dissemination specially in the groups of people with a difcult following.
P135
Trichophyton yaoundei in Italy: report of a case ` C.G. Calabro Gabriella, G. L. Gallo and F. E. Fiammenghi University of Naples Federico II, Naples, Italy
We report the case of a 7-year-old boy from an Ivory Coast family who lives in a little industrialized village in the suburbs of Caserta (Campania, Southern Italy) who went to our observation in December 2008 for the occurrence of multiple, sharply circumscribed, scaling, crusting and itching lesions of the scalp and erythematous and scaling plaques of the trunk. He went on a journey, with his family, to Ivory Coast for a month in August 2008. The patients mother referred the appearance of one erythematous and scaling lesion of the scalp in October 2008. He was treated by a dermatologist with oral uconazole and topical bifonazole for 2 weeks with worsening of the lesions. Fungal cultures analysis on Sabourauds dextrose agar had shown the development of Trichophyton yaoundei, an anthropophilic dermatophyte which is endemic in Africa. The patient was treated systemically with griseofulvin and locally with econazole for 6 weeks. Complete healing, conrmed by micological examination, was obtained. The growing racial mixing related to migratory movements is favoring, also in Italy, the integration of this strain with the species which are most commonly responsible for dermatophytoses. To our knowledge, this is the rst case of not endemic infection by T. yaoundei reported in Italy. Increased international migration and tourism is likely to result in more cases of this kind: this pathogen should be considered in the differential diagnosis of tinea of scalp and body.
P134
Cumulative diagnostic value of galactomannan and anti-aspergillus antibodies detection in children with haematooncology diseases V. Arsic Arsenijevic1, E. Ratkov1, S. Mitrovic1, I. Colovic1 and D. Janic2 1 Institute of Microbiology and Immunology, Belgrade, Serbia, 2 University Childrens Clinic, Belgrade, Serbia
Invasive aspergillosis (IA) is a serious life-threatening complication in immunocompromised children. The incidence of (IA) has increased signicantly in recent decades in parallel with the increasing number and improved survival of patients. IA in adults has been well characterized; however, only a few small studies of IA in children have been reported. Because early diagnosis and treatment are critical to the patients outcome, a high index of suspicion should be maintained in children with hematologic malignancies who are neutropenic and have prolonged fever that is unresponsive to systemic antibacterials. Detection of circulating antigens, such as galactomannan (GM), soluble antigen released during hyphal growth in tissues, appears promising in aiding in the diagnosis but frequently gives false positive results. In high risk children these methods are valuable for serial screening and early detection of Aspergillus infection. The clinical manifestations are heterogeneous and many organ systems can be involved. Diagnosis based on the clinical presentation alone is cumbersome. Objectives: The aim of this study was to investigate clinical usefulness of ELISA tests, for detection of GM and Aspergillus specic antibodies in pediatric patients, in the early diagnosis of IA. Methods: From November 2007 until February 2009, serum samples obtained from 16 children hospitalized in University Childrens Clinic, Belgrade, Serbia were tested for presence of GM and antiAspergillus antibodies. All the children had haematological malignancies and were clinically highly suspected for developing IA. Measuring of GM level was performed by a sandwich ELISA test (Platelia Aspergillus EIA, Bio-Rad, France) while anti-Aspergillus antibodies classes IgA, IgM and IgG were detected at the same time by ELISA test (Serion Elisa classic, Virion/Serion, Germany). Results: A total of 79 serum samples from 16 children were tested for the presence of GM and anti-Aspergillus antibodies. The group consisted of nine girls and seven boys. Ages of children ranged from 3 months to 17 years (mean 7.96 years). GM was found positive in 25% (4/16) patients without anti-Aspergillus antbody detection. Only anti-Aspergillus antbody were detected in 18.75% (3/16) patients, while GM was negative. Two patients were both IgM and IgG positive, one patient was IgG positive. In almost half of screened children (56.25%) results were negative. Conclusion: Since one of the disadvantages of GM is high prevalence of false positive results in children, further investigations are needed for evaluating diagnostic value of cumulative detection of GM and specic humoral immune response. The implementation of accurate diagnostic criteria and standardized protocols in children at risk is elementary for denite, well-timed early diagnosis and sufcient therapy for a successful outcome of IA in children.
P136
Scalp pseudomycetoma caused by Microsporum canis in an immunocompetent pediatric patient R.G. Vitale1, M. Larralde1, A. Castillo1, M. E. Abad1, P. Boggio1, M. Label1, M. C. Corbella1, J. Afeltra1, J. F. Meis2 and R. G. Vitale1 1 Ramos Meja Hospital, Buenos Aires, Caba, Argentina, 2 Canisius-Wilhelmina Hospital, Nijmegen, The Netherlands Introduction: Pseudomycetoma is an extremely infrequent deep
skin and subcutaneous tissue infection due to dermatophytes that mainly affect the scalp of children and is commonly preceded by a longterm tinea capitis. Clinical case: A 13-year-old girl presented with a 6 months history of two asymptomatic nodules on her scalp. Physical examination revealed diffuse white scale and alopecia suggestive of tinea capitis. Two erythematous rm nodules, 11.5 cm of diameter were also observed that were initially interpreted as inammatory pilomatrixomas. The patient started oral griseofulvin at a daily dose of 20 mg kg-1. After 3 months of treatment, scalp desquamation and alopecia resolved, but the nodules persisted and increased in size and number. One of them was surgically removed and was sent for histological and mycological evaluation. Histopathology showed a normal epidermis and the presence of aggregates of ne basophilic granules embedded in a homogeneous eosinophilic matrix surrounded by a giant cell granulomatous reaction in the deep dermis. Periodic Acid Schiff (PAS) stain revealed that those granules consisted of hyphal aggregates. Direct mycological examination showed hyaline hyphae, but culture on SGA, DTM after 3 weeks of incubation and several subcultures to different media, with extended incubation periods, developed only sterile mycelia. Then, with this criterion, since the fungus could not be identied, molecular methods were employed. The obtained ITS sequence of the isolate proved to be 100% identical to Microsporum canis sequences. Therefore, diagnosis of scalp pseudomycetoma caused by Microsporum canis was conrmed. Acquired immunodeciency was discarded. The remaining nodules were all surgically excided, and medical treatment was rotated to oral terbinane, 10 mg kg-1 per daily, during 7 months. After 5 months of follow-up the girl is free of lesions. Discussion: Fungal mycetoma is chronic infection of the skin and subcutaneous tissues characterized by tumefactive and indurated
74
nodular growth, draining sinus tracts and macroscopically visible granules. Mycetoma of the scalp due to dermatophytes is called pseudomycetomaand is an extremely infrequent entity in humans. It clinically differs from eumycotic mycetomas in that there are larger lesions, may affect other sites of the body than hands and feet, and do not have stulae. Additional features include the presence of pseudogranules as well as different histopathological ndings. However, direct self-inoculation of the microorganism through scratches may also play a role in the pathogenesis of this disease. We herein report an additional case of pseudomycetoma due to Microsporum canis in an immunocompetent girl, associated with tinea capitis with a good response to combined surgical and medical antifungal treatment. To our knowledge, only four pediatric cases of pseudomycetoma attributable to Microsporum canis have been described in the literature.
Comments: Congenital candidiasis, and especially meningitis is very

uncommon. As in our case, the low pathogen load has been previously described to cause false negative results at the beginning of Candida congenital infections. The diagnosis of Candida congenital meningitis was made on bases of mothers obstetric history and response of persistent CSF abnormal ndings from birth to antifungal treatment, as well as clinical and microbiological response to antifungal treatment.
P139
Ventriculitis due to Aspergillus fumigatus in a child with central nervous system tuberculosis C. Antachopoulos1, T. Stergiopoulou1, M. Simitsopoulou1, E. Georgiadou1, S. Kottas1, D. Marinopoulos1, A. Anastasiou2 and E. Roilides1 1 Aristotle University, Thessaloniki, Greece, 2Hippokration Hospital, Thessaloniki, Greece Objectives: Central nervous system (CNS) aspergillosis in immunocompromised patients usually presents with brain lesions (abscesses) and carries a poor prognosis. Reports of Aspergillus meningitis/ ventriculitis are rare. We present a case of ventriculitis due to A. fumigatus to highlight its features and outcome and we report the results of the intraventricular antifungal activity on systemic antifungal therapy. Methods: Case report and ex vivo evaluation of antifungal activity of cerebrospinal uid (CSF) against A. fumigatus isolate. The antifungal effect of CSF was studied by incubating undiluted CSF samples for 1/2, 1, 2 or 4 h with pre-grown hyphae of the patients Aspergillus isolate and assessing hyphal damage using a modied XTT assay. Case and results: We present a case of ventriculitis due to A. fumigatus in a 5-year old girl with refractory CNS tuberculosis. At the time of presentation she was on isoniazid, rifampin, pyrazinamide, levooxacin and high-dose dexamethasone (0.8 mg kg-1 day-1) started 4 weeks ago due to neurological complications of tuberculosis. She also had a ventriculoperitoneal shunt due to hydrocephalus. A febrile episode of shunt infection led to removal of the device; cultures of both the valve and catheter revealed A. fumigatus. The patient was started on liposomal amphotericin B (LAMB) at 7 mg kg-1 day-1. Dexamethasone dose was gradually reduced. MICs of A. fumigatus isolate to both amphotericin B and voriconazole were 0.25 lg ml-1 by CLSI method. Fevers persisted and CSF examination revealed neutrophilic pleocytosis with negative bacterial and fungal cultures. Aspergillus PCR in the CSF was positive as well as galactomannan index (5.5). An MRI brain scan revealed no new parenchymal lesions; however, areas of increased signaling in the ventricles suggested ventriculitis. Voriconazole (8 mg kg-1 day-1) was added while rifampin was discontinued to avoid interference with voriconazole metabolism. Intraventricular administration of amphotericin B deoxycholate (DAMB) was also commenced at a dose of 5 mg, followed by 2.5 mg every other day for 1 month. Fevers subsided and CSF galactomannan ratios gradually decreased, becoming persistently negative after 3 months of antifungal treatment. Duration of therapy with LAMB and voriconazole was 4 and 5 months respectively. During the rst month of combined systemic and intraventricular antifungal treatment CSF was collected after intraventricular DAMB administration, at 2 h as well as at 48 h (i.e. before the next intraventricular dose). The mean hyphal damage (two separate experiments) caused by CSF samples obtained 2 h post-DAMB administration was 78%, 93%, 97% and 96% for 1/2, 1, 2 or 4 h incubation periods respectively. Corresponding hyphal damage values obtained with CSF collected 48 h post-DAMB administration were 28%, 57%, 57% and 71% (P < 0.01 by two-way ANOVA). Conclusion: Aspergillus fumigatus ventriculitis appears to be successfully managed using combined systemic (LAMB, voriconazole) and intraventricular (DAMB) treatment. In particular, intraventricular DAMB administration appears to be well tolerated and signicantly augments antifungal activity against A. fumigatus hyphae.
P137
Systemic paheohyphomysis due to Exophiala (Wangiella) in an immunocompromised child D. Alabaz1, F. Kibar1, M. D. Sancak2, M. D. Arikan1, M. D. Celik1, N. Aksaray1 and M. D. Turgut1 1 Cukurova University, Adana, Turkey, 2Hacettep University, Adana, Turkey
We report a rare pediatric case of systemic lymphadenitis and hepatic involvement due to Exophiala (Wangiella) dermatitidis. An 8-year-old immunocompetent boy with chronic fever was investigated by sonography and CT scan, demonstrating cervical and mesenteric lymph node enlargement and numerous small hepatic lesions. The etiologic agent was isolated from lymph node aspiration culture. The isolate was identied by its morphological characteristics and DNA sequencing of the internal transcribed spacer region of r DNA. Despite initial amphotericin B and variconazole therapy, the childs jaundince subsided and died 7 months later. In addition to pathogenic aspects of to Exophiala dermatitidis, the diagnostic approaches and relevant therapeutic strategies are discussed.
P138
Candida congenital meningitis in a preterm neonate S. Tadros1, H. Ntouganioti1, A. Mitroussia2, M. Kimouli1, A. Bakossi1, M. Theodoraki1, D. Petropoulou1 and A. Tsakris2 1 General Hospital of Nikea, Nikea, Greece, 2Medical School, University of Athens, Athens, Greece Introduction: Candida congenital meningitis in neonates is very
rare.
Case: A set of female dizygotic twins, were born 32 weeks of

gestation. Twin A died within few hours, while twin was transfered to our NICU. Their mother was treated for cervical incompetence and vaginal candidiasis during the second trimester of her pregnancy. Baby was started on empiric antibiotic therapy, because of elevated CRP, and very low CSF glucose level. Blood and CSF cultures were negative. On day eight, the neonate looked slightly unwell, LP was repeated. CSF glucose remained very low, protein level was high with pleiocytosis (478 cells mm3, and lymphocyte predominance), indicating chronic meningitis. Blood and urine cultures were sterile. PCR for bacterial genomes, HSV, CMV, enteroviruses, ureaplasma, and Candida albicans were negative. Stool cultures grew Candida albicans. U/S and MRI brain showed mild signs of ventriculitis, while ophthalmologic and cardiologic screenings were normal. Wide spectrum antibiotics were initiated. On day 40 (fourth week of antibiotic), LP showed the same ndings as above, but this time CSF culture was positive for Candida albicans. Antifungal therapy was given for 4 weeks. At the end of therapy, LP and brain MRI ndings were normal. The baby remained clinically well throughout therapy.
75
P140
Early mannan detection in bronchoalveolar lavage uid reduces the incidence of invasive Candida infections in high-risk preterm infants M.S. Sanguinetti, B. Posteraro, S. Boccia, E. De Feo, M. La Sorda, M. Tana, C. Tirone, C. Aurilia, V. Vendettuoli, G. Fadda, C. Romagnoli and G. Vento ` Universita Cattolica del S. Cuore, Roma, Italy Objective: To investigate whether early detection of Candida mannan in bronchoalveolar uid (BAL) reduces invasive fungal infection (IFI) and mortality among very low birth weight (VLBW) infants. Methods: We conducted an observational study of infants with birth weight of <1275 g and gestational age of <28 weeks, where a retrospective cohort under surveillance with traditional culture methods was compared with a prospective group dened after the initiation of routine use of Candida mannan detection in BAL uid. In both groups the antifungal treatment with liposomal amphotericin B was started based on positive microbiological (surveillance culture or mannan antigen) results. Data on several predictors of IFI and mortality were collected from both groups. Results: IFI was observed for 12 (32.4%) of 37 infants in the retrospective group, and for 0 (0%) of 29 infants in the prospective BAL mannan group (P = 0.001). Among 14 infants in the retrospective group with surveillance culture positive, 12 (85.7%) developed IFI (P < 0.0001). We observed no statistically signicant difference in mortality rates (13 of 37 infants in the retrospective group vs. four of 29 infants in the BAL mannan group; P = 0.09), in spite of only two deaths (12.5%) among 16 infants with antigen positive results. Conclusions: This study suggests that Candida mannan detection in BAL uid may be useful for earlier identication and more accurate targeting of preterm NICU infants at high risk of IFI.
and T. tonsurans 13.7% and 5.9% respectively- and T. mentagrophytes (1.9%). Conclusion: The toothbrush method appears a reliable painless and more expedient way to obtain positive cultures from children with tinea capitis so treatment and epidemiological surveillance can start earlier to the benet of the patient and his environment.
P142
Malassezia furfur isolation from non-cutaneous clinical samples V. Lopes1, P. Fernandes2 and H. Ramos1 1 Centro Hospitalar do Porto, Porto, Portugal, 2Neonatal and Paediatrics Intensive Care Unit, Porto, Portugal Objective: Malassezia furfur, a skin colonizer is a lipophilic yeast
capable of invading bloodstream and cause systemic disease in association with catheters and parenteral lipid nutrition. The purpose of this study is to report three cases of Malassezia furfur infections in infants born prematurely. Methods: We report three cases of Malassezia furfur isolation in blood samples and catheter tip of infants born prematurely and presenting several complications: two rst infants had serious bronchopulmonary dysplasia and the third one had intestinal disease and was submitted to surgical intervention. They all were low birth weight prematures, had long ICU stay, vascular catheters and were in parenteral lipid nutrition. The blood samples studied were whole blood in EDTA tubes and sediment of centrifuged bloodcultures for the rst two infants. For the third infant only the catheter tip was sampled and we used the roll tip technique. Sabouraud agar overlaid with oil was the culture medium available for isolation and cultivation of Malassezia. Results: The main clue of Malassezia detection was the observation of characteristic budding yeasts in peripheral blood smear in one of the cases. The fungus was then easily isolated from blood in Sabouraud agar overlaid with olive oil after day three of incubation. In the catheter tip case small colonies appeared in blood agar medium at day three. After Gram stain the typical yeasts were observed and then cultivated in Sabouraud with olive oil. In the latter case Malassezia was recovered because of the remains of lipids in the catheter tip. We also used parallel cultures without olive oil in all cases to conrm there was no growth. Only one of the infants with Malassezia isolated from blood was treated with amphotericin B. The two patients with the yeasts in blood died but as far as we know the yeasts were not the direct cause. The third patient is still alive. Conclusions: We concluded that Malassezia furfur infections can be misdiagnosed since the yeast requires special media for growth. Although in our case reports Malassezia, apparently could not be implicated in the morbidity and mortality there are reports of serious infections. It is though important to be aware and to recognise the risk factors that can lead to serious infections and to include the microbiological methods suitable to detect Malassezia in the set up work of the patients at great risk.
P141
Assessment of laboratory methods for the diagnosis of tinea capitis in children in Athens, Greece V. Athassopoulou, H. Papadogeorgakis, G. Katsadiotis, P. Balkoui and E. Koumantakil A. Sygros University Hospital, Athens, Greece Background: Tinea capitis is a common dermatophyte infection of
the scalp of the children. Since clinical diagnosis can be challenging as symptoms can greatly vary, laboratory conrmation is always needed. The traditional method of scraping scale and hairshafts can be a time consuming method and sometimes a cumbersome process. Objective: The objective of this study was to compare and evaluate the classical method of scraping the scalp with scalp massaging by a toothbrush and a cotton swab in order to increase the speed and sensitivity of diagnosis of tinea capitis in symptomatic patients. Children were examined at the Outpatient Department of the Peadiatric Dermatology Clinic of the A.Sygros University Hospital for Skin and Venereal Diseases in Athens, Greece and had a clinical diagnosis of tinea capitis. Methods: In 107 children aged 10 months to 16 years (mean age 7.3 years) we had applied the above mentioned three different ways of collecting material for laboratory investigation. Collection of the samples was done under the Woods light where this was helpful. We had used duplicate series of 2% Sabouraud Glucose Agar supplemented with chloramphenicol and cycloheximide at 2628C. Results: Out of a total of 107 samples, 48 had microscopical ndings suggestive of dermatophyte infection whereas 51 gave positive cultures. All methods revealed the aetiological agent. Cultures obtained by the toothbrush method turned positive signicantly faster with an average of 4.5 days with the swab method coming next average 6.5 days. The classical method became positive later average 10.2 days. The predominant dermatophyte was Microsporum canis (78.4%). Other dermatophytes were the anthropophilic T. violaceum
P151
Cutaneous and pulmonary pheohyphomycosis (spp alternaria infectoria) at a non transplantanted patient M. Androulaki1, E. Andrikos1, A. Tsinta1, A. Saganas1, E. Pappas1, M. Pappas1, V. Baka1 and A. Velegraki2 1 General hospital of Ioannina G. Hatzikosta, Ioannina, Greece, 2 Athens University, Athens, Greece Objectives: We describe the case of systemic alternariosis due to
Alternaria Infectoria spp in a patient with membranous nephropathy. This is the rst case of such an infection reported in Greece. Methods: Forty-eight year male was referred to our clinic with severe nephrotic syndrome and hypertension. Until the time of refer his medical history was free. Percutaneous kidney biopsy revealed
76
membranous nephropathy and immunosupression was started with prednisolone per os at a daily regime of 1 mg Kg-1 BW-1. Two months later and during the period of cortisone tapering, the patient developed multiple reddish-brown nodules in both legs. At the time of the presentation this lesions were painless and the patient had no fever or other symptoms. There was no history of trauma. Skin biopsy was provided as well as culture sample from the nodules. Within the next days our patient developed productive cough without fever or dyspnea. Routine laboratory tests revealed a signicant rise of the erythrocyte sedimentation rate, CRP was above normal levels. During this period of follow-up kidney function was normal and stable. Chest Xray revealed multiple inltrates in both lungs that were absent 2 months previously. CT scan revealed smaller inltrates that were undetectable with the simple Xray. Our patient underwent FNA under CTscan control and bioptic specimen after the direct examination was cultured in sabouraud dextrose agar. Within 10 days fungal growth was obtained in all cultures. Microscopic examination of the colonies revealed multiple darkly pigmented conidia and the fungus was identied as alternaria infectoria. Identication was performed at Athens University Mycology Center. Fluconazole was started at a daily regime of 400 mg during a period of 6 months and prednisolone dose was reduced. Results: Skin and pulmonary lesions regressed and by the time of 12 months patient had a chest X-ray with no sign of inltrates and only skin hyperpigmatation was present at the point of the nodules. Additionally cortisone therapy was stopped due to proteinuria management. It is important to underline that therapy plan did not include surgical remove of the skin lesions. One year after our patient is feeling well he has no signs of recidive. Conclusions: Pheohyphomycosis refers to a subcutaneous and systemic infection caused by dark- walled hyphae in culture and tissue. Pheohyphomycotic agents are culprits for severe infections at immunocompromiced patients, mostly those who have undergone solid organ transplantation. Until today more than 100 different species have been isolated. The most common human pathogen of all is alternaria alternata Spp. Alternaria infectoria has rarely been reported as culprit of severe disease in humans. Correction of the predisposition factors along with antimycotic agents leads to control of the infection and nally successful treatment.
malities, and eradication or reduction of fungal burden recommended by MSG/EORTC. Results: A total of 204 patients with hematological diseases were retrospectively analyzed. For prophylaxic use of intaconazole, the treatment success rate of oral solution was 75.8% (25/33) and that of capsules was 62.8% (27/43). Treatment success rate of intravenous itraconazle for IFI was 50.0% (7/14). No severe adverse effects of grade 3 or 4 were observed. Conclusions: Prophylaxis of fungal infection by itraconazole oral solution and treatment of IFI by intravenous itraconazle are effective for Japanese neutropenic or immunocompromised patients with hematological diseases, even for those who have received stem cell transplantation, intensive chemotherapies or immunosuppressive treatment. Prospective randomized studies are necessary to conrm the utility of itraconazole and to compare the effects of itraconazole with those of other antifungal drugs.
P153
Incidence of fungal infection or colonization in a solid organ transplant recipients I. Netsvyetayeva, E. Swoboda-Kopec, M. Sikora, S. Blachnio, P. Fiedor, L. Paczek, A. Chmura and G. Mlynarczyk Medical University of Warsaw, Warsaw, Poland Objective: Evaluation of fungal infection frequency in patients
undergoing solid organs transplantation and in group of organ donors hospitalized in The Infant Jesus Clinical Hospital in Warsaw in 2008. Material and methods: The group of 147 liver, kidney, simultaneous kidney pancreas transplant recipients as well as 20 organ donors were analyzed. The study included specimens that contained strains isolated from: urine, blood, specimens from respiratory and digestive tracts and swabs from other sites of infection. In the group of organ donors strains were isolated from: respiratory tracts 16 samples, urine seven. The clinical materials from solid organs recipients consisted of: blood six samples, bile three, sputum 12, urine 119, tracheal aspirate ve, swabs from upper respiratory tract 41, peroperative clinical material- 10, specimens from digestive tract 12 and drain swabs seven. The specimens, which were cultured using standard mycological procedures, had been inoculated into Sabouraud medium with antibacterial protection using chloramphenicol and gentamicin (bioMerieux, France). Isolated strains were identied by CHROMAgar medium (Becton Dickinson, USA) and biochemical test ID 32C (bioMerieux, France). Results: From 244 clinical samples 268 yeast-like fungal strains and one mould strain were cultured. The most common isolates were yeastlike fungi of the genus Candida glabrata 104 (38.6%), Candida albicans 101 (37.5%), Candida tropicalis 19 (7%). The total number 25 yeastlike fungal strains were cultured from organ donors, the most often Candida albicans 64%. In the group of solid organs recipients transplant 243 yeast-like strains and one strain of mould of the genus Fusarium spp. were cultured. Among of these the main groups of isolates were: Candida glabrata 104 (42.6%), Candida albicans 85 (34.8%), Candida tropicalis 16 (6.5%) and others 38 (15.5%). The permanent colonization of urinary tract by fungal ora occurred in 12 patients among of recipients group. The invasive fungal infection were developed in 10 patients. Conclusion: (i) Mycological cultures of the clinical specimens most commonly showed strains of Candida glabrata 38,6%, species naturally resistant to uconazole. (ii) The developing of non-albicans fungal infection may be correlated with long term colonization. Acknowledgement: Supported by Polish State Committee for Scientic Research (grant No. N N404 093735).
P152
Itraconazole oral solution and intravenous itraconazole for fungal infections in patients with hematological diseases in Japan S. Hashino, J. Iwasaki, K. Okada, A. Shigematsu, M. Onozawa, T. Kondo and M. Asaka Hokkaido University, Sapporo, Japan Objectives: Itraconazole oral solution and intravenous itraconazole have been available for fungal infection since late 2006 in Japan. However, there have been few clinical studies on the efcacy of those drugs in Japanese neutropenic or immunocompromised patients with hematological diseases. Therefore, we conducted a retrospective survey to determine the usefulness of prophylaxis with itraconazole oral solution and to compare the efcacy of the drug with that of itraconazole capsules, and we also analyzed treatment success with intravenous itraconazole for invasive fungal infection (IFI). Methods: The subjects of the study were patients with hematological diseases who received stem cell transplantation, intensive chemotherapies, or immunosuppressive treatment during the period from September 2006 to February 2009. Both itraconazole oral solution and capsules were administered at a dose of 200 mg once a day for prophylaxis. Intravenous itraconazole administration was started at an initial dose of 200 mg 2 day-1 for 2 days followed by 200 mg day-1 for treatment of IFI. Treatment success of prophylaxis by itraconazole oral solution and capsules was dened as the absence of proven, probable or possible IFI until the end of administration. Treatment success of IFI by intravenous itraconazle was dened as survival within the prespecied period of observation, resolution or improvement of all attributable symptoms and signs of disease and radiological abnor-
77
P154
Screening for galactomannan and anti-Aspergillus antibodies in haematological patients suspected for developing invasive aspergillosis E. Ratkov1, A. Vidovic2, N. Suvajdzic Vukovic2, A. Dzamic1 and V. Arsic Arsenijevic1 1 Institute of Microbiology and Immunology, Belgrade, Serbia, 2 Institute of Hematology, Clinical Center of Serbia, Belgrade, Serbia
Invasive fungal infections (IFI) continue to cause considerable morbidity and mortality in patients with haematological malignancies. Since late 1980s, the epidemiology of IFI has changed with a trend towards a reduction in invasive infections caused by opportunistic yeasts and an increase in invasive mould infections, particularly caused by Aspergillus spp. Invasive aspergillosis (IA) can involve any organ, but most commonly involves sinopulmonary tract reecting inhalation as the principal portal of entry. Survival of patients from such life-threatening disease depends on early diagnosis, but clinical manifestations of IA and standard laboratory methods are often unable to diagnose the infection in its early stages. Therefore, serology tests present a good alternative for early diagnosis of IA. Glactomannan (GM) is a major aspergillus cell-wall constituent released during fungal growth, while antibodies are produced during fungal infection and both of them can be detected in human body uids. Objectives: The aim of this study was to investigate cumulative diagnostic potential of screening for GM and anti-Aspergillus antibodies in adult hematological patients at high risk for developing IA. Methods: From November 2007 through February 2009 serum GM and anti-Aspergillus antibody levels were measured in 150 adult patients with heamatological malignancies hospitalized at Institute of Hematology, Clinical Center of Serbia. Circulating Aspergillus GM was detected using a sandwich ELISA test (Platelia Aspergillus EIA; BioRad, France). The detection of anti-Aspergillus antibody was performed using ELISA test (Serion Elisa classic; Virion/Serion, Germany). Results: A total of 371 serum samples from 150 patients were collected and analyzed for presence of GM and anti-Aspergillus antibodies. Both GM and anti-Aspergillus antibodies were negative in 79/150 (52.66%). GM was found positive in 25.3% (38/150). The GM index in positive serum samples ranged from 0.54 to 9.73 (mean 4.90). 36.8% (14/38) of GM positive patients was died as a result of IA, in the moment of reporting results. In GM positive patients anti-Aspergillus antibodies were detected in 47.37% (18/38). All three classes of antibodies were positive in 2.63% (1/38), both IgA and IgG were positive in 2.63% (1/ 38), IgM and IgG in 13.16% (5/38), IgA in 2.63% (1/38), IgM in 7.89% (3/38) and IgG in 18.42% (7/38). Only anti-Aspergillus antibodies were positive in 33/150 (22%). Conclusion: In almost 1/4 haematological patients GM was positive, and half of GM positive patients also had detectible humoral immune response, while 1/5 of patients has only antibody without GM. Early diagnosis of IA still presents a challenge. Combination of several non-culture assays is necessary for laboratory diagnosis of IA in high risk patients. No single test is sufcient for diagnosis. For better correlation of laboratory ndings with clinical diagnosis further investigations are necessary and will lead to improved outcomes of IA in the future.
related to the low fungus load. Real time PCR has been developed to provide sensitive and objective detection of Pneumocystis from respiratory specimens. Our purpose was to improve the diagnosis of Pneumocytis Pneumonia (PCP) in immunocompromised patients. From January 2005 to Mai 2009, we prospectively investigated respiratory specimens from immunocompromised patients either HIV infected persons or HIV uninfected subjects (haematological malignancies, cancer, patients receiving prolonged corticosteroid therapy or intensive immunotherapy) with clinical or radiological suspicion of PCP. Samples were subjected to microscopic examination rst. Real time PCR was performed when conventional stains were negative. Primers and probes used for Real time PCR assay were targeted on the MSG (Major Surface Glycoprotein) gene of P. jirovecii. Samples were treated with Uracyl DNA Glycosylase to avoid samples contamination with DNA amplicons. Internal positive control has been included to assess PCR inhibition related to the respiratory samples. Positive BAL was used as control material. Negative BAL and water controls were included in each run as contamination controls. Real time PCR assay was used in a qualitative fashion: a sample is positive when an amplication curve is observed whatever the crossing point. To decrease PCR positive results due to colonization or asymptomatic carriage of Pneumocystis, PCR results were interpreted in conjunction with clinical or radiological data to assess signicance for patients. 725 respiratory specimens, negative on conventional stains, have been tested during the study. Diagnostic strategy consisted of Bronchoalveolar lavage uids in 683 specimens, bronchial aspiration in 16 samples, sputum in 15 specimens, induced sputum in 6 samples and pulmonary biopsy in 5 samples. Among the specimens, 145 additional samples, corresponding to 142 patients, were positive on real time PCR assay corresponding to an increase of 20% in the rate of PCP diagnosis. Non HIV immunocompromised patients were predominant (125 patients, 88%)/They suffered from hematologic malignancies (42%); solid tumors (19.7%); solid organ transplants (6.3%)or received immunosuppressants for systemic diseases (16%). 117 (82%) patients were treated with trimethoprim-sulfamethoxazole. In conclusion, Real time PCR assay is a rapid method (less than 3 h including DNA extraction, amplication and interpretation) compatible for routine use in a Parasitology-Mycology laboratory increasing the detection of Pneumocystis jirovecii in respiratory specimens compared to conventional stains. Real time PCR assay is of interest in non-HIV immunocompromised patients who develop Pneumocystis pneumonia with lower fungus rates than AIDS patients.
P156
Effect of Candida tropicalis in planktonic and biolm form on urinary epithelial cells M. Henriques1, M. Negri1, L. M. Lopes1, T. Svidzinski2, J. Azeredo1 and R. Oliveira1 1 University of Minho, Braga, Portugal, 2Universidade Estadual de , , Maringa Maringa Brazil
Candida tropicalis has been reported to be one of the Candida species which is most likely to cause bloodstream and urinary tract infections in hospitals being responsible for a high rate of patients mortality. Adhesion to host surfaces (epithelial cells and medical devices), as well as biolm formation, are considered the rst step to initiate Candida infection. Hence, the colonization of indwelling devices like urinary catheters by C. tropicalis poses a critical problem. Therefore, more knowledge has to be acquired in order to understand and prevent the formation of these biolm infections. Aim: The aim of this study was to investigate the inuence of C. tropicalis growth form (planktonic or biolm) in its adhesion to TCCSUP cells (human urinary bladder). Materials and methods: This study was conducted with one isolate of C. tropicalis obtained from a patient with candiduria admitted to the intensive care unit at the University Hospital in Maringa, Parana, Brazil and C. tropicalis ATCC 750 was also used, as a control. Adhesion assays were performed incubating one silicone cupon with pre-formed C. tropicalis 24 h biolm or 1 ml of C. tropicalis cell suspension (1.0 107 cells ml-1), at 37 C, on a conuent layer of epithelial cells. The extent of adhesion was evaluated after 2 h of incubation using an adaptation of the crystal violet staining method.
P155
Real Time PCR for detection of Pneumocystis jirovecii from respiratory specimens in Immunocompromised patients F. de Monbrison and S. P. Picot Hospices Civils de Lyon, Lyon Cedex 04, France
Pneumocystis jiroveci is an important cause of pneumonia in immunocompromised individuals. This fungus cannot be cultured by routine methods and the diagnosis, based on microscopic examination, requires expertise for accurate identication. Moreover, the sensitivity rate of staining techniques decreases in non-HIV immunocompromised patients
78
Case report: A 79-year-old woman presented with one-month

history of ocular pain in her right eye without loss of visual acuity. Eighteen months prior to presentation she had undergone a bilateral pterygium excision. There was not other remarkable medical history. Ophthalmological examination with slit-lamp biomicroscopy showed a focal necrotic area in the nasal sclera of the right eye, no corneal inltrates were present, no exudates in the anterior chamber were observed. Laboratory studies did not furnish evidence of any underlying autoimmune systemic disorder. Because of the necrotizing scleritis, a scleral patch graft was performed and topical and oral steroids started, but the graft failed within 1 month of surgery and a second scleral patch graft was needed and azathioprine added. However, the second patch graft failed again and a third scleral patch graft was carried out. Cyclophosphamide was added to the immunosuppressive therapy and oral voriconazole administrated for 2 weeks. Three months later, because of the progression of the illness, evisceration of the right eye was performed. Results: Microbiological cultures of the ocular samples collected during the three scleral grafting were negative and histopathological studies reported non-specic chronic inammation and brosis. Pathologic sections of the eviscerated eye showed areas of acute and chronic inammation with focal necrosis. Periodic acid-Schiff and Gomori methenamine silver stains revealed irregularly branched septate hyphae. Cultures of the eye samples revealed after 4 days the growth of numerous white cottony colonies that became brownish gray. Microscopic examination showed septate hyaline hyphae with brown ovoid unicellular conidia growing on a solitary conidiophore cell or laterally on hyphae. The fungus was morphologically identied as Scedosporium apiospermum, but sequence analysis of the ribosomal internal transcriber spacer region ITS1 and ITS2, showed a 99% homology with Pseudallescheria boydii (CBS 101724) and 98.6% with Scedosporium dehoogii (MUCL 20263). Discussion: Because recent molecular data have shown that the apparently single morphological species Pseudallescheria boydii includes eight different phylogenetic species and these species demonstrated different virulence in animals, morphological identication of these funguses will be conrmed by molecular methods, in order to know if the complex has different human virulence or antifungal resistance. The nal characterization of our isolate needed the knowledge of the btubulin gene sequence. The probable nal identication as S. dehoogii reinforces the experimental high virulence demonstrated for this species.
Moreover, cell viability was also assessed, after contact with yeasts, either by trypan blue staining and using 3-(4,5-dimethylthiazol-2-yl)5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) viability assay. Samples were also observed under scanning electron microscopy (SEM). Results: From the results obtained it was possible to verify that, in general, Candida cells adhered to epithelium (Fig 1). Furthermore, the clinical isolate biolm cells adhered in higher extent than planktonic cells. Nevertheless, comparing both strains, it can be highlighted that the reference strain grown planktonically adhered signicantly more (P < 0.05) to epithelial cells than C. tropicalis from candiduria, which was conrmed through ultra structure analysis by SEM (Figure 1). C. tropicalis in biolm form caused higher epithelial cells death than their planktonic counterparts (Figure 2). Moreover, epithelial cells showed less metabolic activity when in contact with biolms. Conclusions: Thus, it is possible to conclude that C. tropicalis were able to cause more epithelial cell death when in biolm form. This highlights the importance of biolm formation, associated to the use of urinary catheters, on C. tropicalis virulence.
P158
Building work in a paediatric haematology/oncology unit: successful strategies to prevent invasive fungal infection in immunocompromised patients during construction of HEPA-ltered cubicles H. Kennedy, B. Gibson, P. Joannidis, B. McCormack and C. Williams Royal Hospital for Sick Children, Glasgow, UK Background: Hospital building work has been identied as a risk
factor for invasive fungal infection (particularly with Aspergillus species) in immunocompromised patients. In the paediatric haematology/oncology ward and bone marrow transplant (BMT) unit of the Royal Hospital for Sick Children, Glasgow, building work to upgrade two existing BMT HEPA-ltered cubicles and construct two new HEPAltered cubicles started in September 2006. However, a lack of suitable alternative accommodation for patients necessitated the continued use of the remainder of the unit, including the four other existing HEPAltered cubicles. Objectives: Implementation and monitoring of protective strategies to safeguard immunocompromised paediatric haematology/oncology patients and prevent the development of invasive fungal infection during a 4-month period of building work. Methods: Prior to the commencement of any work, a pre-emptive strategy was devised by the Infection Control Team. Impermeable barriers constructed of polypropylene board were tted and sealed from
P157
Exogenous Scedosporium endophthalmitis in necrotizing anterior scleritis F. Sanchez-Reus, M. A. Gil Arnal, N. Dominguez Agustin, Y. Gonzalez Atienza, R. M. Mocanu, M. Espanol Sabate and P. Coll Figa Hospital Sant Pau, Barcelona, Spain Objectives: To report a case of exogenous Scedosporium endophthalmitis in a patient with a surgically induced necrotizing anterior scleritis who underwent three scleral patch grafts.
79
oor to ceiling between the work site and remaining ward area. Visquine plastic sheeting was then used to line the polypropylene board on the work side and the work area was maintained under negative air pressure. The building site was only accessible via an external atroofed area of the hospital which was also used for removal of all rubble. Ward cleaning was increased. An antifungal prophylaxis policy to cover the period of building work was implemented and an extensive programme of air sampling for fungi was commenced. Pressure differential readings were monitored and particle counting was performed in the existing, in-use HEPA-ltered cubicles. Particle counts at other sites within the ward and in outside air were also measured. Results: Ninety-one percent of all samples collected in the existing HEPA-ltered cubicles yielded no fungal growth. Mean spore counts (in cfu m-3 of air) of (a) total fungi and (b) Aspergillus spp. in these cubicles were 0.23 and 0.09 respectively, in patient rooms with standard ltration, 3.86 and 1.07, in the ward corridor at the clean side of the work area, 2.84 and 1.16, at the ward site furthest away from the building work (the units main entrance), 4.42 and 1.63 and outside, in the hospital grounds, 14.0 and 4.0. The fungal counts within the unit were acceptable relative to baseline data for this area. Aspergillus versicolor was cultured from the air in 8.1% of total internal samples, Aspergillus fumigatus from 2.3%, Aspergillus ustus from 1.2%, and Aspergillus niger and Aspergillus avus from 0.6%. In contrast, A. fumigatus was cultured from all external air samples and A. versicolor from 20% of these. The mean decrease in particle counts in the existing, occupied HEPA-ltered cubicles relative to outside air was 99.3%. During the period of building and 6-months follow-up period there were no cases of invasive fungal infection. Conclusion: The construction and renovation work within this haematology/oncology unit has provided state-of-the-art accommodation and equipment for the treatment of paediatric patients with cancer and the protective measures and extensive monitoring employed were successful in safeguarding this same patient group from invasive fungal infection.
gangrenosum and T cell lymphoproliferative lesion. The diagnosis of patient was evaluated as combined bacterial and fungal infection plus pyoderma gangrenosum. Thus, the patient was treated with itraconazole, sulbactam/ampicillin, metil prednizolon, topical naftin and fucidic acid. Along with this treatment, the chemotherapy protocol was continued. Conclusion: Although Acremonium spp. are rarely isolated from supercial or subcutaneous skin infections, it was isolated from skin lesion of our patient due to underlying malignancy. Therefore, mycologist should be alert about opportunistic fungal infections, especially hyaline hyphomycetes as in our case and apply an early mycologic investigation.
P160
Epidemiology of oral yeast carriage and candidiasis in patients with haematological malignancies, solid tumors and head neck cancer S. Schelenz1, S. Abdullah1, G. Gray1, H. Stubbings1, I. Gow1, P. Baker1 and P. Hunter2 1 Norfolk and Norwich University Hospital, Norwich, UK, 2UEA, Norwich, UK Objective: The aim of this study was to assess and compare the
incidence of oral yeast carriage and infection amongst cancer patients at a large regional UK cancer center. The epidemiology, independent risk factors, yeast species distribution and anti-fungal susceptibility are being described. Methods: This prospective, observational study was undertaken in 2005 at the Norfolk and Norwich University hospital, UK. Adult patients (age 18) diagnosed with solid tumor, head-neck cancer or haematological malignancy were recruited into the study. Demographic data on age, gender, type of cancer, reason for admission (radiotherapy, chemotherapy, investigations, terminal care), treatment with antibiotics and anti-fungal agents, preceding chemotherapy regimen, radiation, surgery and presence of dentures were recorded on admission. An oral examination was performed and microbial swabs obtained for yeast culture (CHROMager), identication (API 20C AUX) and antifungal susceptibility testing (NCCLS broth microdilution and disc diffusion assay). Full ethical approval was obtained and all patients provided consent prior to entering the study. Results: A total of 400 patients were recruited in to the study. There were 188 (47%) male and 212 (53%) female patients with a mean age of 61 years (range 1890 years). Oral yeast carriage was prevalent in 56.8% (227/400) of all cancer patients and 18.9% (43/227) of those had clinical and microbiological evidence of oral candidiasis. Patients with haematological malignancies had the highest incidence of oral infection (13.5%) followed by head neck cancer (12.3%) and solid tumor patients (9.4%). The presence of white plaques correlated well with clinical signs and symptoms of oral candidiasis (P = 0.05; OR = 14.7; 95% CI = 6.03436). A logistic regression analysis of risk factors for yeast carriage and infection identied age and dentures as independent factors associated with oral yeast carriage whereas gender, previous antibiotics or chemotherapy were statistically not signicant. A total of 269 yeast isolates were recovered from 227 patients. C. albicans was the dominant (74%) species causing colonization and infection with an incidence of 497.5 per 1000 cancer admissions. The remaining 26% of cases were due to non-C. abicans strains consisting of 16 different yeast species. C. glabrata (11.5%) was the commonest non-C. albicans species followed by C. tropicalis (2.6%), C. krusei (2.6%) C. parapsilosis (1.9%), C. cerevisiae (1.5%) and other yeasts (5.7%). The overall resistance to azoles was 28.2% (75/266). Highest resistance was noted for ketoconazole (11.3%), followed by itraconazole (10.9%), uconazole (4.5%) and caspofungin (4.5%) whereas resistance remained low for voriconazole (0.75%), nystatin and amphotericin B (0%, respectively). Conclusion: Patients with haematological malignancies demonstrate a higher prevalence of oral candidiasis compared to other cancer types. C. albicans remains the predominant strain followed by C.
P159
Isolation of Acremonium spp. from subcutaneous skin lesion of a patient with chronic lymphocytic leukemiatext S.E.M.A. Keceli Ozcan, D. Dundar, A. Akturk Sikar and R. Kiran Kocaeli University, Kocaeli, Turkey Objectives: Fungi of the genus Acremonium are environmental
saprophytes and rarely human pathogens. In immunocompetent individuals, Acremonium spp. mainly cause foot mycetoma or corneal infections after inoculation during penetrating injuries. Acremonium spp. are being increasingly recognised as opportunistic pathogens. Here, we report a case of skin lesion of which Acremonium spp. isolated from a patient with chronic lymphocytic leukemia (CLL). Methods: The patient was 76 years old and CLL for 5 years. A wound lesion on distal part of left lower leg was the rst clinical manifestation of the patient. Dermatological exam revealed an edematous, erythematous and inltrated 5 7 cm plaque with irregular borders and central ulcer surrounded by hemorragic crusts. There were no sinus tract or grains. Several swab and skin biopsy cultures were taken with a preliminary diagnosis of fungal skin infection, leukemic inltration or pyoderma gangrenosum. Fungal cultures were performed on Sabourauds dextrose agar (SDA) and incubated at both 37 C and 26 C. Routin bacterial cultures and pathologic examination of the biopsy specimens were also performed. Results: After, one week of incubation, white fungal colonies were observed on SDA. On multiple passages at 26 C, white tufted colonies had formed. On microscopic examination, with lactophenol cotton blue, septate hyphae, conidiogenous cells and needle-shaped phialides decorated with ellipsoidal conidia with rounded edges were seen.This fungus was identied as Acremonium spp.on the basis of its colony morphology and its morphology on microscopic observation of the lactophenol cotton blue preparations. On bacterial cultures, Enterococcus faecalis, E. cloacae Enterococcus faecalis, E. cloacae and Candida albicans were grown. Pathologic invastigation resulted as pyoderma
80
glabrata. The overall anti-fungal drug resistance is low and ucoazole, nystatin or amphotericin B continue to be useful empirical agents.
P161
A rare case of cutaneous hyalohyphomycosis A. Rosmaninho, V. Lopes, G. C. Velho and M. Selores Centro Hospitalar do Porto-HSA, Porto, Portugal
Paecilomyces lilacinus (P. lilacinus) is a ubiquous, saprophytic fungus of environments from decaying vegetation to contaminated medical materials. Although Paecilomyces spp rarely infect humans, they can produce serious infections in immunocompromised hosts and are becoming a prevalent source of infection in such individuals. We report a case of a 63-year-old man that was under immunosupressive treatment because he has been submitted to a renal transplant 1 year before; he presented to our consultation with several painful, violaceous nodules of the left foot with 5 months of evolution. Punch biopsies of the skin lesions revealed a suppurative and granulomatosus process and PAS staining demonstrated budding yeast and septate hypha. In tissue culture grew a lilac-colored cottony colony. Paecilomyces lilacinus was identied as the pathogen agent. Treating P. lilacinus infections is also challenging due to discrepancies between in vitro and in vivo data. At the present time there is no standard treatment for P. lilacinus infections, and can include surgery and/or antifungal therapy. When using antifungal therapy, systemic imidazoles seemed to be the best option. Our patient was succesfuly treated with a long course of itraconazole. To our knowledge, only 16 cases of Paecylomyces infections in solid organ transplant patients have been reported and only 10 cases were due to P. lilacinus.
galactomannan, aspergillus PCR and panfungal PCR were negative. Multiple blood cultures were negative for fungal etiology. The nodule on upper leg was removed surgically. However because of the anatomical localization the second nodule on distal tibia could not be removed by surgery. He is still on oral voriconasole treatment with partial response for noduler lesion on distal tibia. Conclusion: Every skin lesion in immunocompromised patients should be carefully examined for the possibility of infections. A rapidly growing lesion with an area of central necrosis is the typical clinical manifestation of cutaneous Aspergillosis involvement. These skin lesions might occur as the rst clinical manifestation of disseminated disease. Early diagnosis and rapid initiation of systemic effective antifungal treatment for cutaneous aspergillosis is important for successful outcome in immunocompromised patients.
P163
variations in serum galactomannan level in patients with proven and probable aspergillosis U. Nawrot, K. Kalwak, M. Ussowicz, M. Pajaczkowska and A. Chybicka Wroclaw Medical University, Wroclaw, Poland
Galactomannan (GM) is an accepted diagnostic marker of invasive aspergillosis (IA) in immunocompromised patients. The study presents the variations of serum GM index (GMI) during the course of aspergillosis treatment in ve patients classied according to EORTC/MSG criterion to groups with either proven (PvA) (n = 2) or probable aspergillosis (PbA) (n = 3). Patient A, 16-year-old girl with AML developed disseminated microabscesses in the brain during induction chemotherapy. The cerebrospinal uid was positive for GM (0,7), however serum samples remained negative. Pathological ndings in biopsy conrmed aspergillosis, whereas mycological examinations were negative. Patient B (17year-old girl with ALL after HSCT; lesions in lungs and liver), patient C (5 months old boy with SCID after HSCT; lesions in lungs), and patient D (36 -year-old women with ALL and lungs involvement) showed high GMI in the serum, ranging up to four. The values of GMI diminished below 0.5 in patients B and C, which correlated with good clinical response to antifungal therapy (L-AmB/voriconazol treatment in patient B or L-AmB in patient C). Both pts B and C received subsequent secondary therapy with posaconazole. In patient D the serum GMI grew from 0.45, when treatment was started, to 3.2, which was consistent with observed clinical refractoriness to the therapy (L-AmB, voriconazole). Patient E, 3year-old girl with AML, developed multiple pulmonary lesions during reinduction chemotherapy. The samples obtained during thoracoscopic lung biopsy were negative for fungi, however signicant clinical improvement was observed after combined therapy with caspofungin and voriconazole. The progression of pulmonary lesions (bilateral disseminated abscesses and cavitations) was observed when patient underwent hematopoietic stem cell transplantation. High serum GMI (4.41) persisted for 4 weeks of antifungal therapy and subsequently diminished below 0.5. GMI values lower than 0.1 were observed during next 5 months. Despite clinical improvement massive cavity in left lung was observed on CT and surgical resection was performed. Mycological examination revealed biomass of fungal hyphae typical for Aspergillus, but the culture was negative. Both GM testing as well as quantitative PCR from tissue homogenisate were positive for Aspergillus. One month after surgery the serum GMI is still negative, patient is recovering well and remains on posaconazole therapy. Presented cases illustrate that negative results of GM in serum do not preclude aspergillosis, especially if infection is localised out of the respiratory tract. Switching to negative GMI usually corresponds well with clinical outcome, however not always means complete Aspergillus eradication. Comprehensive analysis of risk factors, clinical symptoms and laboratory data remain the only way to diagnose invasive mycoses in immunocompromised patients.
P162
Cutaneous aspergillosis in an acute lymphoblastic leukemia patient after allogeneic hematopoietic stem cell transplantation G. Ozlem tunccan, A. Sahika Zeynep Aki, A. Nalan Akyurek, S. Gulsan Sucak and S. Esin Gazi University Faculty of Medicine, Ankara, Turkey
Infections are one of the major causes of mobidity and mortality after haematopoietic stem cell transplantation (HSCT). Opportunistic infections including Aspergillus species are the major pathogens in HSCT recipients during severe immunosuppression. Despite efffective anti-fungal treatment more than half of the transplant patients with invasive aspergillosis die because of infection. Although lung and sinuses are accepted as the primary portal of aspergillus hyphae, primary cutaneous aspergillosis (PCA) might be a rare form of locally invasive disease in transplant patients under severe immunosuppression. Here we report a case with acute lymphoblastic leukemia (ALL) who underwent allogeneic HSCT and developed PCA during acute graft-vs.-host disease (aGvHD) associated severe immunosuppression. Case: A 26 year- old man with the diagnosis of T cell ALL underwent allogeneic HSCT in second complete remission. He received cyclosporin A and longterm methotrexate as GvHD prophylaxis. He developed acute overall grade II skin GvHD on day +28 after HSCT. Because of corticosteriod refractory skin GvHD he received mesenchymal stem cells on day +94 after HSCT. On day +143, during steroid dose tappering after the resolution of skin GvHD ndings, he developed fever unresponsive to antibacterial treatment and skin lesions including 1 2 cm ecchymotic nonulcerated nodular lesion on the upper third of the left leg and 3 2 cm ecchymosis nonulcerated nodular lesion on the distal third of the right tibia. Histological examination of the biopsy specimen from the nodular lesion on the upper leg showed LPG positive branched aspergillus hyphae in deep dermis and subcutaneous adipose tissue consisting with cutaneous aspergillosis. Infections of sinuses and pulmonary cavities were excluded by paranasal computerised tomography (CT) and high resolution CT of lungs. Molecular analysis for
81
P164
Distinctive ROS function induced by Aspergillus nidulans and Aspergillus fumigatus during in vitro phagocytosis by X-CGD monocytes S.S.V. Henriet, A.J.M.M. Rijs, P. E. Verweij, P.W.M. Hermans and A. Warris Radboud University Nijmegen Medical Center, Nijmegen, The Netherlands Objectives: The underlying mechanisms of the detrimental interaction between Aspergillus nidulans (AN) and children suffering from chronic granulomatous disease (CGD), compared to the more common encountered mould Aspergillus fumigatus (AF) remains unsolved. In order to unravel the development of invasive aspergillosis (IA) in CGD patients and to determine the background of more specic hostimmune reactions, susceptibility to phagocytosis, H2O2, and the inuence on human leucocyte oxidative response were studied. Methods: Clinical AF and AN strains isolated from X-CGD patients suffering IA, were used. Growth-rates and cell-free H2O2-induced damage were determined by a spectrophotometer at 450 nm wavelength for 48 h. Oxidative burst activity, expressed as the relative uorescence intensity (RFI) of dihydrorhodamine related uorescence, was analyzed by FACScalibur. Monocytic differentiation of the myelomonoblastic cell-line PLB-985 and its transgenic analogue gp91phox (X-CGD cell line) was induced by 100 nmol L-1 1,25(OH)2D for 4 days. Granulocytes from unrelated healthy donors were isolated by Ficoll density gradient. Results: Phagocytosis of AN conidia was signicantly lower by healthy and X-CGD monocytes compared to those ingesting conidia of AF (both P < 0.05). Also the efciency of uptake, which indicates the % of internalized conidia from all cell-associated conidia, was found to be signicantly lower for AN compared to AF conidia by healthy and X-CGD cells (both P < 0.01). As phagocytosis is associated with the generation of ROS and activation of signaling pathways, inuence on leucocyte oxidative response was analysed after 30 min stimulation with resting live conidia. A signicantly higher ROS production was measured after AN stimulation compared to AF, both in healthy as in X-CGD monocytes (both P < 0.01). Even more, comparing the RFI of X-CGD monocytes stimulated by either PMA or conidia, a signicant higher ROS production by AN stimulation compared to PMA was seen. In contrast, stimulation by AF conidia was comparable to PMA stimulation. The higher ROS stimulation of AN in monocytes is in line with the oxidative response found in healthy granulocytes: live resting conidia of AN induce a signicant higher oxidative response in healthy granulocytes compared to AF (P < 0.05). Fungicidal capacity of ROS was evaluated and the 103 mol L-1 H2O2-induced damage to swollen AF conidia was found to be signicantly greater than to AN and sustained up to 18 h (P < 0.01). Growth-curves of AN at 10-3 mol L-1 H2O2 were even similar to their negative controls, reecting a complete H2O2-insusceptibility. No differences in growth inhibition was found between resting conidia or hyphae of both species at 10-3 mol L-1 H2O2. Conclusion: Comparing AN and AF at their initial steps towards host-invasion: AN showed to be more resistance to the phagocytic capacities of mononuclear phagocytes compared to AF; Live AN conidia induce a higher oxidative response of the phagocytic cells compared to AF, while swollen AN conidia showed to be completely resistant to direct H2O2-induced damage in a cell-free culture. These results are strengthening the hypothesis that ROS play distinctive roles in the host-defense against AN compared AF.
Microsporidia are opportunistic pathogens, recently categorized as fungus, which cause localised or disseminated disease in immunocompromised patients. Only two cases of invasive Microsporidiosis, all fatal, have been previously reported in HSCTR (Table 1). We present here the rst case of disseminated microsporidiosis in an allogenic HSCTR who survived the infection. Methods: Retrospective analysis of clinical chart and microbiology results. Results: An allo-HSCT was performed in June 2008 to treat Hodgkin Lymphoma in a 49 year-old female patient. The patient presented many infectious complications and received large spectrum antimicrobials. While being persistently neutropenic, and on treatment with teicoplanine, meropenem, gancyclovir, atovaquone and voriconazole, she developed on Day +60 fever, diarrhoea, dyspnoea and confusion, followed by symptoms suggestive of meningeal involvement. A cerebral CT scan was unremarkable. A pulmonary CT scan was non-specic, with interstitial inltrates. A bronchoalveolar lavage (BAL) revealed 90 cells ml-1 with a mononuclear predominance. A lumbar puncture showed no cerebral spinal uid (CSF) pleocytosis. The fungi-uor stain of the BAL (Table 1) showed small intracellular yeast-like structures compatible with Microsporidia. The same microorganism was identied in peripheral blood and stools. Both BAL and CSF were positive for Microsporidia by PCR. The sequencing showed 99% (288/290 bp) homology with Encephalitozoon cuniculli chromosome I. No other pathogen was identied. The disease was successfully treated with oral albendazole and donor lymphocyte infusions. Fumagillin treatment was not considerer after identication of Encephalitozoon cuniculli.
P165
Systemic microsporidiosis in an allogenic haematopoietic stem cell transplant recipient (HSCTR) J. Ambrosioni, K. Bouchuiguir-Wafa, Y. Chalandon, J. Passweg and C. Van Delden University Hospitals of Geneva, Geneva, Switzerland Objectives: Invasive fungal infections are a substantial source of
morbidity and mortality among immunocompromised patients.
Conclusion: Microsporidiosis is a rare complication in HSCTR, with non-specic presentation, difcult diagnosis and management. Fungal stains such as fungi-uor are useful for early diagnosis but species identication requires molecular biology techniques. Albendazole is an active drug against Encephalitozoon genera while fumagillin is also active against Enterocytozoon, but extremely myelotoxic. Prognosis is poor. This is the rst reported case of disseminated microsporidiosis with meningeal involvement, successfully treated in a HSCTR.
82
P166
Efcacy outcomes in a randomized trial of liposomal amphotericin B (L-AMB) based on Revised EORTC/MSG 2008 denitions of invasive fungal disease (IFD) O.A. Cornely1, J. Maertens2, M. Bresnik3, R. Ebrahimi3, E. Dellow3, R. Herbrecht4 and P. J. Donnelly5 1 University Hospital of Cologne, Cologne, Germany, 2University Hospital Gasthuisberg, Leuven, Belgium, 3Gilead Sciences, Foster City, CA, USA, 4University Hospital of Strasbourg, Strasbourg, France, 5University Medical Center St Radboud, Nijmegen, The Netherlands Background: In 2008 EORTC/MSG published revised consensus denitions for diagnosis (Dx) of IFD with standardized inclusion criteria for clinical trials. A prospective trial of L-AMB in invasive mold infections (AmBiLoad) used modied EORTC/MSG 2002 criteria. We reevaluated response and survival based on the 2008 revision. Methods: Patients with allogeneic HSCT or absolute neutrophil count <500 ll-1 within 14 days of study entry with other hematological conditions were recruited on the basis of halo or air crescent sign on chest CT. Cases were originally classied as probable IFD and were redened as possible IFD using EORTC/MSG 2008 criteria. Patients received L-AMB 3 mg kg-1 day-1 (3 mg) or 10 mg kg-1 day-1 (10 mg) for 14 day, followed by 3 mg kg-1 day-1 for all patients. Favorable response at EOT, and 12 week survival results from the trial were reclassied according to 2008 denitions. Results: 201 patients had IFD according to the trial denition of whom 118 (59%) had Dx based on chest CT halo signs and host factors only: 3 mg: 62 (9 allo-HSCT, 60 neutropenia; 7 both), 10 mg: 56 (12 allo-HSCT, 50 neutropenia; 6 both).
experienced pain in her left eye and visited the eye clinic. She presented with a red left eye, a decreased visual acuity of Hand Movements or 1/300, and high intraocular pressure (30 mmHg). In addition, a hypopyon and brin was seen in the anterior chamber. Fundus examination was impossible due to a dense vitreous haze. There were no signs or symptoms of keratitis or systemic inammation. An intravitreal biopsy was performed and Gram staining showed leukocytosis without bacteria. Treatment according to the endophthalmitis protocol was started with intravitreal, local and intravenous vancomycin and ceftazidime. Five days after the puncture Fusarium spp. was cultured and treatment was changed in local amphotericin B and intravenous voriconazole, a loading dose of 400 mg twice a day, followed by 300 mg twice daily. In addition, a complete pars plana vitrectomy with lense extraction was performed, in an attempt to evacuate as much pus as possible. The retina already showed severe ischemia, with necrosis and vessel occlusions. Amphotericin B was left intravitreally. Unfortunately, we were not able to perform a species differentiation, but the antifungal susceptibility test showed MIC voriconazole 4 mg L-1, amphotericine B 2 mg L-1, posaconazole 2 mg L-1, caspofungin 16 mg L-1. Therefore, we decided to treat her with local administration of amphotericine B and systemic voriconazole for 3 months. Despite this long term treatment, the vision of her left eye showed no improvement. This is the rst report of Fusarium endophthalmitis associated with intravitreally administered bevacizumab and prednisolone. Fusarium endophthalmitis may occur in immunocompetent individuals after ocular surgery, such as cataract extraction, or as a complication of advanced keratitis. In severely immunocompromised patients haematogenous spread may result in disseminated fusariosis. In our case, Fusarium endophthalmitis developed in a locally immunocompromised eye, after intravitreal injection of bevacizumab and prednisolone. Bevacizumab, a recombinant humanized monoclonal IgG1 antibody, binds to and inhibits the biologic activity of vascular endothelial growth factor. This leads to less inammation and improvement of vision by inhibition of new vessel formation and reduction of macular edema. However, suppression of the local inammatory response by bevacizumab and prednisolone may also result in a diminished response to infection. This local immunocompromised state facilitated a full-blown endophthalmitis. The treatment of Fusarium endophthalmitis is difcult: the penetration of iv amphotericin B formulations in the vitreous is lacking. Besides, many Fusarium isolates are voriconazole resistant, although breakpoints for lamentous fungi have not been established. Combination of pars plana vitrectomy and therapy of local amphotericin B and systemic voriconazole could not improve her vision.
Conclusions: With early initiation of L-AMB in patients with

possible IFD (chest CT halo signs + host factors) based on EORTC/ MSG 2008 criteria a higher proportion had improved response and survival compared to those with probable/proven IFD. These data suggest L-AMB is suitable for pre-emptive treatment of suspected mold infections in high-risk patients.
P168
Recurrent Paecilomyces lilacinus endocarditis in an intravenous drug user. Case report and review J. Ambrosioni, K. Bouchuiguir-Wafa, I. Uckay and J. Garbino University Hospitals of Geneva, Geneva, Switzerland Objective: Fungal intravascular infections are a well recognized,
P167
Fusarium endophthalmitis after intravitreal bevacuzimab injection A.M.L. Oude Lashof, F. H. Van Tiel and E. C. La Heij Maastricht University Medical Center, Maastricht, The Netherlands
A 75 year old woman with a history of diabetes and diabetic retinopathy was seen at the outpatient eye clinic for worsening of her age-related macular degeneration. She was treated with intravitreal administration of bevacizumab (1.25 mg) and prednisolone (5 mg). The rst injection in her left eye was without any complications, therefore a second injection in this eye was performed 1 month later. Unfortunately, 5 days after this second injection, she
although rare, complication in intravenous drug users (IDUs). Paecilomyces lilacinus is a little-known mold that causes rare cases of invasive infections in humans regardless of their immune status. It shows low susceptibility to conventional antifungal drugs in vitro, and variable susceptibility to novel triazoles. Since 1963, seven cases of endocarditis due to Paecilomyces spp. were published in the medical literature and only one due to Paecilomyces lilacinus. The aim of this study was to describe the case of a recurrent endocarditis due to Paecilomyces lilacinus in an IDU patient and to discuss diagnosis and treatment. Methods: Description of the patient case and microbiology results. Results: In November 2007 a 41 years old male patient was admitted to our institution for acute abdominal pain followed by intense pain in the right leg. Medical history was positive for active intravenous drug abuse and hepatitis C virus infection. The patient
83
referred fatigue since 1 month and weight loss, but no fever or chills. The angiography showed bilateral thigh arterial insufciency compatible with bilateral septic emboli, more severe at the right side. A cardiac ultrasound showed a bicuspid aortic valve with images compatible with vegetations. Empiric treatment was started with ceftrixone and gentamycin, and a cardiac valvular replacement with a mechanical prosthesis was performed. Bacterial cultures were negative, but a fungal growth was noted in the valve abscess and in an embolic cutaneous lesion. The fungus was identied by PCR and sequenciation as Paecilomyces lilacinus. Antibiotic treatment was stopped and liposomal amphotericin B plus oral voriconazole were started. Clinical evolution was favourable. Sensitivity tests showed that Paecilomyces lilacinus was resistant to Amphotericin B, uconazole, itraconazole, ucytosine and caspofungin and only sensitive to voriconazole and posaconazole. Oral voriconazole monotherapy was continued with good clinical evolution. Patient was discharged on voriconazole treatment and follow up was lost. Two years later, the patient was readmitted in February 2009 with acute paraparesis of unknown origin and during the hospitalisation he developed a stroke followed by cardiac arrest. Cardiopulmonary resuscitation was unsuccessful and the patient died. The autopsy ndings showed a recurrent fungal disease in the heart with a paravalvular abscess and cerebral emboli. Cardiac tissues and blood cultures were positive for Paecilomyces lilacinus. Figure 1 shows Paecilomyces plate growth from blood. Figure 2 shows fungi-uor stain from the sample of the recurrent cardiac abscess.
Conclusion: Endocarditis due to Paecilomyces lilacinus is an extremely rare disease, but it must be considered active IDUs. Combination therapy must be considered while awaiting the sensitivity tests due to the low susceptibility to conventional antifungal drugs. Voriconazole is reported as the most active drug in vitro. Concomitant surgery is very important for diagnosis and for outcome improvement in case of valvular involvement. Long antifungal treatment must be considered but treatment duration is not established.
P169
Fungal infection in a neutropenic patient caused by Alternaria alternata R.G. Vitale, J. Afeltra, M. Lluesma Gonalons, G. Rigada, K. Andrade, F. Figueroa, M. Inmutabile, C. Carbia, A. Miroli, V. Ybarra and R. G. Vitale Ramos Mejia Hospital, Buenos Aires, Caba, Argentina Case report: Male patient 25 year old with a diagnostic of acute
lymphoblastic leukemia. He receives treatment for his disease within an induction of chemotherapy and consolidation treatment with protocol GATLA during 2007. In 2008 he was hospitalized to receive phase I Hyper-CVAD treatment because hematologic relapse. The patient develops fever and neutropenia, and piperazilin tazobactam was initiated empirically. He develops muget and yeast form was visualized in the direct microscopy examination from oral sample and C. albicans was isolated. Treatment with uconazole was initiated, 200 mg day during 10 days with successful outcome. The patient had a total white cells of 600 mm3, and 10 days later he develops nasal pain, with ulceration. Biopsy was taken. In the direct examination hyaline septate hyphae was observed, thus, aspergilosis was suspected and voriconazole treatment was started. Galactomanan antigen test was performed and being negative. CT scan showed ulceration of the nasal septum without compromise of the lung. A black fungi was cultured after 7 days identied as Alternaria alternata. The treatment was switch to itraconazole at doses to 600 mg day-1 for 3 days and 400 mg day-1 after. After 1 month, the patient recovers neutrophyl count and lesion in the nose disappears and CT scan revealed no lesions. He continues the treatment for 4 months without relapses up date. Conclusion: Leukemic patients are a population of high risk to develop fungal infections. This is and interesting case, since in the direct biopsy material hyaline hyphae was observed but the isolation was a black fungi, being important to identied the aetiologic agent, since treatment might be different. It is described that these fungi especially in biopsy, can be seen as hyaline, then miss diagnoses is possible and culture can be wrong interpretive as contaminant.
Figure 1.
P170
A fatal microascus cinereus (anamorph scopulariopsis) brain abscess in an allogeneic bone marrow transplant recipient K. Bouchuiguir-wafa, B. Mohty, J. Ambrosioni, C. Van Delden and Y. Chalandon University Hospitals of Geneva, Geneva, Switzerland Objectives: The ascomycetous mold Microascus cinereus is an uncommon human pathogen. We report the second case of brain abscess due to M. cinereus in an allogeneic bone marrow transplant recipient, and discuss the mycological ndings. Methods: Retrospective analysis of clinical chart and microbiology results. Results: A 34-year-old allogeneic bone marrow transplant (allo-BMT) recipient for Hodgkin lymhoma was admitted 4 years post-transplant with right lateral homonym hemianopsia. At the time of this complication, he was treated with tacrolimus, glucocorticosteroids and mycophenolate for severe graft-vs.-host disease (GVHD), as well as ciprooxacine, metronidazole and voriconazole. A magnetic resonance imaging scan (MRI) of the brainrevealeda1,5-by2-cmenhancedlesionintheposteriorpartoftheleft
Figure 2.
84
internal capsula lobe. Liposomal amphotericin B was added to voriconazole, and a stereotactic brain biopsy performed. Initial bacterial and fungal cultures were negative. Two weeks later, he developed a complete right sensitivo-motricerighthemiplegia.AsecondMRIshowednochangeinthe size of the lesion. The patient underwent a second steretoactic-guided aspiration of the abscess cavity. Direct smear of this brain biopsy prepared with Fungi-Fluor showed septate hyphae and oblong cells in short chain (Figure 1). Biopsy material was inoculated onto potato dextrose, sabourauds dextrose, and brain heart infusion agar. Initially the colonies were pale, but developed a grey-olive color over time (Figure 2). Microscopic examination of potato dextrose agar slide cultures revealed catenulate, dematiaceous annelloconidia (conidia formed from annellides and occurring in chains), measuring 4 to 5.5 by 2.5 to 3 lm and arising from either single or penicillate ask-shaped conidiophores attached to dematiaceous, septate hyphae (Figure 3). These features were consistent with a dematiaceous Scopulariopsis species. After 2 weeks of incubation, small black fruiting structures were seen. Microscopic examination of these structures revealed globose perithecia (100 by 350 lm) with a short neck (Figure 4). Partial sequencing of the large ribosomal subunit 28S identied the mold as Microascus cinereus, in accordance with the morphological results. The patient was treated with liposomal amphotericine B and posaconazole, but died within a few days.
Figure 3.
Figure 1. Figure 4.
Conclusion: We describe the second case of brain abscess caused by M. cinereus after allo-BMT. Predisposing factors for infection with this organism included severe immunosuppression, GVHD, and exposure to broad-spectrum antibiotics. The isolation of this organism from brain abscess tissue extends the list of known neurotropic dematiaceous organisms capable of causing cerebral phaeohyphomycosis.
P171
Antifungal drug susceptibility of Aspergillus spp. strains isolated from cystic brosis patients and immune responses against them M. Simitsopoulou, E. Hatziagorou, E. Georgiadou, J. N. Tsanakas and E. Roilides Aristotle University of Thessaloniki, Thessaloniki, Greece
Figure 2.
Objectives: Aspergillus species can be isolated from respiratory

secretions of cystic brosis (CF) patients. Phagocytes play a major role in the innate host immune response against Aspergillus by responding to and destroying the fungi locally. In this study we have analyzed A. fumigatus and Aspergillus avus isolates from sputa of patients with CF in order to identify differences in drug susceptibilities and induced immune effector cell responses.
85
Methods: Identication of A. fumigatus or A. avus was performed by

colony morphology and microscopic examination. Minimum inhibitory concentrations (MICs) for three azoles (itraconazole, voriconazole and posaconazole) and deoxycholate amphotericin B as well as minimum effective concentrations (MECs) for two echinocandins (caspofungin and anidulafungin) were determined by broth microdilution method (CLSI). Superoxide anion production and antihyphal activity of neutrophils (PMNs) and/or monocytes (MNCs) were assessed spectrophotometrically by superoxide anion release assay and XTT reduction assay. For the conidiocidal activity, 2 105 conidia were mixed with 4 105 MNCs for 4 h at 37 C and colony-forming units were counted. For the superoxide anion assay, 105 conidia were incubated for 12 h at 37 C. Resulting hyphae were opsonized with 50% human serum and incubated with 105 PMNs and 75 lmol L-1 cytochrome-C for 1 h at 37 C, 5%CO2. The superoxide anion produced by PMNs was then quantitated. For the XTT assay, 104< conidia were incubated for 12 h at 37 C. Phagocytes were added to hyphae at 20:1 effector-to-target (E:T) ratio and incubated for 1 h at 37 C, 5%CO2. Phagocytes were lysed and 0.25 mg ml-1 XTT containing 40 lg ml-1 coenzyme-Q0 were added to the plates. Following 30 min incubation at 37 C, percent hyphal damage was evaluated. Results: Six isolates of A. fumigatus and two isolates of A. avus isolates from sputa of eight patients with CF were studied. All isolates exhibited similar MICs/MECs for the antifungal agents tested compared to control strain, except for one isolate of A. fumigatus that showed relatively higher MEC value for anidulafungin (1 lg ml-1) than control strain (0.004 lg ml-1). Except for two strains, PMNs exhibited hyphal activity against the fungal targets (2455%) that was higher than that of MNCs (hyphal damage 1629%). High amounts of superoxide anion were released from PMNs (approximately 6nMO-2/105 PMN/h) when challenged with each isolate. Both strains of A. avus were very susceptible to the conidiocidal activity of MNCs; the intracellular killing reached 66% and 75%, respectively. Except for three A. fumigatus strains, percent intracellular killing ranged from 51% to 66% compared to control (13%). Conclusion: These preliminary data show that while there are generally no major differences in the susceptibility of Aspergillus isolates from CF patients to antifungal agents, there are considerable variations in their susceptibility to innate host immune responses.
Aspergillus spp. Product of primary PCR amplication was used as a template in the second reaction. A separate set of primers was used. Products of the PCR reaction were visualized during elecrophoresis in ethidium bromide stained 2% agarose gel. All diagnostic techniques were performed simultaneously with clinical observations. Results: Of the 47 patients included in the study Aspergillus was grown on the Sabouraud agar plates only in three cases. Galactomannan was detected in two serum and 1 BAL sample (6.3%). DNA, however, was detected in eight serum and 13 BAL samples (38.3%). Number of patients that were able to undergo biopsy was four. There were three patients representing proven Invasive Aspergillosis. Conclusion: (i) Serological and molecular tests might be useful in the early diagnosis of Invasive Aspergillosis, especially when the culture of pathogen is hard to receive and there are contraindications to perform biopsy or taking BAL sample. (ii) Examinations of biological markers of Aspergillus infection demonstrate diagnostic value only when performed parallel and dynamically. (iii) In patients with hematological malignancies testing of galactomannan levels in serum may give false negative results while full symptomatic Aspergillosis. (iv) Detection of fungal DNA cannot be used as a routine laboratory tool for diagnosing fungal infections. However in immunocompromised patients with hematological malignancies may serve as a supplementary method in comparison with other accessible microbiological methods: culture, microscopy and serology. (v) In order to set proper diagnosis of Invasive Aspergillosis there is a need in simultaneous cooperation between team of clinicians, radiologists, microbiologists, histopatologists.
P173
Blastoschizomyces capitatus caspofungin-resistant: disseminated infection in a patient with acute myeloid leukaemia J. Alcoba-Florez, I. Gutierrez, I. Hernandez, R. Sanchez and J. Ode University Hospital Ntra. Sra. de Candelaria, Santa Cruz De Tenerife, Spain Introduction and objective: Among opportunistic pathogenic yeast, Blastoschizomyces capitatus is an uncommon species. It produces serious systemic infections in immunocompromised patients, especially in those who suffer haematological malignancies. The aim of this study is to describe a case of systemic infection caused by B. capitatus resistant to caspofungin in a patient with acute myeloid leukaemia (AML). Materials and methods: We present a case of a female patient diagnosed with AML, on chemotherapy with cytostatics, who develops a disseminated fungal infection with hepatic and splenic affection that required splenectomy because of a splenic abscess. Blood cultures were obtained and processed with the BACT-ALERT system (bioMerieux, S.A.). Malt extract agar (Beckton Dickinson) was employed for the morphological characterization and API-ID 32C (bioMerieux, S.A.) for its identication. Sensitivity testing against eight antifungal agents was performed by broth microdilution, following CLSI (M272A) and Sensititre-Yeast-One (Trek Diagnostic System S.L.) indications. Results: Creamy yeast-like colonies were isolated from blood cultures, and mycelium, arthroconidia and blastoconidia were observed, leading to the identication as Geotrichum capitatum (currently B. capitatus). Sensitivity test revealed this isolate to be susceptible-dose-dependent (SDD) to uconazole (MIC 32) and resistant to caspofungin (MIC 16). MIC for the rest of the antifungal agents were as follows: 0.125 posaconazole, 0.5 amphotericin B, 0.5 ketoconazole, 0.125 itraconazole, 0.125 voriconazole and 32 for 5-ucitosin. Treatment with caspofungin was started. Owing to the microbiological results observed, treatment was changed to amphotericin B and it was maintained with voriconazole. Conclusions: (i) As is true for many other opportunistic fungi, the number of infections due to B. capitatus has increased considerably in the last few decades, especially among patients surffering from haematological malignancies and neutropenia. (ii) Sensitivity tests conrm that uconazole does not have good activity against B. capitatus, and that caspofungin do not have any activity al all. (iii) The best treatment for B. capitatus infections is not well established yet, but
P172
Aspergillus spp. DNA and galactomannan testing in BAL and serum of immunocompromised patients D.D. Dzierzanowska1, E. R. Romanowska1, P. N. Nadkowska1, R. K. Krenke2, E.M.G. Grabczak2, T. D. Dzieciatkowski2, M.P. Przybylski2 and A.K.L. Kolkowska-Lesniak3 1 The Childrens Memorial Health Institute, Warsaw, Poland, 2 Medical University, Warsaw, Poland, 3Institute of Haematology and Transfusion Medicine, Warsaw, Poland Objectives: The study was designed to demonstrate the prevalence
of Invasive Aspergillosis in a group of 47 immunocompromised patients with haematological diseases (mainly malignancies) and claimed signs of pulmonary infection. The control group consisted of 24 immunocompetent patients who underwent beroptic bronchoscopy. We sought to evaluate the optimal method of detecting the infection. Fiberoptic bronchoscopy and BAL were performed to search for potential pathogens involved in the pulmonary infection. Methods: In both groups of patients BAL was performed through exible, beroptic bronchoscope. The bronchoscope was inserted in the specic lung region. Sterile 0.9% saline was instilled and then withdrawn by a gentle suction. BALF was collected in a tube and immediately transferred to the laboratory. Samples were cultured on Sabouraud Dextrose Agar plates. Forceps biopsy was performed after the BAL procedure. Galactomannan levels were determined both in serum and BAL by PLATELIA Aspergillus EIA Galactomannan test (BioRad) according to manufacturers description. The cut-off level for BAL and serum was 0.5. Aspergillus DNA was isolated from BAL and serum using DNA Mini Kit (Qiagen, Syngen Biotech). Next DNA was amplied using nested PCR technique with primers specic to 18S rRNA of
86
recent studies agree with this work about the role that new azoles (voriconazole, posaconazole) may play in this type of infection.
P174
Mannose binding lectin deciency does not increase usage of antifungals during febrile neutropenia in children a prospective single institution study P. Mudry1, M. K. Kyr1, J. J. Jarkovsky2, J. S. Sterba1 and J.Ch. Chumchalova2 1 University Childrens Hospital Brno and Masaryk University Brno, Brno, Czech, 2University Hospital Brno, Brno, Czech Objectives: Mannose binding lectin (MBL) is a plasma collectin, a
substantial part of innate immunity. MBL immunodeciency is dened as such combination of haplotypes of MBL-2 gene which encodes a low or intermediate plasma MBL level compared to high MBL level encoding haplotypes. Association of low level MBL (LLMBL) with longer duration of febrile neutropenia (FN) contrary to high level MBL (HLMBL) has been described. We analysed prescription of antifungals and incidence of invasive infections during FN in children with a malignancy and correlated them with LLMBL or HLMBL genotype. Methods: Prospective analysis of MBL-2 gene had been done during study period. Total of 47 patients were included and 152 episodes of FN were analysed. MBL genotype was assessed by SSP-PCR method. Patients were included into the study when they had undergone at least one episode of FN. Results: Diagnoses were solid tumors and leukemias, median age at diagnosis was 6.7 years, male to female ratio was 30:17. Total of 22 and 25 patients with LLMBL and HLMBL respectively were assessed. They underwent 87 and 65 episodes of FN, respectively. To avoid diagnosis bias we analysed separately patients with acute lymphoblastic leukemia (ALL) and other diagnoses (OD). In ALL group, antifungals were given during 50% and 51.5% of FN in LLMBL and HLMBL patients, respectively, P = 1.0. In OD group, antifungals were given during 67.7% and 63% of FN in LLMBL and HLMBL patients, respectively, P = 0.814. Invasive fungal infections were observed in two cases, both were candidemia in OD group in patients with HLMBL genotype. Conclusions: Our results do not support hypothesis that LLMBL genotype is associated with higher frequency of antifungal treatment during febrile neutropenia in children. LLMBL genotype possessing patients are not at higher risk of invasive fungal infection.
developed extensively destructive necrotizing local invasion and died from septic shock on the 13th day of his hospitalization. 2nd case: Zygomycosis from Mucor hiemalis, after trauma. A 20 year-old patient,was admitted to ICU due to severe trauma after a car accident,with spleen,left kidney, urinary-bladder rapture and multiple fractures. She underwent splenectomy,removal of the left kidney,rehabilitation of the urinary-bladder and fracture reconstruction. Five days after the accident, she developed a rapidly progressive necrotizing lesion at the left limp. After receiving two specimens for culture, antimycotic therapy (Liposomal Amphotericin B 600mg 1 i.v. and Posaconazole 400 mg 2 p.o) was initiated. Because of the extensively necrotizing local invasion, the patient underwent a limp amputation. She continued receiving Amphotericin B for 15 days after the amputation, while Posaconazole was administered for 6 weeks totaly. Her clinical condition was stabilized. Due to combined surgical and antimycotic therapy, the patient survived. Laboratory diagnosis was based on direct microscopy, histopathologic examination and culture. Exudates and necrotic tissues from the two patients were sent to the laboratory. On direct microscopy wide,coenocytic,hyaline hyphae were present. Conventional culture revealed mixed bacterial ora. Minimally manipulated tissue samples were cultured in Sabouraud dextrose agar with chloramphenicol at 25, 30 and 370C. Woolly, rapidly growing, zygomycotic colonies appeared in 24 h and covered the entire Petri dish in 48 h. The strain of the rst case didnt sporulate in malt extract and potato dextrose agars,so the isolate was cultured in Czapeks agar, 1% water agar and in saline agar at 25, 30 and 370C but remained sterile for over 2 months. Both strains were sent to the Microbiology Department of the Medical School of Athens, where ITF-based sequencing was performed and 99% homology was conrmed with those published for Saksenaea vasiformis (CBS 122520, GenBank Accession No Fj433876, rst isolation in Greece), and Mucor hiemalis sequences, respectively. In both cases diagnosis was conrmed by the histopathologic examination. Conclusions: (i) Zygomycosis is rare, usually appearing in a sporadic form. (ii) In patients with predisposing factors, for favorable prognosis, the relevance of a strong clinical suspicion, early laboratory diagnosis and rapid initiation of antimycotic therapy can prevent the fatal outcome. (iii) Saksenaea vasiformis is an emerging human pathogen, often associated with trauma. Laboratory identication may be difcult or delayed because of the moulds failure.
P176
Fatal Saccharomyces fungemia with septic shock complicating S. boulardii prophylactic therapy in a burn patient P. Giannopoulou1, N. Charalambaki1, H. Stefanatou1, A. Velegraki2, F. Tsidemiadou1 and E. Trikka-Graphakos1 1 Thriassio General Hospital, Athens, Greece, 2University of Athens, Athens, Greece
The yeast S. boulardii (strain of S. cerevisiae)has been used as a probiotic for the prevention and treatment of antibiotic and enteral feedingassociated diarrhea. Although commercially available strains are regarded as safe,there are many reports implicating S. cerevisiae as a cause of invasive infection in immunosuppressed patients. We report a fatal case of Saccharomyces fungemia with septic shock in a burn patient,receiving S. boulardii prophylactic therapy. A 34 year-old woman was transferred suffering from extensive thermal burns covered 60% of her TBSA and she received probiotic therapy S. boulardii (100 mg 3/24 h) while she was on antibiotics. Two weeks after the last surgical debridment,she became febrile(39 C),progressively deteriorated, with septic shock,multiple organ failure and Amphotericin B was added. On direct microscopy of the positive blood culture, yeast cells were observed,and slightly cream,smooth,uniform at colonies were isolated from sabouraud dextrose agar, after 48 h at 30 C. The isolate was puried by streaking in CHROMagar Candida(CHROMagar) and identied as S. cerevisiae by the API32C (BioMerieux). Then it was checked for growth at 370C and ascospore
P175
Cutaneous zygomycosis in a general hospital in Greece P. Giannopoulou1, N Charalambaki1, A. Kyratsa1, A. Velegraki2, F. Klouva-Molyvda3 and E. Trikka-Graphakos1 1 Thriassio General Hospital, Athens, Greece, 2University of Athens, Athens, Greece, 3Intencive Care Unit,Thriassio General Hospital, Athens, Greece Introduction: Zygomycosis is an uncommon fungal infection
which usually occurs in immunocompromised (mainly diabetes mellitus, haematologic malignancy, transplantation) and rarely in immunocompetent hosts, usually after trauma. We report two cases of cutaneous zygomycosis in our hospital, in a 2 year period. 1st case: Fatal zygomycosis from Saksenaea vasiformis in a young patient, after a car accident A 30-year old patient was admitted to our hospital due to mild cranial contusion. Three days after the accident at the left posterior thoracic and lumbar region a rapidly progressive necrotising lesion appeared. The patient was febrile(390C), while was heamodynamical stable. He underwent extensively surgical debridment and two specimens were taken for culture. Despite the combination of the aggressive surgical debridement of the infected tissues and the systemic treatment with Liposomal Amphotericin B (750 mg/24 h i.v.) and Posaconasole (400 mg 2 p.o), the patient
87
production on McClary acetate agar for 8 weeks. Fungal DNA from the clinical isolate and from S. boulardii grown from Ultralevure capsules was extracted and the whole Internal Transcribed Spacer region was amplied by PCR. The amplication products were sequenced (Macrogen,Korea)the sequences were aligned(BIOEDIT www.mbio.ncsuedu) and were compared to published fungal sequences (BLAST www.ncbi.nlm.nih.gov). For comparison reasons,all S. boulardii (n = 9)and S. cerevisiae (n = 158)sequences publicly available in GenBank, as well as representatives of close relatives S. bayanus (n = 1) and S. paradoxus (n = 1) were used. In vitro susceptibility to antifungal agents was performed by E-test(AB Biodisk,Sweden) The therapeutic use of probiotics should be carefully considered regarding the risk-benet potential. Saccharomyces organisms should be added to the growing list of emerging fungal pathogens and special caution should be taken regarding their use in the immunocompromised critically ill patients,including burn patients.
P178
False-positive Aspergillus real-time PCR assay due to nutritional supplement in an allo-BMT recipient with GVH disease L. Millon, F. Grenouillet, J. Crouzet, F. Larosa, S. Loewert, A. P. Bellanger, E. Deconinck and F. Legrand CHU Jean Minjoz, Besancon, France Objectives: Screening for circulating DNA by PCR has shown potential in the denitive diagnosis of invasive aspergillosis, especially in combination with antigen testing. Occurrence of false-positives of Aspergillus real-time PCR has been described in several reports, but source of fungal DNA contamination remain unclear. We report here a case of false-positive of both galactomannan antigenemia and Aspergillus PCR due to nutritional supplement in a bone marrow transplant recipient. Case report: A 42 years old man received an allogenic hematopoietic stem cell transplantation acute myeloid leukemia on June 2006 (day 0, D0). At D15, he presented a stade three (grade II) cutaneous acute graft-vs.-host disease (GVHD) and later developed a chronic GVHD after D150, treated with a combination of corticosteroid and tacrolimus. He developed severe diarrhea and denutrition. Since D178, he received a parenteral nutrition associated with an oral hypercaloric supplementation : Scandishake Mix (Nutricia), one or two bags per day. At day 190, the patient was admitted for pulmonary syndrome with productive cough and moderate dyspnea without fever. Serum was tested for galactomannan (GM) antigenemia (Platelia Aspergillus; Biorad, Marnes-la-Coquette, France), using threshold of 0.5. Real-time PCR targeting to Aspergillus mitochondrial DNA was performed with 44 cycles as positive threshold. PCR and GM positive results were obtained from serum samples, at D190 and D192. Disseminated aspergillosis with digestive origin was suspected, and nutritional supplement was stopped. A probabilistic antifungal treatment (voriconazole-caspofungin combination) was immediately started. Thoracic CT-scan revealed unilateral lung consolidation with pleural effusion, with Pseudomonas aeruginosa isolation from sputum. Anti-Pseudomonas antibiotic therapy was rapidly implemented. GM detection on serum became negative at D195, whereas PCR became negative at D201. Clinical improvement was progressively observed, voriconazole was stopped due to adverse events (D195) and antifungals were replaced by itraconazole monotherapy at D204. A Scandishake Mix bag from the batch taken by the patient were tested for GM detection and real-time PCR. Both assays were positive until dilution of 1/1000. Two other batches obtained from the manufacturer gave similar results. Fungal cultures of all batches were negative. DNA extracted from two sera (D190, D192) and from the three batches of Scandishake Mix bag was amplied using another real-time PCR, targeting 18S A. fumigatus rDNA. PCR products were subsequently sequenced. Sequencing data showed 100% identity with A. fumigatus rDNA for all tested specimens. Conclusion: To our knowledge, this is the rst described case of a false-positive of both GM antigenemia and circulating Aspergillus DNA detection due to nutritional supplement intake in a bone marrow transplant recipient with GVH disease. Passage of fungal DNA into the serum from the intestinal tract could occur in the same way as fungal GM could. Clinicians should be aware of this possibility of falsepositives of both tests to avoid prescription of unnecessary costly antifungals.
P177
Candida spp. oral disease, colonization and uconazole resistance in HIV/AIDS patients using microbiological and molecular detection methods in the era of antiretroviral therapy W.R. Kirkpatrick, J. E. Erlandsen, L. K. Najvar, A. C. Vallor, G. R. Thompson III, M. L. Herrera, B. L. Wickes, D. K. Berg, S. D. Westbrook, N. P. Wiederhold, S. W. Redding and T. F. Patterson The University of Texas Health Science Center, San Antonio, TX, USA Objectives: The recent prevalence of symptomatic oropharyngeal
candidiasis (OPC), colonization, and rate of uconazole (FLU) resistance due to Candida in HIV/AIDS in patients receiving antiretroviral therapy (ART) has not been well described. This study was designed to detect and identify the occurrence of oral Candida colonization/disease and FLU susceptibility in patients (pts) using standard microbiological and molecular techniques. Methods: HIV/AIDS patients were eligible for enrollment with CD4+ count <200 and/or symptomatic OPC. Oral rinse samples were obtained from 215 patients over 311 visits. Yeast colonization was assessed microbiologically and by direct amplication of yeast DNA from oral samples by standard PCR using Candida pan-fungal primers. Species ID was conrmed using CHROMagar Candida, germ tube assessment, API 20C, and molecular sequencing. FLU susceptibility (MIC 8 lg ml-1) was assessed by CHROMagar dilution. Results: Of these 215 pts, the median CD4 cell count at enrollment was 98 (range, 2348). Within this group of 215 patients, there were 178/215 (83%) colonized with yeasts by traditional cultures or by PCR. Of these 178 colonized patients, 59/178 (33%) had symptomatic oral infection and yeasts with elevated uconazole MICs (>8 lg ml-1) were detected in 45 (25%) patients. 243 of 311 patient visits (78%) were from patients on ART. Colonization was detected in 260 visits; microbiology was positive in 250 and PCR in 217; 10 were positive exclusively by PCR. Candida species were isolated and identied to the molecular level from 341 total patient visits. Of these isolates, C. albicans was detected in 54%. Other species noted were C. dubliniensis (16%), C. glabrata (17%), C. tropicalis 5%, C. krusei 4%, C. parapsilosis 3% and C. guilliermondii and C. lusitaniae <1% each. Decreased FLU susceptibility occurred in 110/341 (32%) isolates. 75/110 (68%) isolates with reduced susceptibility were non-albicans spp. 41/110 (37%) of these isolates with decreased susceptibility to FLU were obtained from OPC patients. Of 311 patient visits, colonized by multiple Candida species was detected in 106 (34%) and symptomatic OPC was present in 33/106 (31%) visits. Conclusion: Even with antiretroviral therapy, oral yeast colonization and symptomatic OPC, including non-albicans yeasts and isolates with reduced FLU susceptibility remain common in patients with advanced HIV/AIDS.
P179
Comparison between voriconazole vs. caspofungin for invasive aspergillosis among immunocompromised patients R. Rabagliati, L. Siri, G. Fuentes, I. Aedo and J. Labarca Ponticia Universidad Catolica De Chile, Santiago, Chile
Voriconazole (V) has demonstrated superiority to amphotericin deoxycholate, becoming the rst line therapy for Invasive Aspergillosis (IA). Despite caspofungin (C) has shown favorable response in some IA series, only has been approved for salvage therapy. To our knowledge there are not face-to-face studies comparing C vs. V among IA patients.
88
Objective: To assess the efcacy of voriconazole when used as

primary therapy for invasive aspergillosis in immunocompromised subjects in our center and compare to a control group who received caspofungine as primary therapy. Patients and methods: Retrospective study including patients over 15 years-old with V prescription for IA therapy hospitalized in Hospital Clnico Universidad Catolicain Santiago Chile from January 2005 to December 2008. A CRF was completed through clinical chart review. EORTC criteria were applied to classify the episode as possible, probable or proven Aspergillosis. Treatment response was dened as failure (F), stable disease (SD) or favorable response (FR) including both complete and partial response (CR en PR). Mortality analysis considers lost follow-up as a failure/dead. These responses were compared to a cohort of consecutive IA subjects between 2001 and 2006 who had received caspofungine as primary therapy using the same case and response denitions. Results: Forty-six cases received V prescribed due to IA: possible 25 (54.3%), probable 19 (41.3%) and proven 2 (4.3%). Age was 47.4 17. One years-old and 60.9% were male. The majority was haemato-oncological patients (71.7%), followed steroids or immunosuppresors users (10.9%), HSCT (8.7%) and solid organ transplantation receptors (8.7%). Twenty-one cases (45.6%) had neutropenia <500 mm-3. The controls were 51 patients who received C for IA therapy: possible 28 (55%), probable 17 (33%) and 6 (12%) proven; age was 48.1 18. Six years-old; 29 (57%) were males; 87% hematooncological, 11% HSCT, 4% solid organ receptors and 49% had neutropenia <500 mm-3. V was prescribed as rst line monotherapy in 22/46 (47.8%) of the subjects, combined with another antifungal drug in 17 (36.2%) and as salvage therapy in 7 (14.9%). Considering 20 evaluable probable and proven cases, 16/20 (80%) were FR, 1/20(5%) SD and 3/20 (15%) were failure. Mortality at the end of hospitalization was 20% and 40% at twelve-week follow-up. On the other hand, C was prescribed as rst line monotherapy in 4 of 28 (14.3%) probable and proven cases, in 13 (46.4%) associated to another antifungal drug in 11 (39.3%) for salvage or intolerant to previous therapy. Comparing results among V vs.C, FR and CR was more frequently observed in V (80% vs. 60.7%; P = 0.2 and 65% vs. 17.8%; P = 0.0009), less mortalitity at the end of hospitalization in V group (20% vs. 32%; P = 0.12) but no differences at 12 weeks mortality (40% vs. 42.8%). Comparing only probable and proven cases who received V vs.C as rst line monotherapy, FR was similar in both group 71% vs. 75%, CR 42.8% vs. 50%, mortality 14.3% vs. 25% and twelve-week mortality 42.8% vs. 25% respectively. Conclusions: V and C shown comparable efcacy considering FR and mortality. However V was superior to C to reach CR. It is not clear if combination therapy reach better results than monotherapy.
load and a CD4 lymphocytes level of 15 mmc-1. He received HAART (Epivir + Zerit + low-boosted Atazanavir) and 800 mg day-1 Fluconazol, with a clinical favorable course but a stationary CD4 level. The control lumbar puncture at 2 months showed six fungal cells per mmc and seven mononuclear cells per mmc in CSF analysis; fungal susceptibility was diminished for Fluconazol (CMI 6) and the patient received Voriconazol 400 mg day-1 (CMI 0.064). He developed photosensitivity after the previous 2 weeks of Voriconazol therapy. The next lumbar puncture was performed after 1 month and revealed 10 mononuclear cells per mmc, with fungal culture still positive for Cryptococcus neoformans and developed uconazol-resistance (CMI 32); the susceptibility at Voriconazol was preserved (CMI 0.125), so he continued the Voriconazol therapy. In a 6 months period his immune status does not improve, the CD4 level oscillating between 18 and 50 mmc-1, with undetectable viral load. He was again admitted in Institute because of the reappearing of the headache, malaise and fever. A new lumbar puncture was performed and that time the CSF analysis seamed to be compatible with bacterial meningitis (900 cells mmc-1, 60% neutrophils, 15% polymorph lymphocytes and 25% monocytes; 275 mg protein dl-1, 15 mg glucose dl-1), so he received antibacterial medication, besides Voriconazol. The latex agglutination was still positive for Cryptococcus, as in the precedents exams but the fungal culture was negative. The CD4 level was 34 mmc-1 with negative viral load. Considering that the Voriconazol level is lowered by ritonavir (the IP boosting agent), the patient received no longer this boosting agent, instead he received an increased doses of Atazanavir. Discussion: The patient developed Fluco-resistance during the treatment of the cryptococcal meningitis and he is in the way to develop Vorico-resistance also. The therapeutical antiretroviral scheme was the only one possible, because it consists in a combination of INRT + low boosted IP and nally unboosted IP, that permits the preserved high level of Voriconazol (Voriconazol shouldnt be associated with INNRT or ritonavir) The outcome for this patient depends of the response at anticryptococcal agent and the developing triazoleresistance and also depends on the rate of the increasing CD4 level (the potence of HAART) The duration of Voriconazol therapy should be indenite probably till the level of CD4 will increase beyond the 200 mmc-1 or life-long.
P181
Characterization of serial Cryptococcus neoformans isolates from patients with recurrent cryptococcal meningitis M.T. Illnait-Zaragoz1, G. F. Martnez-Machn1, C. M. Fernandez-Andreu1, M. R. Perurena-Lancha1, C. H. Klaassen2 and J. F. Meis2 1 Instituto Pedro Kouri, Havana, Cuba, 2Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Objectives: Cryptococcus neoformans is commonly associated with
meningoencephalitis in immunocompromised patients and occasionally in apparently healthy individuals. To investigate whether recurrences of 19 C. neoformans isolates from seven patients (six HIV positive and one negative) with recurrent cryptococcal meningitis are due to drug resistance, we tested the in vitro antifungal susceptibility and determined the genotypes of the isolates using MLVA. Methods: Isolates were recovered from cerebrospinal uid (n = 16), blood, urine and sperm (one each). They were identied by conventional and molecular techniques. Antifungal susceptibilities for amphotericin B, uconazole, ucytosine, itraconazole, voriconazole, posaconazole and isavuconazole were tested by CLSI M27A2 broth microdilution method. Genotyping was done using a panel of nine microsatellite (STR) markers: (CT)n, (CTA)n, (TG)n, (TCT)n, (TA)n and (CCA)n, (TTAT)n, (ATCC)n and (AATA)n using established procedures. Results: The average number of isolates per patient was 2.71. The mean time between collection of any two isolates was 52.5 days. All the strains were identied as C. neoformans var. grubii ser. Aa. None of the isolates were resistant to any of the tested drugs. Amphotericin and posaconazole MICs did not change more than twofold for any of the cases over time. STR patterns showed 14 distinctive proles. Two patients (two and three isolates respectively) had multiple genotypi-
P180
Induced uco-resistance in a cryptococcal meningitis at an immune-compromised patient R. Moroti Constantinescu, A. Hristea, V. Arama, D. Munteanu, O. Dorobat, I. Podea and V. Gheorghita Matei Bals National Infectious Diseases Institute, Bucharest, Romania Introduction: Cryptococcal meningitis is one of the most frequent
indicatory SIDA stage in HIV infection, appearing at a level at CD4 lymphocytes below 50 mmc-1. Although most Cryptococcus neoformans strains are susceptible to uconazole, isolates with high MICs have been detected. Case description: The case related here is about a lent-progressor HIV infected 20 years-old patient (high probability perinatal infection), admitted in Infectious Diseases Institute for subacute meningitis and diagnosed in SIDA stage. The patient was hypotrophic, pale and accused headache, malaise and nausea for 2 weeks and the medical examination revealed a low-grade nuchal rigidity and absence of fever. The lumbar puncture shows high pressure clear CSF, with 300 elements per mmc, 100% round fungal cells, identied as C. neoformans, which a good azole susceptibility. HIV serology was positive, with an 15800 c ml-1 viral
89
cally identical isolates. The other patients (14 isolates) were infected by more than one genotype. Conclusions: These results suggests that recurrences were not due to drug resistance but probably by initial co-infection with different strains.
P191
Electrophoretic karyotype and gene mapping of Brazilian strains of Sporothrix schenckii L. Santos Feitosa1, A. A. Sasaki2 and Z. P. Camargo2 1 o Universidade Camilo Castelo Branco, Sa Paulo, Brazil, 2 o o Universidade Federal de Sa Paulo, Sa Paulo, Brazil Objectives: In order to know differences in electrophoretic karyotype and gene mapping in Sporothrix schenckii strains, we analyzed 10 Brazilian strains using pulsed eld gel electrophoresis (PFGE) and mapped ITS and b -tubulin genes in electrophoretic karyotype through Southern blotting assay. Methods: Ten S. schenckii strains isolated from patients or from soil were cultured in Sabouraud agar slants at room temperature. After 10 days of incubation at 37 C under gentle shaking, yeast cell were harvested. Cells were mixed with Zymolyase solution and Low Melting Point Agar to reach a nal concentration of 1 108 cell ml-1. Then, cell suspension were pipetted into casting mold and agar allowed to solidify at 4 C. Plugs were unmolded and spheroplast solution were added and the inserts were incubated overnight at 37 C. Spheroplast solution were replaced by NDSK buffer and then, the inserts were washed three times with EDTA (50 mmol L-1), and incubated overnight at 50 C. NDSK buffer were replaced by Stock solution after washing three times with EDTA (50 mmol L-1) and stocked at 4 C until use. Plugs were loaded into PFGE gel (0.8%) and chromosomal separation were carried out in a constant temperature at 10 C, with homogeneous pulses and interpolation for 168 h at 42V (phase 1: pulse time 900 sec/24 h; phase 2: 1800 sec/24 h; phase 3: 2700 sec/ 48 h; phase 4: 3600 sec/48 h; phase 5: 4500 sec/24 h). After separation, chromosomes were transferred to nylon membrane by capillarity and membranes were hybridized with probes from ITS fragments and b-tubulin genes. Results: The electrophoretic karyotype show ve to seven chromosomal bands in S. schenckii Brazilians isolates. Genome size, calculated through sum of all chromosomal bands, appeared to range from 27.7 to 36.6 Mpb. Four strains presented the same electrophoretic karyotype (EPM 03, EPM 05, EPM 18 and EPM19). EPM 14, EPM 10 and EPM 20 show similar pattern of electrophoretic karyotype having common bands of 8.0, 6.0, 3.5 and 3.0 Mpb. The band of 6.0 Mpb was present in all isolates and only EPM 15 strain did not present the band of 8.0 Mpb. ITS probe hybridized in the bands of 7.0 Mpb (EPM 03, EPM 05, EPM 18, EPM 19, EPM 14, EPM 08); 8.0 Mpb (EPM 19, EPM 20); 5.6 Mpb (EPM 10); 3.2 Mpb (EPM 17 and EPM 15). b-tubulin probe hybridized in the bands of 3.1 Mpb (EPM 03, EPM 05, EPM 18, EPM 19, EPM 08); 4.7 Mpb (EPM 20); 3.5 Mpb (EPM 17); 3.2 Mpb (EPM 15); 3.0 Mpb (EPM 14 and EPM 10). Conclusion: Difference in electrophoretic karyotype among Brazilian strains suggest chromosomal polymorphism in size and number of chromosomal bands. ITS probe hybridized predominantly in large chromosomes and the opposite happened with b-tubulin probe. These ndings show high degree of polymorphism among Brazilian S. schenckii isolates.
assessment, genotyping and phylogenetic dentogram reconstructing. RAPD analysis is based on the PCR with primers of arbitrary sequence. The aim of this study was to evaluate RAPD analysis efciency with each of the ve primers JWFF, R4, RP2, RP42 and R108 of the medically important fungi in epidemiological studies. Methods: We studied strains of Candida spp., Trichoderma spp. and Penicillium spp. from the Russian pathogenic fungi collection of Kashkin Research Institute of Medical Mycology. The primers used in RAPD analysis were: JWFF (GGTCCGTGTTTCAAGACG), R4 (TGGTCGCGGC), RP2 (AAGGATCAGA), RP42 (CACATGCTTC) and R108 (GTATTGCCCT). In RAPD patterns evaluation only bands presence but not its intensity considered being signicant. For increasing RADP analysis accuracy we made statistical analysis of results using soft Gel Compar II v. 5.10. Cluster analysis based on RAPD patterns was performed with UPGMA/Dice algorithm. Results: We examined primers on theirs ability to discriminate isolates from collection of strains and species Candida genus. Two primers, JWFF and R4, gave the highest level of discrimination different species of C. albicans. Comparison of the RAPD patterns of the same strain in different repetition of analysis gave 95% of similarity for JWFF primer and 98% for R4; similarity between different strains was 4582% for JWFF and 60 94% for R4; whereas Candida species revealed similarity not exceeded 56% for JWFF and 60% for R4. It is important that major bands were equal for all strains within same species and varied between different species. This allowed easily differentiate Candida species without running statistical analysis (Figure 1). Then we tested efciency of these primers in epidemiological studies on several non-Candida genus. Two isolates from genus Trichoderma and two from Penicillium were used in the exam. The goal was to determine whether the isolates belong to the same population or not. RAPD typing with ve primers revealed very low similarity level: from 0% to 27% for Trichoderma spp. and from 6% to 35% for Penicillium spp. Also common major bands were not detected in RAPD patterns. These results most probably indicated that this fungi might belong to different populations and moreover to different species. ITS1 and ITS2 rDNA loci were sequenced to verify this prior conclusion. Sequence alignment conrmed that isolates belongs to the different species: T. citrinoviride and T. atroviride, P. chrysogenum and P. commune. Thus these primers are useful to discriminate species as within Candida as within other genus. But similarity of Trichoderma and Penicillium RAPD patterns exceeded similarity between species within these genus, so logenetic dentogram constructed in this case was incorrect (Figure 2). Therefore it is necessary to use other primers for intergeneric distinguishing.
Figure 1 RAPD patterns with primer JWFF of Candida spp.
P192
RAPD analysis efciency of the medically important fungi in epidemiological studies D. Markozashvili, N. A. Smolina and S. M. Ignatieva Kashkin Research Institute of Medical Mycology of SEI APE SPb MAPE, Saint Petersburg, Russia Objectives: RAPD analysis is one of the most popular DNA-ngerprinting methods used for genetic variability detection, relationship Figure 2 RAPD patterns with primer R4 of four fungi species.
Conclusion: RAPD analysis with JWFF, R4, RP2, RP42 and R108 primers were useful for distinguishing species within Candida, Trichoderma, Penicillium genus and most probably within other fungi genus. RAPD with JWFF primer is the best for Candida discriminating because it allows easily differentiate species without applying software analysis.
90
JWFF and R4 primers are more suitable for distinguishing C. albicans strains. Statistical treatment of RAPD results is essential for accuracy increasing and avoidance of incorrect typing.
P202
Mixed Candida albicans and Candida krusei biolm formation on stainless steel surface evaluation of fungal killer toxin on two Candida species biolms N. Seguy1 and E. Mazars2 1 University of Burgundy, Dijon Cedex, France, 2Hospital, Medical biology laboratory, Valenciennes, France
Most of the studies on biolm of Candida have so far used the silicone, the polyethylene, PVC, elastomeric supports. Nevertheless, other biomaterials are also used for medical prosthetic implants (resins, metals as the titanium). These devices can become colonized by microorganisms which produce a biolm. But, in that case, the data are very fragmented. Two Candida species were compared: Candida albicans and Candida krusei. Their differences are specically obvious like, their morphological forms (hyphal forms only observed in C. albicans), their habitats (commensal versus environmental), and their resistance to antifungal drugs. Our study compared development of biolm made up by single yeast (C. albicans versus C. krusei). Several parameters such as temperature (25, 30 and 37 C) and time course (2, 24, 48, 72 and 96 h), were investigated to obtain monospecies biolms. These parameters (temperature at 25 C and time course: 272 h), were dened to obtain an optimal development on both species Candida in a mixed biolm. The formation of biolms elaborated with one Candida (C. albicans or C. krusei), had the same characteristics, especially in the early steps: adhesion and the colonization of the steel surface was observed after 24 h growth for the two species whoever the temperatures may be. Nevertheless, after 48 h of incubation, we saw a maximum of development of these two yeasts ordered in biolms. The hyphal/pseudo-hyphal forms are observed only with C. albicans biolm formation, and not on the C. krusei biolm. With these experiments at 25 and 30 C, the number of C. albicans increased at least 4-fold more by comparison with C. krusei. Nevertheless, number of adherent cells (at 2 h of incubation) was the same for the two species. For the mixed biolms, in early steps (2 and 24 h of incubation), C. albicans was the most prevalent in the biolm. But at 48 and 72 h, C. krusei colonized widely the stainless steel surface (10-fold more). And the number of C. krusei was more important since 24 h of incubation in the mixed biolm than in the biolm constituted with only C. krusei. The mixed biolms of C. albicans and C. krusei were in favour of C. krusei development. Addition of killer toxin, secreted by Pichia anomala in the mixed biolm induced signicant reduction on both C. albicans and C. krusei developments. From 24 h of incubation at 25 C, only 28% of C. krusei and 47% of C. albicans were growth in the mixed biolm to compare with the mixed biolm without P. anomala secreted killer toxin. It is interesting to note that effect of killer toxin was more important on C. krusei. At 48 h, only 4% of C. krusei cells were alive against 17% of C. albicans in mixed biolm with P. anomala. This effect of killer toxin was quantity-dependent.
P201
Candida albicans uptake and escape from macrophages C.G.J. McKenzie1, U. Koser1, L. E. Clift1, J. M. Bain1, H. Mora-Montes2, R. N. Barker1, N.A.R. Gow2 and L. P. Erwig1 1 University of Aberdeen, Aberdeen, United Kingdom, 2School of Medical Sciences, Aberdeen, United Kingdom Objectives: Candida albicans is the most common human fungal
pathogen. In immunocompromised individuals, lamentous C. albicans penetrates the mucosal layers of the host, causing systemic candidiasis, with a high mortality rate. C. albicans pathogenicity depends on its ability to kill immunocompetent cells and escape destruction by the host immune system. Our aim is to determine the role of specic C. albicans cell wall components and corresponding pattern recognition receptors (PRRs) for the ability of C. albicans uptake by and escape from macrophages. Methods: We have examined the worlds largest collection of genetically and phenotypically characterised isogenic mutants of C. albicans, depleted in specic cell wall components, and conducted complimentary studies using monoclonal antibodies to Dectin-1, Mannose receptor (MR) and soluble inhibitors (laminarin, mannans). Further experiments were conducted using mutants (hgc1D, efg1D, cph1D, efg1D/cph1D and clb2D) with intact cell walls but defects in morphogenic switching from yeast to hyphal forms. Uptake was assessed by our standard phagocytosis assays using bone marrow derived (BMDM) and J774 macrophages at 30 min, 1, 2 and 3 h at C. albicans:macrophage ratios of 1 : 1 and 3 : 1. The ability of C. albicans to kill macrophages was assessed by light microscopy using Trypan Blue and conrmed by scanning electron microscopy. Results: Uptake by BMDM and macrophage cell lines of C. albicans glycosylation mutants with defects in phosphomannosylation (mnn4D and pmr1D) was signicantly reduced, whereas uptake of mutants decient in O-linked mannosylation (mnt1/2D) was signicantly increased, compared with wild-type and genetically complemented controls. Despite signicant differences in the rate of uptake, all glycosylation mutants exhibited a reduced ability to kill macrophages in vitro. Complimentary experiments using wild-type C. albicans and blocking specic PRRs using antibodies or soluble inhibitors show delayed uptake when inhibiting Dectin-1, but not MR. Interestingly, despite their divergent effects on uptake, blocking Dectin-1 and MR resulted in similar reductions in macrophage killing. Morphogenesis mutants with intact cells walls but unable to form true hyphae, showed little difference in uptake, when compared to wild-type C. albicans, but interestingly were unable to kill macrophages. Conclusions: C. albicans uptake by macrophages is strongly inuenced by the glycolysation of the fungal cell wall, but not the pathogens ability to switch from yeast to hyphal forms. Morphogenic switching however is essential for C. albicans ability to kill host cells and abrogated in mutants that are unable to form hyphae. Interestingly, all glycosylation mutants despite normal hyphal formation exhibit a reduced ability to kill macrophages in vitro. Blocking PRRs known to recognise motifs on the C. albicans cell wall signicantly reduces macrophage killing, regardless of whether they contribute to uptake. This illustrates the complex interactions between the C. albicans cell wall and macrophage PRRs. A better understanding of these interactions is crucially important for therapeutic manipulation of the hosts ability to ingest and process fungal pathogens.
P203
The interaction of macrophages with different Cryptococcus neoformans isolates L.V. Filippova, N. V. Vasilyeva, E. P. Kiseleva, E. V. Frolova and A. E. Uchevatkina Kashkin Research Institute of Medical Mycology, St. Petersburg, Russia Objectives: The pathogenesis of cryptococcosis reects the interaction between immune response to the infecting organism and the virulence potential of the Cryptococcus neoformans strains. The aim of this study was to investigate the ability of highly and weakly virulent C. neoformans strains to inuence phagocytosis and nitric oxide (NO) production by murine peritoneal macrophages. Methods: Seven strains of C. neoformans were isolated from patients with AIDS or after renal transplantation. Range of virulence C. neoformans strains was study according to survival time of Balb/c male mice 812 weeks old after intravenous inoculation with 0.5 106
91
cells per mice. The observation time was 65 days. Murine peritoneal macrophages (PM) obtained from Balb/c male mice were incubated during 18 h with and without LPS in glass Chamber Slides in 5% CO2 incubator. For phagosytosis of different C. neoformans strains with and without opsonization of fresh serum were added in ratio 1 : 2 and incubated for 2 h. The phagocytic index (PI) was determinated as a number of attached and ingested cryptococci divided by macrophages number. For nitric oxide production PM were incubated during 48 h with C. neoformans in ratio 10 : 1. The concentration of NO was measure spectrofotometrically with Griess reagent. Results: Highly virulent strains have caused 50% mortality of mice on 14th day and 100% mortality on the day 25 after inoculation. Low virulent strains have caused 50% mortality on the day 50th and there was no 100% mortality after 65 days of observation. These two groups of strains were used for investigation of interaction with PM in vitro. In all variants of experiments PI of strains with low virulence was signicantly higher than for strongly virulent strains. Opsonization have increased PI both highly (13.5 2.1 vs. 8.8 1.0% P 0.01) and weakly virulent strains (24.3 0.3 vs. 14.7 0.9% P 0.01) in comparison with control. Activation PM with LPS was resulted in increase of PI more for highly virulent strains than weakly virulent ones (20.3 1.0 vs. 8.8 1.0 P 0.01 and 25.7 0.7 vs. 14.7 0.9% P 0.01). We have found that nitric oxide synthesis of LPS-activated PM after incubation with highly virulent strains was decreased signicantly in comparison with control (73.8 19.7 vs. 168.3 18.8 nmol L-1 per 106 cells P 0.01). In contrast, incubation with weakly virulent strains was resulted in markedly increased nitrite generation (302.3 45.9 vs. 168.3 18.8 nmol L-1 per 106cells P 0.01). Therefore, highly virulent strains may cause a direct suppression of NO-mediated activity of LPS-stimulated macrophages and poorly phagocytosed. On the contrary, low virulent strains induce an activation of nitric oxide production and better phagocytosed in all variants of experiments in comparison with results for highly virulent strains. Conclusion: All these data suggest that the degree of the virulence C. neoformans depend on capability different strains to inuence on phagocytosis and NO production by macrophages. Further studies are necessary to determine the exact mechanisms of such effect.
demonstrate that ROS are released prior to NET detection. Currently we aim to visualize NET formation in a murine in vivo infection model by 2-photon-microscopy. First results show NET like structures around sources of infection in explanted lungs of fungi treated animals. To summarize our data, we found rapid NET formation as a commonly observed immune response of neutrophil granulocytes contacting A. fumigatus in vitro and in vivo. Consistent with studies on different pathogens this mechanism seems to be ROS-dependent. The time course of NET-formation and the ROS-dependency in vivo has to be investigated by us in future. Furthermore we focus on establishing an innovative infection model to perform intravital 2-photon-imaging in the respiratory organs of mice.
P211
Molecular diagnosis of Malassezia spp. by PCR-RFLP M. Shams-Ghahfarokhi1, S. Amanloo1, M. H. Mirzahosseini2, M. Foruzandeh-Moghadam1 and M. Razzaghi-Abyaneh2 1 Tarbiat Modares University, Tehran, Iran, 2Pasteur Institute of Iran, Tehran, Iran Background: Lipophilic yeasts of the genus Malassezia are commensals of the microbiota found on normal skin of many warmblooded vertebrates, but they are also associated with several skin diseases such as tinea versicolor, seborrehoeic dermatitis and even systemic infections. The genus Malassezia has recently been revised to include 11 species by biochemical, morphological and molecular ndings. Application of polymerase chain reaction (PCR) technology to molecular diagnostics allows early and accurate identication of Malassezia spp. Methods: At the rst, conventional identication methods based on macroscopic, and microscopic features and physiological properties was performed. All samples consisted of scales and scraping from the scalps of tinea versicolor patients. collected samples were divided into two portions- one for culture and biochemical analysis, and the other for molecular examination. A specic and unique restriction pattern was determined for each of three currently recognized Malassezia species. Results: The primers ITS1/4 produced a large amplicon (about 800 bp for M. furfur, and M. globosa) and the other amplicon is smaller (about 600 bp for M. sympodialis). For further species distinction with this amplicon, one restriction endonuclease proved useful. Restriction patterns obtained by ECOR1 digestion of amplied products from the ITS region was distinguish. The PCR-RFLP results correlated well with those obtained with traditional identication procedures. No intraspecic variation was detected. Conclusions: This study was aimed at the development of a DNAbased procedure applicable to rapid laboratory conrmation and identication of each Malassezia species.
P204
New insights into NET formation after contact of polymorphonuclear neutrophils to Aspergillus fumigatus M. Hasenberg1, S. Wolke2,3, A. Brakhage2,3 and M. Gunzer1 1 Institute for Molecular and Clinical Immunology, Otto-von-Guericke-University, MAGDEBURG, Germany, 2 Leibniz Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute (HKI), JENA, Germany, 3 Friedrich-Schiller-University JENA, Germany
Since their discovery in 2004 nucleic extracellular traps (NETs) released by certain cell types including neutrophil and eosinophil granulocytes were shown to play a crucial role in mediating innate immune responses towards different bacterial und fungal pathogens. Recently it was found by us and others that neutrophil granulocytes release NETs also upon contact to the lamentous fungus Aspergillus fumigatus. In the present study we aimed to characterize this process in more detail focusing on the kinetics of NET-formation as well as clarifying the responsible cell-biological mechanisms. By the use of several microscopic techniques (Scanning electron microscopy, uorescence wideeld microscopy and confocal microscopy) we initially demonstrated the generation of NET like structures after coincubation of A. fumigatus germlings and freshly isolated murine or human PMN in vitro. The analysis of our time lapse video microscopy data allowed us to examine the exact time course from initial contact to the fungal surface to explosive release of NETs up to 3 h later. Moreover, we investigated the dependency of this phenomenon on the induction of an oxidative burst. Therefore we added the NADPH-oxidase inhibitor DPI to the cell coincubation and found clearly reduced NET formation. By uorescence staining of reactive oxygen species we could
P212
Signicance of allele state determination of MTL locus in Candida albicans S.M. Ignatieva Kashkin Research Institute of Medical Mycology, Saint-Petersburg, Russia Introduction: Candida albicans being opportunistic pathogens represent unicellular organisms with the size of cell 610 l. These organisms are known to exist in two morphological states whiteand opaque. White-opaque switching is caused by high frequency genotype switching between different mating types. MTL locus is responsible for mating type and it is situated on fth chromosome. There are two mating types type a and type a, which are carried out as a result of loci become homozygous. Mating may take place only between homozygous MTLa and homozygous MTLa strains. Cells possessing opaque phenotype are more pathogenic then that with white phenotype because of its higher invasive activity.
92
Materials and methods: Cloning of C. albicans strains was conducted on Saburo agar; goal was to get genetic uniformity of descendants. Cloning was followed by distinguishing able and disable to switching strains. In future studying, all strains were used. DNA extraction from liquid culture was held by previously optimized method with using isoamyl and chloroform and glass beads. After extraction, PCR was carried out. Each strain was exposed two reactions varied in types of primers, the rst one were for MTLa locus the other for MTLa locus. For amplication results visualization agarous electrophoresis was used. By evaluation of fragments, size concentration of gel was chosen 1.2%. Results and conclusion: Strains that were able for phenotype switching had homozygous MTL loci and their genotype was MTLa/ MTLa, or MTLa/MTLa. And on the other hand strains for which switching was not observed had heterozygous genotype. So that previous genotyping of C. albicans clinical isolates MTL loci and determining allele state of fth chromosome might have important diagnostic signicance. Strains being homozygous tend to be more pathogenic than heterozygous one.
components, DNA isolation reagents, and gel electrophoresis equipment. Furthermore, no DNA probes or expensive analysis is needed. The same MP65 specic primers used in Multiplex PCR could be used also to develop a Multiplex Real-Time PCR for detection and identication of Candida species in biological samples. The advantage of the Multiplex Real-Time PCR over PCR is that it is simpler, less expensive and consequently more readily adaptable to Candida detection in clinical laboratories.
P214
The CAMP65 gene is essential for cell wall integrity, adhesion and biolm formation S. Sandini, A. Stringaro, S. Arancia, M. Colone, S. Murtas, N. Mastrangelo, A. Cassone and F. De Bernardis `, Istituto Superiore di Sanita Rome, Italy Objectives: We have previously shown that Camp65 is a putative bglucanase mannoprotein adhesin of Candida albicans, required for hyphal morphogenesis and experimental pathogenicity and recognized as a major target of the human immune response against this fungus. The objectives of this study were to determine a possible role of Camp65 in cell wall integrity, adhesion and biolm formation with the use of microbiological and molecular biological tools. Methods: To determine the role of Camp65 on the cell wall integrity, we grew the wild-type and Camp65 null mutant strains in YPD w/o different cell wall-perturbing agents. We then checked the sensitivity (by microdilution and spotting in solid medium), cell morphology (by light and scanning electron microscopy), the expression of some genes involved in cell damage response (by real-time PCR), the expression of MAPKs and P-gp-like protein (by Western-blot analysis), and the cell wall composition (by immunoelectron microscopy, ow cytometry and high-performance ionic chromatography). To investigate the role of Camp65 on the adhesion, we tested the differences in adhesion of wild-type and Camp65 null mutant strains using two target cell systems and evaluation methods: (i) exfoliated human buccal epithelial cells (BEC), where adhesion was evaluated microscopically; and (ii) Caco-2 cell monolayer, adhesion evaluated by cfu count. In order to determine the role of Camp65 on biolm formation, we performed an in vitro reduction assay with XTT and menadione, where the cells were added to 24-well plates and incubated for 2 days until they adhered to the surface, to permit the development of a biolm. To understand how CAMP65 is linked to adherence and lamentation, we studied its expression by Northern-blot analysis in mutants defective of genes regulating hyphal morphogenesis and adherence (efg1, efg1 cph1, cph1). Results: More observations have supported the idea that CAMP65 is required for cell wall integrity: (i) the Camp65 null mutant is hypersensitive to Congo red, calcouor white, hydrogen peroxide, caspofungin, uconazole, voriconazole, itraconazole, b 1-3 glucanase and weakly sensitive to SDS, tunicamycin and caffeine; (ii) interestingly, under the stress of Congo red, the Camp65 null mutant shows morphological changes, such as swelling and formation of pseudohyphae and hyphae and an increase in the phosphorylation of Mkc1p, Cek1p and Cek2p (p4244 homologues), consistent with the increased sensitivity to this substance; (iii) furthermore, the Camp65 null mutant presents an expression of some genes involved in cell damage response, such as DDR48, a decrease of P-gp-like protein expression and a different cell wall composition. Compared to the wild-type, Camp65 null mutant shows a reduced adherence and a defect in biolm formation, highlighting the role of Camp65p adhesin. Furthermore, CAMP65 was under the differential control of several regulators of lamentation; its expression was particularly enhanced in efg1 and efg1 cph1, but not in cph1 strains, suggesting that it is dependent on cAMP pathway, but independent of the MAPK cascade. Conclusion: Overall, our data demonstrate that Camp65 is involved in cell wall integrity, adhesion to host tissue and biolm formation, making it a promising therapeutic target.
P213
Multiplex PCR and real-time PCR identication of ve medically important Candida species by using 65 kDa mannoprotein gene primers S. Arancia1, S. Sandini2, A. Cassone2 and F. De Bernardis2 1 `, Instituto Superiore di Sanita Roma, Italy, 2National Health Institute, Roma, Italy Objectives: Candidemia has been estimated as the fourth most
common nosocomial infection with an attributable mortality rate of about 50%. Early diagnosis is often difcult as most clinical signs are non specic and cultures become positive too late for the initiation of effective antifungal therapy. Blood cultures were reported to be negative in 56% of autopsy-proven disseminated candidiasis. Candida albicans is the most common and clinically relevant pathogen of the genus. However, there has been a signicant trend in the emergence of species other than C. albicans, with a particular increase in C. glabrata, C. krusei, C. parapsilosis and C. tropicalis frequency. In addition, given that several non-C. albicans species are intrinsically resistant to common antifungal agents, accurate identication of Candida species is crucial for the determination of appropriate antifungal therapy. For these reasons there is an increasing interest in the development of new technological tools for the diagnosis of invasive candidiasis. Polymerase chain reaction (PCR) methods to detect fungal DNA from blood and other biological samples are being developed in the research laboratory. PCR has the potential to decrease the time required to diagnose fungal infections and therefore reduce the mortality associated with disseminated disease. Methods: In this work we describe the development and evaluation of single-tube multiplex PCR and real-time PCR methods for the detection of the ve most common Candida species. Sequences of the MP65 gene of the ve different Candida species were determined (C. albicans, C. glabrat a, C. guilliermondii, C. tropicalis and C. parapsilosis) and six different primer pairs were used in the same PCR reaction with the objective of producing different specic amplicons dependent on the target present in the sample. Then we developed two types of PCR: in the rst, in each reaction tube we added a mix of ve different Candida species DNA and a single species-specic primer pair. In the second, in each reaction tube we added a mix of ve primer pairs and a single Candida species DNA. Results: Both types of PCR assays detected the ve Candida species tested. All the PCR assays were also performed with DNAs extracted from biological samples (urine and serum). At the time being, new assays that make use of the same primers and samples are being performed by Real Time PCR, thus allowing to reach specicity in a short time. Conclusions: In conclusion, we have drawn primers-pairs specic for ve Candida species and we developed different PCR methods using them. The methods are cost-effective because they only require PCR
93
P215
Multilocus sequence typing of Cryptococcus neoformans var. grubii Italian clinical isolates. Preliminary results of three gene sequence analysis M. Cogliati1, R. Zamrova2, M.A. Viviani2 and FIMUA Cryptococcosis Network2 1 ` Public Health-Microbiology-Virology, Milano, Italy, 2Universita Degli Studi di Milano, Milano, Italy Objective: Cryptococcus neoformans var. grubii (serotype A) is the
major etiological agent of cryptococcal meningitis in both immunocompromised and immunocompetent patients. Since this pathogenic yeast is globally distributed and the PCR-based molecular methods are not sufciently able to discriminate among the different populations, a multilocus sequence typing (MLST) approach has been applied in the present study to investigate the genotype of C. neoformans var. grubii Italian clinical isolates. Methods: The analysis includes 53 isolates, each representative of a single case. Forty out of the 53 cases were previously reported in the ECMM cryptococcosis survey (Viviani et al. 2002) whereas the additional 13 cases were recorded subsequently. Genotyping was performed by MLST analysis adopting the scheme recently established by the ISHAM Cryptococcus Working Group (Meyer et al. 2009) which includes seven hypervariable housekeeping genes: IGS1, GPD1, LAC1, URA5, SOD1, CAP59, and PLB1. In the present study, three (IGS1, GPD1 and URA5) of the seven genes have been completely sequenced and analysed for all the strains. Results: URA5 and IGS1 produced ve different genotypes each, and GPD1 three. The combination of the three genes produced 11 genotypes and the most representative genotype grouped 16 isolates. No correlation between genotypes and geographic distribution was found. Interestingly, the ve IGS1 genotypes were not included in the list of genotypes previously identied by Litvintseva et al. (2006) and therefore have been classied as new genotypes. In addition, all the ve genotypes presented a 13-bp insertion which was identied only in one African isolate of the Litvintsevas study. On the contrary, BLAST analysis in GenBank database showed that this 13-bp insertion was present in several IGS1 sequences, mostly from European isolates (The Netherlands, Belgium, France, and Italy). Conclusions: These preliminary results show that the genotypes of Italian var. grubii isolates are different with respect to other strains previously genotyped by MLST (Litvintseva 2006) and, comparing IGS1 sequence, they appear to be correlated to few European isolates. The heterogeneity of IGS1 genotypes presenting the 13-bp insertion suggests a possible origin of this genotype in Europe. The present study is ongoing with the aim of sequencing all the seven genes of the MLST standard scheme.
and the plates were left on ice for 15 min. After centrifugation at 2250 g for 20 min at 4 C, 130 ll of supernatant was collected and transferred to new plates containing 20 lg of linear acrylamide as carrier. 15 ll of 2.5 mol L-1 sodium acetate and 150 ll of absolute ethanol were added, the plates kept on ice for 15 min and then centrifuged for 15 min at 2250 g and 4 C. The supernatant was gently removed, the pellet was washed twice with 80% ethanol (5 min at 2250 g at 4 C), left to dry at room temperature and then redissolved in 30 ll of buffer TE/RNase (10 mmol L-1 TE, 10 lg ml1 RNAse, pH 7.5). To evaluate whether this method of DNA recovery was the most efcient, duplicates with 100 ng of plasmid DNA (~4 Kb) were submitted to different protocols of precipitation and the result was compared with known concentrations of the plasmid DNA, 20, 60 and 100 ng (lanes 7, 8 e 9, respectively). The addition of Tween 20 to the culture medium is important to avoid growth of fungus on the surface of the solution. In the absence of a refrigerated centrifuge there is no loss in processing the samples at room temperature. The precipitation with linear acrylamide, sodium acetate and absolute ethanol did not promote greater recovery of DNA when compared with other techniques widely used in molecular biology (Fig. 1A, 1B). However, for the recovery of smaller molecules as plasmid DNA (~4 Kb) it was more efcient (Fig. 1C, 1D). With this methodology we managed to extract genomic DNA from 192 samples in just three hours, free of endonucleases and enough to provide material for different molecular biology procedures like PCR, RFLP, RAPD and real-time PCR.
P217
Comparison of the efciency of DNA extraction from Aspergillus fumigatus spores using ve commercial kits and quantitative PCR U. Nawrot, K. Wlodarczyk, A. Wasik, A. Sadakierska-Chudy and T. Dobosz Wroclaw Medical University, Wroclaw, Poland
Detection of fungal DNA in clinical samples requires the most sensitive and specic methods. An extraction of fungal DNA represents a crucial point in such procedures, as its poor efciency and frequently occurred contaminations are regarded the most important reason of false negative and false positive results, respectively. Currently, most kits offered in the market are intended for isolation of human DNA from clinical samples, or for extraction of DNA from fungal cultures. In this study we used the quantitative real-time PCR method (qPCR) for comparison an efciency of DNA extraction from blood samples spiked with Aspergillus (10107 spores ml-1) using ve commercial kits: Qiamp DNA Micro (QMc) and Qiamp DNA Mini (QMn) from Qiagen, ZR Fungal/Bacterial DNA (ZRF) and YeaStar Genomic DNA (YSG) from Zymo Research, and Dynabeads DNA Direct Blood (DYN) from Dynal Biotech. In all above methods the manufacturers procedures were preceded by lysis of red and subsequently white blood cells and in case of both Qiagen kits additionally fungal cells destroying by vortexing with glass beads on Mini-BeadBeater-8 (Biospec) or enzymatic treatment with a lyticase (Lofer et al.1997; Metwally et al. 2008). The glass beads beating was added also to DYN protocol, whereas in
P216
A practical and rapid microplate method for yeast genomic DNA extraction A.J. Mota, G. N. Back-Brito and F. G. Nobrega University of Sao Paulo, Sao Paulo, Brazil
In this work we established a practical and low cost protocol that allows rapid extraction of genomic DNA from multiple samples of several yeast genera (Candida spp., Debaryomyces spp., Geotrichum spp., Hansenula spp., Issatchenkia spp., Pichia spp., Saccharomyces spp., Trichosporon spp., Yarrowia spp.). Aliquots of rich yeast medium (150 ll) with 0.001% v/v Tween 20 were distributed in two 96 wells microplates. A small quantity of cells was inoculated with frog of 96 pins and the plates where incubated at 30 C overnight without shaking. The plates were centrifuged at 2250 g for 5 min at 20 C, the supernatant was removed and the cells resuspended in 100 ll of lyses buffer (100 mmol L-1 EDTA, 50 mmol L-1TrisCl, pH 7.5, 25 mmol L1 DTT, 165 lg ml-1 de Zymolyaze) and incubated at 37 C for 30 min. SDS was added to a nal concentration of 1%, followed by incubation at 65 C for 30 min. 40 ll of 5 mol L-1 ammonium acetate were added
94
kits of Zymo Research cell wall breaking is a part of manufacturer instruction, namely enzymatic lysis in YSG and mechanical in ZRF. qPCR was performed using previously described Aspergillus-specic primers and TaqMan probe targeting 28S rDNA (Williamson et al. 2000, White et.al 2006) on Rotor- Gene 6000 (Corbett Life Science). A serially diluted genomic DNA of A. fumigatus (IHEM13934) was used as standard. All examined DNA extraction methods were efcient enough to detect the lowest tested number of fungi (10 spores), with CT values ranged between 34.1 0.8 for ZRF, and 37.5 1 for DYN. ZRF and YSG methods showed the highest yield. The use of beads beating instead enzymatic lysis slightly enhanced the amount of extracted DNA with both Qiagen tests. All examined methods seems to be suitable for the extraction of DNA from blood infected with Aspergillus spores. ZRF method, however, because of less complicated procedure and good efciency seems to be more relevant for routine use.
P219
Cell cycle regulation in the pathogenic yeast Cryptococcus neoformans S. Kawamoto1, V. Virtudazo1, M. O. Ohkusu1, Y. M. Miyagi2, S. M. Miura3 and K. T. Takeo1 1 Chiba University, Chiba, Japan, 2Kanagawa Cancer Center Research Institute, Yokohama, Japan, 3Yokohama City University, Yokohama, Japan
We have been involved in studies towards molecular understanding of cell cycle regulation in the pathogenic yeast Cryptococcus neoformans. Our group has reported the unique cell cycle pattern of C. neoformans, different from that of the model yeast Saccharomyces cerevisiae. In contrast to S. cerevisiae, very little is known about the molecular regulation of C. neoformans cell cycle. To clarify C. neoformans cell cycle regulation at the molecular level, cell cycle control genes in C. neoformans were cloned and analyzed, and further studies are currently being done to conrm their function in C. neoformans cell cycle. The homologues of CDC28/Cdc2, the main cell cycle gene which regulates the major processes in eukaryotic cell cycle, and its cyclin counterparts, known to interact with CDC28/Cdc2 and activate it to carry out specic controls throughout different stages of the cell cycle, were isolated and identied from C. neoformans. In addition we have also cloned some other related gene candidates. Analysis of amino acid sequences of the CDC28/Cdc2 homologue, CnCdk1, revealed that it possesses the conserved motifs found in CDC28/Cdc2 homologues. However, we found the difference in an amino acid residue in the well conserved PSTAIRE motif known to be involved in cyclin binding; in CnCdk1 alanine is changed to serine to become PSTSIRE. In addition to CnCdk1, at least three cell-cycle related cyclin homologues were identied in C. neoformans. Analysis of putative amino acid sequences of these cyclin homologues showed that one is a G1 cyclin homologue, named CnCln1 and two are B-type or G2/M cyclin homologues, named CnClb1 and CnClb2. One of the features that were observed in CnCln1 is the occurrence of two upstream ORFs in the 5 leader of its mRNA. Short uORFs in the 5 leader sequence are known to affect translational efciency of many eukaryotic genes. We also identied CnCdc25, the Cdc25 homologue in C. neoformans. Cdc25 is a phosphatase involved in the dephosphorylation of the Cdk1 tyrosine residue that results to activation of the Cdk1-cyclin B complex. Analysis of the putative Cdc25 catalytic domain showed that CnCdc25 possesses the conserved motifs present in protein phosphatases and the consensus sequences involved in tyrosyl phosphate substrate binding. Further molecular analysis of cell cycle regulation in C. neoformans is underway.
P218
Cloning, characterization and expression of the gene encoding a glicoprotein of 70 kDa (gp70) from Paracoccidioides brasiliensis J.T.M. Maricato, L.S. Feitosa, E. S. Kioshima, R. Puccia, W. L. Batista, G. H. Goldman and J. D. Lopes o o Universidade Federal de Sa Paulo, Sa Paulo, Brazil Objectives: Paracoccidioides brasiliensis is a thermodimorphic fungus
that causes Paracocciodioidomycosis (PCM), human systemic granulomatous disease prevalent in Latin America. Most of the genes encoding and proteic sequences of relevant fungal antigens remain uncharacterized. P. brasiliensis produces some important antigens like gp43 which has been fully characterized, and a 70 kDa glycoprotein (gp70) recognized by 96% PCM patients sera. It has been shown that this puried antigen modulates murine peritoneal macrophages functions and that passive immunization of mice with specic antigp70 mAbs before fungal infection, signicantly inhibited lung granuloma formation. The purpose of this work was molecular cloning and characterization of the gene that encodes gp70 from P. brasiliensis followed by heterologous expression of the recombinant antigen to better understand the role of the gp70 in PCM. Methods: Using degenerated primers corresponding to peptides obtained by microsequencing from gp70, recognized and isolated with specic mAB (C5F11), a 384-bp DNA fragment was amplied from the P. brasiliensis genomic DNA (pbgp70). This fragment showed 97% of similarity with one of the Expressed Sequence Tags (ESTs) in P. brasiliensis EST databank. Specifc primers were synthetized attempting to obtain the sequence and amplifying the genomic and cDNA sequences corresponding to this EST. Using these specic primers, G2.154 pb products were obtained by PCR of the genomic DNA. These fragments were cloned and sequenced by primer walking. Results: In preliminary sequence analysis it was found the open reading frame in a 2154 pb fragment, without introns. Deduced amino acid sequence showed prevalence of hydrophilic regions which probably contains B-cell epitopes, one putative T-cell mouse epitope and high JamesonWolf Antigenic Index. BLAST analysis showed homology with putative proteins from the fungus Coccidioides immitis, Aspergillus fumigatus, Ajellomyces capsulatus, which are phylogenetically close to P. brasiliensis. Oligonucleotides were synthesized to achieve the heterologous expression of the partial cDNA. A 35 kDa recombinant protein was obtained and recognized by mAB C5F11. Polyclonal antibodies anti-gp70 recombinant protein, were rise in rabbits and these antibodies recognized the 70-kDa native protein in cellular extract from P. brasiliensis. Biological assays using the partial recombinant protein and polyclonal antibodies were carrying on. Conclusion: The 2.7 kb genomic DNA cloned sequence and the partial expressed sequence presents some predicted characteristics of the P. brasiliensis native gp70 and may represent the gene of the gp70 antigen.
P220
Multiplex PCR for the detection of fungemia and bacteriemia in the same run A. Kalkanci, M. Dizbay, A. Kalkanci, K. Hizel, K. Caglar, A. Fouad, D. Arman and S. Kustimur Gazi University, Ankara, Turkey Objectives: Fungi are emerging as important etiological agents of bloodstream infections as much as bacteria. We performed a multiplex Real Time PCR based methodology to determine an accurate diagnostic method for bloodstream infections. In the present study, detection of Aspergillus fumigatus, Candida albicans, Staphylococcus aureus and Escherichia coli were aimed. Methods: The specic multiplex PCR method used in this study targets one Gram-positive species Staphylococcus aureus, one Gramnegative species Escherichia coli, and two fungal species Aspergillus fumigatus and Candida albicans. The designed primers and probe sets were based on regions of identity within the 16S rRNA gene of bacteria. Fungal primers anneal within the ITS2 region. Primer ITS-R anneals to a highly conserved region of the 28S rRNA gene of fungi. For the detection and differentiation of Aspergillus species from Candida species, two different species-specic biprobes were designed. For in vitro testing, EDTA-anticoagulated blood was inoculated with S. aureus, E. coli, A. fumigatus and C. albicans. For in vivo testing, four rabbits were used as the animal model of sepsis. They were inoculated
95
with the microorganismas and on the fth day, the blood was collected. DNA was extracted from simulated blood samples as well as from blood samples of the rabbits. Results: The combination of a group-specic and a universal primers for bacteria and fungi in one reaction mixture facilitated rapid screening and species differentiation by the characteristic peak melting temperatures of the probes. Both assays performed either as single assays or simultaneously in the same LightCycler run. The analytical sensitivity using pure cultures and EDTA-anticoagulated blood was shown to be at least 10 CFU per PCR, corresponding to 10 100 CFU ml-1 blood. All of the simulated blood samples were found to be positive both for bacteria and fungi. A total of three rabbit samples were found to be positive. Conclusion: Our data suggest that our PCR method may be appropriate for use in clinical laboratories as simple and rapid screening tests for the most frequently encountered species causing bloodstream infections. Therefore, modern diagnostic tests for bacteremia and fungemia, including the multiplex PCR studied, deserve the attention of clinicians and laboratory specialists as well as further study in clinical settings.
P222
A simple and inexpensive method for genomic DNA extraction from fungi using Whatman FTA? Elute lter paper for conventional and real-time PCR assays R.L. Gorton1, T. A. Vyzantiadis2, S. Seaton1 and C. C. Kibbler1 1 The Royal Free NHS Trust, Hampstead, London, United Kingdom, 2 Aristotle University, Thessaloniki, Greece Objectives: DNA extraction using lter paper has become well
established and is suitable for conventional but not real time PCR protocols. Whatman FTA Elute paper offers a simplied method for the extraction of DNA from fungal cultures. The extracted DNA is eluted from the FTA matrix into sterile water. Our objective was to evaluate the FTA Elute papers ability to extract DNA from lamentous fungi and assess the performance of the DNA eluate with conventional and real-time PCR. Methods: A total of 75 moulds and 10 yeasts were collected from clinical samples, of which 70 moulds were sub-cultured in glucose/yeast/ peptone (GYP) broth and ve moulds and 10 yeasts were taken directly from Sabouraud agar. A pea-sized quantity of mycelium/yeast was freeze/thawed and ribolysed in molecular grade water and then applied to the FTA Elute card. To inactivate the fungal mass, the card was dried at 80 C for 20 min. Elution of the genomic DNA from a 3 mm punch of FTA Elute card into 50 ll of sterile water was achieved by heating at 95 C for 30 min. Elutions were performed at day 0, weeks 4 and 12 to evaluate the preservation of DNA on the paper. A pan-fungal ITS (internal transcribed spacer) rDNA PCR assay was used to amplify the eluted DNA and the amplicons were sequenced to conrm the phenotypic identication of each fungus. By converting the conventional ITS rDNA PCR the amplication of DNA from the eluate was evaluated with realtime PCR on the Corbett Rotor-Gene 6000, and high resolution melt (HRM) curve analysis was performed on the ITS rDNA amplicons. Results: The Whatman FTA Elute paper successfully extracted DNA from all the fungal cultures from GYP broth and Sabourauds agar including Candida spp, Aspergillus spp, Fusarium spp, Scedosporium spp, Acremonium spp and Zygomycetes (n = 85). Using a 3 mm punch of Whatman FTA Elute paper the quantity of DNA eluted ranged between 50 to 200 ng of DNA per punch. The ITS rDNA region was amplied from all the DNA extracts using the conventional PCR (n = 85) and all isolates were identied genotypically using the NCBI Blast Nucleotide database. Real-time PCR amplication of the ITS rDNA gene from the DNA elutions was successful. Furthermore the HRM analysis revealed a signicant difference in the melting temperatures of the ITS rDNA amplicons for the different fungal species (complete real-time data will be presented in the poster). Re-elution of the DNA at weeks 4 and 12 were successful and quantication using a NanoDrop ND-1000 showed no evidence of degradation of DNA over time. Conclusion: Whatman FTA Elute paper provides a simple, inexpensive and chemical free method of genomic DNA extraction from yeasts and moulds. The ability to elute DNA enables this extraction method to be used with real-time PCR assays in place of laborious and time-consuming post-PCR analysis for amplicon detection. The ability to archive the papers provides the user with an invaluable source of genomic DNA for future use.
P221
Molecular typing of clinical and environmental Aspergillus fumigatus isolates with random amplication of polymorphic DNA E. Sodja, T. Kavcic and T. Matos Institute of Microbiology and Immunology, Ljubljana, Slovenia Objectives: Aspergillus fumigatus is an opportunistic fungus responsible for invasive aspergillosis in immunocompromised people. In nature, this fungal species grows on decaying vegetation and releases large amounts of conidia in air. Patient infection is acquired upon inhalation of conidia. Since treatment of invasive aspergillosis is difcult and the outcome is often fatal, identication of infective strains and sources of infection is a major epidemiological concern in many studies of nosocomial aspergillosis. Techniques of molecular biology have been extensively used for typing A. fumigatus isolates. The most popular technique for molecular typing of A. fumigatus isolates is based on random amplication of polymorphic DNA (RAPD). Here we report genotyping analysis of clinical and environmental A. fumigatus strains to nd out if cases of aspergillosis in an individual patient were caused by hospital acquired strains of A. fumigatus. Methods: Three clinical and thirty-seven environmental isolates were included in this study. Clinical isolates of A. fumigatus were collected from patients with proven invasive aspergillosis of lung nursed in three departments of University Medical Centre Ljubljana, Slovenia: Department of Intensive Internal Medicine, Department of Anaesthetics and Surgical Intensive Care and Department of Nephrology. Environmental isolates were collected with air sampling method in patients rooms and shared areas of the departments. After extraction of DNA with PureLink Genomic DNA Mini Kit (Invitrogen, Carlsbad, USA), each A. fumigatus isolate was genotyped using RAPD analysis. The primer used for RAPD typing was R108. Results: RAPD analysis of environmental and clinical isolates of A. fumigatus allowed identication of thirteen distinct proles among 40 isolates. All three strains isolated from patients have distinct proles; two of them were isolated only from patients and not from the environment. One strain isolated from patient nursed in Department of Intensive Internal Medicine was found to be identical to environmental strains collected from air of hallway and room of Department of Nephrology. Some environmental strains with identical RAPD proles were collected from air of all three departments. Conclusions: Thirteen distinct proles were identied by RAPD analysis, indicating great genetic diversity of A. fumigatus strains isolated from infected patients and from their hospital environment. In one case, a genetic similarity was noted between isolate obtained from patient and isolates from the hospital environment.
P223
Investigation of fungal DNA presence on atherosclerotic plaques Z. F. Otag1, A. Kalkanci2, N. Sucu1, Ph.D Direkel1 and M. D. Ozden1 1 Mersin University, School of Medicine, Mersin, Turkey, 2School of Medicine, Gazi U, Ankara, Turkey Objectives: Several studies have been suggested to investigate the
trigger factors in the inammatory process of atherosclerosis in humans. A possible role of some microorganisms has been proposed in the pathogenesis of atherosclerosis, but it is still an unresolved issue. Chlamydia pneumoniae and Helicobacter pylori are among the most
96
commonly implicated microorganisms in the pathogenesis of atherosclerosis. But, we have limited data about the fungal signatures on the cardiovascular system. In the present study, the samples of human aortic wall and left internal mammary artery (LIMA) were examined for the presence of fungal DNA. Methods: Fungal DNA was analyzed by real-time polymerase chain reaction method in all biopsy samples. The specimens were obtained from 26 patients who underwent coronary artery bypass grafting. Biopsy samples were taken from proximal bypass punching areas of aorta (Group A), and from the LIMA which is accepted as resistant to the atherosclerosis (Group B). Primers and two probes bind to conserved regions of the fungal 18S rRNA gene. For amplicon detection, real-time PCR was performed with uorescence resonance energy transfer (FRET) hybridization probes using the Light Cycler DNA Master Hybridization Probes Kit and the Light Cycler instrument. Results: Fungal DNA was detected in 6 of 26 samples of group A (46.15%) and in 12 of 26 samples of Group(23.07%). Fungal DNA was found in eight samples of four patients in both tissues. Conclusion: Results demonstrate that fungal DNA could be detected in aortic wall and LIMA speciemens which do not support this hypothesis concerning the role of fungi in atherosclerosis etiology, but may be an independent risk factor in the pathophysiology of coronary hearth diseases. The overall presence of fungi in our natural environment, the permanent fungal colonization of human microbial communities and the contact with fungi through food components make it likely that fungi cross human barriers leading to temporary fungaemia in the cardiovascular system.
P226
Candidaemia: antifungal susceptibility and molecular typing proles of concomitant isolates from blood and other biological products E. Ricardo1, S.C.O. Costa de Oliveira1, A. P. Silva1, T. G. Goncalves2, C. Pina-Vaz1 and A.G.R.G. Rodrigues1 1 University of Porto, Porto, Portugal, 2Center for Neurosciences and Cell Biology, Coimbra, Portugal Objectives: Bloodstream fungal infections have increased worldwide
during the last two decades and are considered a serious public health problem. A prospective, observational study was conducted at a Portuguese University hospital, aiming to evaluate the susceptibility pattern of isolates from patients with bloodstream fungal infection and to determine the degree of similitude between distinct isolates of the same patient. Methods: Yeasts isolated from blood cultures (89) and from other body sites (40) of patients with fungaemia admitted at a university hospital of Porto were collected and identied with VITEK 2. Minimal Inhibitory Concentrations (MIC) to uconazole, posaconazole voriconazole, amphotericin B, Caspofungin and Anidulafungin were determined according to the protocol M27-A3 from the Clinical Laboratory for Standards Institute (CLSI). The strains were classied as S, R, susceptible-dose dependent (S-DD) or non susceptible accordingly the CLSI protocol. Sixty strains (C. albicans, C. glabrata and C. parapsilosis) isolated from blood cultures (40) and other biological products (20), from 16 patients were studied regarding the presence of different restriction patterns after restriction endonuclease analysis (REA) with HinfI enzyme. Restriction patterns were analyzed using the UVIDOC 12.6 software and compared among the distinct groups of strains. Results: From a total of 89 strains isolated from blood cultures during the rst fungaemia episode 43% corresponded to C. albicans, 26% to C. parapsilosis, 13% to C. glabrata and 7% to C. tropicalis. C. albicans (28%), C. parapsilosis (24%), C. glabrata (18%) and C. krusei (17%) were the most frequent yeasts isolated from other body sites. Regarding the susceptibility prole, 8% of C. albicans, 17% of C. parapsilosis, C. tropicalis and 58% of C. glabrata isolates were resistant to uconazole. Resistance to equinochandins was detected in 8% of C. glabrata and 22% of C. parapsilosis. Regarding molecular typing, the method did not provide satisfactory results for C. parapsilosis since the same pattern was obtained when comparing among different patients. For the other tested Candida species the results obtained among the different set of isolates for each patient were very heterogeneous. From one patient yielding C. albicans (n = 2) and C. parapsilosis n = (9) strains, isolated both from blood cultures and other biological products, the differences both in the restriction pattern and susceptibility prole were only found at a interspecies level. Conversely, the C. albicans strains isolated only from the blood cultures of two patients (three strains of each one), were all different within each patient; in one patient the susceptibility proles were similar but in the other major differences were registered. Conclusion: High resistance to azoles and equinochandins was observed. Differences in susceptibility pattern do not necessarily imply differences in restriction patterns, i.e. different strains. REA is a rapid and simple technique to be used for strains typing. This technique could be of value in the follow up of patients under antifungal prophylaxis protocols to clarify strains relatedness in the case of emergence of fungal infection. Acknowledgments: S Costa de Oliveira and A P Silva are supported by the grants SFRH/BD/27662/2006 and SFRH/BD/29540/ 2006, respectively, from Portuguese Science and Technology Foundation (FCT).
P224
Retrospective screening of 164 clinical isolates for C. orthopsilosis, C. metapsilosis, C. nivariensis and C. bracarensis M. Arabatzis1, K. Kollia1, D. Ioannides2, T. Koussidou3, D. Devliotou-Panagiotidou2 and A. Velegraki1 1 Mycology Laboratory, Medical School, University of Athens, Athens, Greece, 2Medical School, Aristotle University of Thessaloniki, Thessaloniki, Greece, 3Hospital for Skin and Venereal Diseases, National Health Service, Thessaloniki, Greece Objectives: Recent reports indicate that a minority of clinical
C. parapsilosis isolates should be correctly re-identied to discriminate C. orthopsilosis or C. metapsilosis. Similarly, a number of C. glabrata isolates resistant to antifungals are actually belonging to the new species C. nivariensis and C. bracarensis. As the clinical signicance and respective susceptibilities of these new species are unclear, C. parapsilosis and C. glabrata local isolates of the last 10 years were molecularly re-identied and their antifungal susceptibilities determined. Methods: Ninety C. orthopsilosis isolates from blood (n = 67), skin (5), mucosa (10), chest (3) and nail (5) infections, conventionally identied by the API 32C system, were re-identied by sequencing of the ITS and the sequences were deposited to the GenBank (www.ncbi.nlm.nih.gov). Seventy-four C. glabrata isolates from blood (n = 44), mucosa (22), chest (6) and peritoneal (2) infections were analysed by C. glabrata specic PCR. Voriconazole, posaconazole, itraconazole, amphotericin B, ucytosine, caspofungin, anidulafungin and micafungin MICs were recorded by the CLSI M27-A3 microdilution method. Results: Only one C. orthopsilosis isolate was recovered but no C. metapsilosis, C. nivariensis or C. bracarensis isolates. The C. orthopsilosis isolate, from a bloodstream infection, was resistant to uconazole. C. parapsilosis exhibited rare resistance (MIC > 64) to uconazole (13%) while 23% of the C. glabrata isolates were resistant. Conclusion: C. orthopsilosis comprise only a small fraction of the C. parapsilosis Greek isolates. More clinical yeast isolates have to be studied before drawing denite conclusions on the exact C. metapsilosis, C. nivariensis and C. bracarensis incidence, although predictably low. C. orthopsilosis resistance pattern to uconazole has to be studied more extensively.
97
P227
Expression of inammatory cytokines and receptors in human monocytes exposed to Aspergillus fumigatus hyphae, amphotericin B and amphotericin B lipid complex M. Simitsopoulou1, E. Georgiadou1, T. J. Walsh2 and E. Roilides1 1 Aristotle University of Thessaloniki, Thessaloniki, Greece, 2 National Cancer Institute, Bethesda, MD, USA Objectives: Innate immune response including monocytes (MNCs)
and various inammation-related cytokines is critical in the host defense against invasive aspergillosis. While antifungal agents such as deoxycholate amphotericin B (DAMB) and amphotericin B lipid complex (ABLC) have immunomodulatory effects on the function of phagocytes (Dotis et al. AAC 50:868, 2006), their effects on the expression of multiple genes mediating the innate immune response to A. fumigatus are yet to be resolved. In this study, we used a pathwayspecic microarray analysis to compare the effects of DAMB and ABLC on gene expression of immune molecules by MNCs exposed to A. fumigatus hyphae (AH). Methods: THP1 human monocytic cell line was used as MNC source. MNCs were grown in RPMI plus 10% fetal calf serum at 37 C/5% CO2. 106 ml-1 conidia were incubated at 37 C for 12 h to germinate to AH. MNCs were incubated with AH at effector:target ratio of 10 : 1, 1 lg ml-1 DAMB, 5 lg ml-1 ABLC or with the combinations AH+DAMB or AH+ABLC at 37 C/5% CO2 for 4 h. Total RNA (4 lg) was converted to cRNA, labelled with biotin-16-dUTP and then hybridized to 124 immobilized oligonucleotide probes. The labeled target bound at each gene-specic spot was detected using chemiluminescence (Oligo GEArrays, Superarray). The average of two actin gene tetraspots were used as positive controls. Changes in gene expression were calculated as ratios of those expressed by MNCs alone and to MNCs exposed to AH, DAMB, ABLC, AH+DAMB and AH+ABLC. A >2.5-fold change was considered significant. Results: Fourteen genes were up-regulated by AH while 21 and 20 genes were up-regulated by DAMB and DAMB+AH, respectively. In contrast, ve and nine genes only were up-regulated by ABLC and ABLC+AH treatments, respectively. The genes encoding MCP-1 and MIP-1-beta were up-regulated in response to AH, DAMB and AH+DAMB. IL1B was overexpressed after all treatments. The least number of over-expressed genes was observed by MNCs stimulated with ABLC alone. A greater number of inammatory cytokines and receptor superfamilies, including IL12A, IL12B, IL17A, IFNA, IL2RB, IL10RA, LTB4R and TOLLIP, were enhanced in response to DAMB+AH than to DAMB or AH alone. Expression of genes encoding IL13, IL18, IL2, and IL3 were signicantly decreased in response to AH and DAMB alone while MIF and TNFRSF1A were signicantly decreased in response to ABLC. When MNCs were treated with AH, up-regulation of a cluster of chemokines was favoured while a cluster of interleukins was down-regulated. This prole expression was reversed when MNCs were incubated with DAMB+AH. Conclusion: AH induce mostly chemotactic factors and complement components for monocyte recruitment. While ABLC with or without AH causes mild gene expression, DAMB and DAMB+AH treatments induce a more pronounced mRNA prole of inammatory gene expression in MNCs indicating different immunomodulatory effects of the amphotericin B formulations.
Innate host immune response against C. albicans (CA), a major component of which are mononuclear phagocytes (MNCs), is a critical factor of host defense against CA. Little is known about the immunomodulatory effects of antifungal agents such as deoxycholate amphotericin B (DAMB) and amphotericin B lipid complex (ABLC) on the expression proles of multiple genes mediating the innate immune response to CA. In this study, we used pathway-specic microarray analysis to compare the effects of DAMB and ABLC on prole gene expression of immune molecules by MNCs exposed to CA. Methods: THP1 human monocytic cell line was used as MNC source. MNCs were grown in RPMI plus 10% fetal calf serum at 37 C/5% CO2. 106 ml-1 MNCs were incubated with 105 CA blastoconidia, 1 lg ml-1 DAMB, 5 lg ml-1 ABLC or with the combinations CA+DAMB or CA+ABLC at 37 C/5% CO2 for 4 h. Total RNA (4 lg) was converted to cRNA, labelled with biotin-16-dUTP and then hybridized to 124 immobilized oligonucleotide probes of human immune response-related cytokines, chemokines and their receptors. The labeled target bound at each gene-specic spot was detected using chemiluminescence (Oligo GEArrays, Superarray). The average of two actin gene tetraspots were used as positive controls. Changes in gene expression were calculated as a ratio of those expressed by MNCs alone and to MNCs exposed to CA, DAMB, ABLC, CA+DAMB and CA+ABLC. A >2.5-fold change was considered signicant. Results: Seventeen genes were up-regulated by CA while 25 and 6 genes were up-regulated by DAMB and CA+DAMB, respectively. In contrast, 5 and 21 genes were up-regulated by ABLC and CA+ABLC treatments, respectively. A greater number of proinammatory cytokines, chemokines and their receptors were down-regulated in response to DAMB and CA alone than against ABLC alone, CA+DAMB or CA+ABLC. The genes encoding MIP-1-alpha, MIP-1-beta, MCP-1, TNF, IL10RA, IL10RB and IL8 were up-regulated in response to both CA and DAMB. ABLC up-regulated only genes corresponding to chemokines. Exposure of MNCs to CA+ABLC resulted in signicant expression of CCR7-9, IL10, IL10RB, IL11 IL11RA, IL11RB1 and IL11RB2 genes. Expression of genes encoding IL16 and IL3 were signicantly decreased in response to CA, DAMB and ABLC alone, while TOLLIP, IL1R1 and IL2RB were signicantly decreased in response to CA and CA+ABLC. Conclusion: DAMB treatment induces a more pronounced mRNA prole of gene expression in MNCs, followed by CA and CA+ABLC than that observed with ABLC and CA+DAMB. Furthermore, by signicantly enhancing expression of TNF-alpha and IL8 in response to both CA and DAMB alone, MNCs maintain pro-inammatory immune functions. In contrast, ABLC- and CA+ABLC-treated MNCs show a shift from a Th1 to a Th2 immune response.
P229
One-Enzyme PCR-RFLP Assay for differentiation of Candida nivariensis and Candida glabrata J. Alcoba-Florez, I. Hernandez, E. Perez-Roth and S. Mendez-Alvarez University Hospital Ntra. Sra. de Candelaria, Santa Cruz de Tenerif, Spain Introduction: Candida nivariensis is a novel Candida spp. rst described as a distinct taxon in 2006. Identication of Candida nivariensis still remains a problem in routine laboratories due to the high degree of phenotypic similarity between this species and Candida glabrata. Phenotype-based methods do not give completely reliable results. Hence, genotypic methods have been used to differentiate between these two species. The use of quick and reliable yeast identication methods, as well as the development of new antifungal agents with more specic targets, will enable a more efcient treatment of mycoses. Objective: The aim of this study is to use a single-enzyme PCRrestriction fragment length polymorphism(RFLP) technique for differentiation between C. nivariensis and C. glabrata. Materials and methods: In the present work, a total of 50 clinical isolates belonging to C. nivariensis and C. glabrata were identied by
P228
Comparison of the effects of deoxycholate amphotericin B and amphotericin B lipid complex on the gene exression of inammatory cytokines and receptors in human monocytes exposed to Candida albicans M. Simitsopoulou1, E. Georgiadou1, T. J. Walsh2 and E. Roilides1 1 Aristotle University of Thessaloniki, Thessaloniki, Greece, 2 National Cancer Institute, Bethesda, MD, USA Objectives: Candida albicans is a frequent opportunistic fungus that
can cause invasive candidiasis in immunocompromised patients.
98
means of a rapid molecular method, PCR-RFLP. C. glabrata ATCC90030 was tested as quality control isolate. Primers were selected to allow the amplication of ITS1-5.8S-ITS2 and 25S ribosomal DNA regions in both species. After amplication and purication of products, they were treated with species-specic restriction enzymes (Hinf I and SI). Digestion was performed by the incubation of 20 ll aliquots of PCR products with 10 U of enzymes in a nal reaction volumen of 25 ll at different temperatures for 2.5 h. Restriction fragments were separated by 2% agarose gel electrophoresis in TBE buffer for 1 h at 100V, and the samples were stained with ethidium bromide. Results: DNA sequencing of the ITS region and the D1/D2 regions of the 28S rRNA gene conrmed the species-specic identication of C. nivariensis and C. glabrata strains. The amplied ITS region of C. nivariensis and C. glabrata were digested twice using the enzyme Hinf I, but the length of them, were different. If we used the enzyme S I all of the isolates remained intact. Conclusions: (i) The amplicon length of the intergenic spacer (ITS) was species-specic, and PCR-RFLP analyses region identied two distinct species, which corresponded with the ITS region sequence data. (ii) The enzyme investigated (Hinf I) demonstrated genetic diversity between the two species. (iii) It can be concluded that PCRRFLP method may be used for the differentiation of C. nivariensis and C. glabrata isolates in clinical samples.
ranged from 0.25 to 2.0 and 12 mg L-1 for E. jeanselmei and E. oligosperma, respectively. ITC (MIC50 0.125 mg L-1) and POS (MIC50 0.031 mg L-1) showed potent activity against all E. jeanselmei isolates.VOR and ISA had lower activity with an MIC50 (1 and 2 mg L-1) against E. jeanselmei and MIC50 (both 1 mg L-1) against E. oligosperma. With regard to the echinocandins, CAS had no activity against both E. jeanselmei and E. oligosperma (MIC50 4 mg L-1), whereas ANI demonstrated potential activity (MIC50 0.5 mg L-1). Discussion: Considerable sequence differences were found among the 17 selected isolates with nine strains conrmed as E. jeanselmei originating from mycetoma or subcutaneous phaeohyphomycosis. Strains with an identity of 99% with the ex-type strain of E. jeanselmei appeared to be very consistent in their clinical spectrum. Although different antifungal agents have been used in the treatment of mycetoma, in this study POS and ITC exhibited the highest antifungal activity against E. jeanselmei and E. oligosperma. Both species had high MICs for CAS. Clinical effectiveness of these compounds in the treatment of Exophiala infections remain to be determined.
P231
Induction of apoptosis by Paracoccidioides brasiliensis correlate with pulmonary infection prole J. F. Julhiany de Fatima da Silva1, A. Del Vecchio1, G. Bernard2 and M.J.S. Mendes Giannini1 1 o FCFAR UNESP, Araraquara-SP, Brazil, 2USP, Sa Paulo SP, Brazil
The programmed cell death is regulated by extracellular signals, which can activate or inhibited the apoptosis. These signal molecules act mainly regulating the levels or activity of Bcl-2 family members. In mammals, apoptosis can be directed by the activation of groups of proteases called caspases, which cleave specic substrates. P. brasiliensis (Pb) yeast cells can enter in various cells types and probably manipulate the host cell environment to favor their own growth and survival. The succession of events that may occur with P. brasiliensis would be fungal adhesion, translocation to the cell cytoplasm, multiplication and the induction of apoptosis. The correlation with pathogenic mechanisms in vivo could elucidate the initial steps of the infection. The phenomenon of apoptosis was described in several studies with P. brasiliensis and the ability of pathogens to induce apoptosis of phagocytes might be an important virulence factor, for it would curtail the hosts defense mechanisms. P. brasiliensis and other fungi can exploit apoptosis to their own advantage, and their intracellular residence in epithelial cells could potentially elicit this type of cell death response. The invasion mechanisms of the host cells, persistence within them and subsequent induction of apoptosis may explain the spread ability of P. brasiliensis, however, the apoptotic mechanisms operating in alveolar epithelial cells remain largely unexplored. Then, we investigated whether the pattern of infection to epithelial cells could be associated with the apoptosis induction. For this investigation, we treated human A549 cells with the different isolates of P. brasiliensis and puried adhesins of this fungal (30 kDa and gp43) in vitro and explore the expression of different pathways of apoptosis induction in these cells. Then, we analyzed the expressions of Bcl-2, Bak, caspase 3, caspase 8, caspase 9 and DNA fragmentation by ow citometry and TUNEL technique, respectively. It was found that the apoptosis of human A549 cells could be induced by P. brasiliensis in a isolate and time-dependent manner. Our data demonstrated that caspase-3, Bak, Bcl-2 and DNA fragmentation mediating P. brasiliensis-induced pulmonary cell apoptosis and the overall mechanism is a complex process, which may involve a variety of signal transduction pathways. These ndings could explain the efcient behavior of this fungal to promote tissue infection and/or blood dissemination. Supported by FAPESP, CNPq and CAPES.
P230
The clinically important black yeast, Exophiala jeanselmei and its in vitro antifungal susceptibility H. Badali1, M. J. Najafzadeh1, V. Vanesbroeck2, E. Van den Enden2, J. F. Meis3 and G. S. De Hoog1 1 CBS-KNAW Fungal biodiversity Centre, Utrecht, The Netherlands, 2 Institute of Tropical Medicine, Antwerp, Belgium, 3Canisius Wilhelmina, Nijmegen, The Netherlands Introduction: Mycetoma is a localized, chronic, suppurative subcutaneous infection of tissue and contiguous bone after a traumatic inoculation of the causative organism. Exophiala jeanselmei is clinically redened as a rare agent of subcutaneous lesions of traumatic origin, eventually causing eumycetoma. The species has been described as being common in the environment, but with molecular methods only clinical strains were conrmed. Current diagnostics of E. jeanselmei is by using sequence data of the Internal Transcribed Spacer region of ribosomal DNA, which reects the taxonomy of this group sufciently. The rst purpose of this study is the re-identication of all strains maintained under the name E. jeanselmei, and to establish clinical preference of the species in its restricted sense. Given the high incidence of eumycetoma in endemic areas, the second goal of this study is evaluation of in vitro susceptibility of eight antifungal drugs against E. jeanselmei. Materials and methods: E. jeanselmei strains (n = 17) were obtained from the CBS Fungal Biodiversity Centre. The identication of 17 strains was veried with sequences of the internal transcriber spacer regions (ITS) of the rDNA. MICs were determined for amphotericin B (AmB), uconazole (FLU), itraconazole (ITC), voriconazole (VOR), posaconazole (POS), isavuconazole (ISA) or MECs for caspofungin (CAS) and anidulafungin (ANI). Microdilution testing was done in accordance with CLSI M38-A2 guidelines adjusted spectrophotometrically at 530 nm wavelength to optical densities that ranged from 0.17 to 0.15 in RPMI 1640 MOPS broth with Lglutamine without bicarbonate. Microtitre plates were incubated at 35 C for 96 h. Results: Nine out of 17 strains showed 98% similarity with ex-type strain of E. jeanselmei isolated from a true mycetoma-like infection. Five strains were re-identied as E. oligosperma, and single isolates were others. Strains conrmed to be E. jeanselmei all originated from subcutaneous infections, whereas strains originating from environmental samples like soil, wood or from clinical relevant sites were considered to belong to E. oligosperma and E. xenobiotica. AmB MICs
99
P232
Genotypic diversity of Cryptococcus neoformans var. grubii isolates from central to west London as determined by MLVA typing C.H. Klaassen1, M. A. Petrou2 and J. F. Meis1 1 Canisius Wilhelmina Hospital, Nijmegen, The Netherlands, 2 Imperial College Healthcare NHS Trust, London, United Kingdom Objectives: Cryptococcus neoformans complex consists of C. neoformans var. grubii, C. neoformans var. neoformans and C. gattii. Unlike C. gattii which is a true pathogen, the opportunistic C. neoformans var. grubii is most often found in immunocompromized patients. Relatively little research has been done to determine the intraspecic genotypic diversity of C. neoformans var. grubii. We used MLVA typing to determine the genotypic diversity of C. neoformans var. grubii isolates from clinical samples in patients from central to west London. Materials and methods: A total of 156 clinical isolates from 99 patients collected in the period of 19892001 were included in the analysis. DNA was isolated from freshly grown cells using a MagNA Lyser/MagNA Pure protocol. MLVA typing was performed using a previously reported panel of nine species specic microsatellite markers. Amplication products were analyzed on a MegaBACE 500 using established procedures. Data was analyzed using the multistate categorical similarity coefcient. Clonal complexes were assigned to groups of a minimum of two genotypes that differed by a maximum of three markers. Results: One hundred and forty eight Isolates yielded 82 different genotypes. These segregated over 10 clonal complexes. Eight Isolates yielded no amplication products for any of the MLVA markers indicative of misidentied isolates. Conclusions: A large variety of genotypes exists in C. neoformans var. grubii from the central to west London area. MLVA typing is an excellent typing method to discriminate between C. neoformans var. grubii from various origins
genotypically very heterogeneous isolates that represent multiple different and possibly novel Candida species.
P241
Pelvic mucormycosis refractory to amphotericin-B in a young woman with good response to posoconazole F. Abbasi, M. Mardani and S. Korooni Fardkhani Shaheed Beheshti Medical University, Tehran, Iran Background: Mucormycosis is an aggressive fungal disease that
involves the paranasal sinuses, orbit, central nervous system and other organs. It may rapidly be fatal. This infection usually occurs secondary to immune suppression, diabetic ketoacidosis, and prolonged use of antibiotics, steroids, and cytotoxic drugs. Management of the condition consists of treatment of the underlying disease and surgical debridement combined with intravenous antifungal agents. Patients: The patient was a young woman with fever after cesarean section. CT scan Evaluation showed a large mass in pelvic area. With diagnosis of malignancy the mass excised and the large black mass was sent to pathology department. Report of pathology showed fungal element in the mass. The mass re-evaluated and hyphae of mucor was detected. Result of culture was positive for mucoral. Amphotericin-B was started with no response. Posoconazole started and the patient improved clinically. Conclusion: Mocurmycosis should be in mind and considered in every patient with pelvic mass specially if background of immunesuppression exist. Resistant to amphotericin-B is inceasing in mucoral agents. Keywords: Mucormycosis, pelvic, amphitericin-B, posoconazole
P242 P233
Genotypic diversity segregates Candida pelliculosa isolates into distinct subgroups C.H. Klaassen, E. Geertsen, I. Curfs-Breuker, J. W. Mouton and J. F. Meis Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Objective: Candida pelliculosa is frequently reported as the cause of
candidaemia. Differences in the susceptibility proles of clinical isolates that were routinely identied as C. pelliculosa prompted us to study these isolates in more detail. AFLP analysis has been shown to be a very powerful method to differentiate between Candida species. We applied AFLP analysis to isolates routinely identied as C. pelliculosa. Materials and methods: Twelve clinical isolates from sterile sites were included in the analysis. Routine identication was performed using the API ID 32C System. Susceptibility testing was performed for amphotericin B, uconazole, itraconazole, voriconazole, posaconazole, caspofungin, anidulafungin and micafungin according to EUCAST produres. DNA was isolated from freshly grown cells using a MagNA Lyser/MagNA Pure protocol. AFLP typing was performed using a combination of restriction enzymes HpyCH4IV and MseI. Reference isolates for the 22 most common Candida spp. were included in the analysis. Results: The 12 isolates were grouped into six clusters with very different ngerprint patterns. Only two isolates clustered together with the C. pelliculosa reference strain (CBS 605). Two isolates coclustered with C. guilliermondii (CBS 566) and C. pseudotropicalis (C. kefyr) (CBS 607), respectively. The remaining eight isolates segregated over three groups. This segregation was supported by the susceptibility proles. None of the three non-pelliculosa groups represented any of the other reference strains that were included. Conclusion: Routine methods fail to accurately identify C. pelliculosa isolates. Isolates fenotypically identied as C. pelliculosa may consist of
In vitro photodynamic inactivation of Candida spp. using phthalocyanines L. Ryskova1, V. Buchta1, M. Karaskova2 and J. Rakusan2 1 University Hospital, Hradec Kralove, Czech Republic, 2Research Institute for Organic Syntheses, JSC, Pardubice, Czech Republic Background: Phthalocyanines (Pc) represent a potential group of
photosensitisers, which have been proven to have a signicant antibacterial effect in photodynamic therapy (PDT). The aim of this paper is to evaluate the antifungal effect of fteen Pc derivatives. Methods: Fifteen different Pc (with anionic, cationic and amphiphilic structure) were investigated. Their photokilling activity was tested on Candida albicans strains and some of them also against Candida glabrata and Candida krusei. After treating yeast cells with Pc in the following concentrations: 1, 2, 4, 8 mg L-1 for 30 min, the cultures were irradiated with low-power laser light (20 J cm2, 40 J cm2). The effectiveness of photoinactivation was evaluated based on decrease of a number (log10) of viable yeasts in the tested and control samples (without Pc and irradiation). Results: Only two Pc showed some antifungal effect on C. albicans. More effective was tetramethylenepyridinium chloride of hydroxyaluminum PcPc1 (six logs decrease of viable cells). Sulphonated zinc Pc [(3-diethylammonium)-propylsulphonamide Pc2 inactivated cells in tested culture by four logs. The results of the antifungal testing of Pc against C. glabrata and C. krusei were similar. Conclusion: The most efcient phthalocyanines tested caused a signicant decrease of viable counts of C. albicans, C. glabrata and C. krusei and represent promising drugs for potential use in the PDT of fungal infections. Acknowledgement: The study was supported by the grant No.2B06104 of the National Research Program of the Ministry of Education, Czech Republic.
100
P243
In vitro fungicidal activity of dihydroxyacetone against Candida sp M.L. Scroferneker, D. O. Stopiglia, G. Mondadori, J. Vieira and P. Oppe Institute of Basic and Health Sciences, Porto Alegre, Brazil
Candida albicans is a yeast found in human endogenous microbiota which may eventually become pathogenic. It is the most frequent opportunistic pathogen in patients on prolonged use of broad-spectrum antibiotics or of feeding tubes, with autoimmune diseases, and in those who underwent organ transplantation or received prosthetic implants. The pathogenic behavior of Candida is primarily assigned to its great phenotypic diversity. Acquired invasive properties associated with changes in the hosts immune system promote the opportunistic behavior of this yeast, which may then become pathologically important. Clinical studies have demonstrated that any change in the hosts immunological status may facilitate the proliferation of this saprophyte and that, according to the level of immunodepression, infection may range from benign mucocutaneous candidiasis to systemic, usually fatal, invasion. Together with the virulence of Candida sp., these characteristics have justied studies about its pathophysiology and improved treatment strategies. Dihydroxyacetone (1,3-dihydroxy-2-propanone) is a monosaccharide used in articial suntan lotions for the human skin. In addition to its cosmetic use, there are reports of its use in the treatment of psoriasis, vitiligo and piebaldism. The site of action of this substance is the interface between the stratum corneum and the granular layers of the skin. Objective: this study described the in vitro antifungal activity of DHA against Candida sp. Methods: The minimum inhibitory concentrations (MIC) were determined using the Clinical Laboratory Standards Institute (CLSI) M27-A2 broth microdilution method. Nystatin was the standard antifungal agent. The minimum fungicidal concentration (MFC) was determined by transferring 100 ll from the well that showed 100% growth inhibition in the microdilution method into tubes with 2 ml of Sabouraud dextrose broth medium. The tubes were incubated for 3 days at 35 C and the MFC was determined as the lowest concentration at which fungal growth was inhibited. Results: The concentrations at which the substance had antifungal properties ranged from 0.625% to 5%, and fungicidal activity, from 2.5% to 10%, whereas the usual DHA concentration in cosmetic articial suntan lotions is 35%. Conclusion: DHA seems to be a promising substance for the treatment of candidiasis because it has antifungal properties at the concentration used in articial suntan lotions. Therefore, it is a potential low-toxicity antifungal agent that may be used as a topical fungicidal agent because of its penetration into the corneal layers of the skin.
polymer. To overcome this problem a functionalized quaternary ammonium compound, [2-(methacryloyloxy) ethyl]trimethylammonium chloride (MADQUAT), which copolymerizes with methacrylates and could act as a fungal inhibitor, must be investigated. Objective: This study described the in vitro antifungal activity of MADQUAT against Candida sp. Methods: The minimum inhibitory concentrations (MIC) were determined using the Clinical Laboratory Standards Institute (CLSI) M27-A2 broth microdilution method. Nystatin was the standard antifungal agent. The minimum fungicidal concentration (MFC) was determined by transferring 100 ll from the well that showed 100% growth inhibition in the microdilution method into tubes with 2 ml of Sabouraud dextrose broth medium. The tubes were incubated for 3 days at 35 C and the MFC was determined as the lowest concentration at which fungal growth was inhibited. Results: The concentrations at which MADQUAT had antifungal properties ranged from 0.00625 to 0.1 g ml-1, and fungicidal activity, from 0.025 g ml-1 to >0.1 g ml-1, whereas nystatin showed antifungal activity between 1 and 4 lg ml-1 and fungicidal activity between 2 and 8 lg ml-1. Conclusion: Therefore, MADQUAT is a promising antifungal agent that can be used in acrylic resins, as its antifungal activity may be due to the presence of a much higher concentration, which is likely to prevent the proliferation of Candida on the surfaces of prosthetic devices, barely interfering with the patients normal microbiota.
P245
Antifungal activity of the phenolic essential oil of Thymus viciosoi L.A. Vale-Silva1, E. Pinto1, M. J. Goncalves2, C. Cavaleiro2 and L. Salgueiro2 1 Universidade do Porto, Porto, Portugal, 2Universidade de Coimbra, Coimbra, Portugal Objectives: The genus Thymus (Lamiaceae) is a complex group of
aromatic plants widely distributed across the Iberian Peninsula. Several species have traditionally been used as medicinal plants, namely for their antiseptic properties (1). In this context, the objectives of the present work were to investigate the composition of the essential oil (EO) of Thymus x viciosoi and its antifungal activity on a range of representative human pathogenic Candida species. Methods: The EO of T.x viciosoi was obtained from the owering parts of the plants by hydrodistillation and analysed by gas-chromatography and gas-chromatography/mass spectroscopy. The antifungal activity was evaluated against several strains from seven Candida spp. (C. albicans, C. glabrata, C. parapsilosis, C. krusei, C. tropicalis, C. dubliniensis, and C. guilliermondii) using the reference CLSI (formerly NCCLS) broth macrodilution protocol M27-A3 (2). Minimum fungicidal concentrations (MFCs) were the lowest concentrations showing no growth after incubation of 20-ll samples from clear tubes in the macrodilution test in Sabouraud dextrose agar at 35 C. Results: The oil showed high percentages of phenolic monoterpenes, thymol (18.0%) and carvacrol (30.0%), and their biogenetic precursors, c-terpinene (7.5%) and p-cymene (19.0%). Minimum inhibitory concentrations (MICs) of the EO and its major components, carvacrol and thymol, were quite low, ranging from 0.08 to 0.32 ll ml-1. For p-cymene, on the other hand, a markedly lower activity was found. Furthermore, the EO, thymol, and carvacrol displayed a clear fungicidal activity, with MFCs equal to or just one dilution above the respective MICs, including against isolates with decreased susceptibility to commercial antimycotic drugs. Conclusions: This work revealed a powerful antifungal activity of the EO of T.x viciosoi against Candida spp., in line with previously reported results for related Thymus oils (3), thereby supporting further, more in depth, in vitro studies, as well as the potential of the EO of T.x viciosoi for the clinical management of mucocutaneous candidiasis. The authors acknowledge the Fundacao para a Ciencia e Tecnologia (FCT) and FEDER for nancial support through the research project POCI/ QUI/59407/2004 and FCT for the post-doc grant attributed to L. A. Vale-Silva (SFRH/BPD/29112/2006).
P244
In vitro antifungal activity of [2-(methacryloyloxy)ethyl]trimethylammonium chloride against Candida sp. M. L. Scroferneker1, D. O. Stopiglia2, M. Collares2, A. Ogliari2, J. Vieira1, G. Mondadori1, B.B. Fortes2 and M. W. Samuel2 1 Institute of Basic and Health Sciences, Porto Alegre, Brazil, 2 School of Dentistry, Porto Alegre, Brazil
Candida-associated denture stomatitis is the most common form of oral candidal infection, of which Candida albicans is the principal etiologic agent. Candida adheres directly or via an intermediate layer of plaqueforming bacteria to the acrylic resin (polymethylmethacrylate) on the denture. Although denture stomatitis is treated with antifungal therapy, infection recurs soon after treatment completion, suggesting that denture plaque may serve as a protected reservoir for C. albicans. Several antifungal substances have been incorporated into dentures acrylic resin in order to avoid Candida proliferation on the surfaces of the prosthetic device, such as chlorhexidine, cetylpyridinium chloride and other quaternary ammonium compounds. However, incorporation of these substances into acrylic resin leads to long-term acrylic denture degradation due to the leaching of components from the bulk of the
101
References
1. Figueiredo AC, Barroso JG, Pedro LG et al. Curr Pharm Des 2008; 14(29): 31203140. 2. Clinical and Laboratory Standards Institute. Approved standardthird edition M27-A3, Wayne, PA, USA, 2008. 3. Pina-Vaz C, Rodrigues AG, Pinto E et al. J Eur Acad Dermatol Venereol. 2004; 18(1): 7378.
P246
Inhibition of Sporothrix schenckii isolates by killer yeast M.L. Scroferneker, D. O. Stopiglia, F. Landell, J.M.S. Sorrentino, H. D. Heidrich, J. Vieira, K. L. Kammler, G. Mondadori, I. A. Reis, M. Madagnin and V. P. Valente Institute of Basic and Health Sciences, Porto Alegre, Brazil
The dimorphic fungus Sporothrix schenckii is the etiologic agent of sporotrichosis, a widely distributed mycosis. It is the subcutaneous mycosis with the highest incidence in the state of Rio Grande do Sul, Brazil. A saturated solution of potassium iodide is used as a therapy for localized sporothrichosis. Other drugs commonly used are itraconazole (ITC) for the treatment of lymphocutaneous infections and amphotericin B (AMB) for severe infections or when ITC therapy fails. Although these drugs are generally effective, the long duration of therapy and the toxicity of AMB make it necessary to explore new alternatives for the treatment of severe infections. Some yeasts possess antagonistic property (killer activity) toward moulds and other yeasts by producing killer toxins. This property has been exploited against several pathogenic and phytopathogenic fungi, showing activity compared to the conventional antifungal azole. Objective: In the present study we have veried the action of 20 killer yeasts, isolated from cheese and milk, against 53 Sporothrix schenckii clinical and environmental isolates. Methods: Strains of S. schenckii were subcultured onto potato dextrose agar at 25 C for 7 days. Conidial suspensions were prepared in sterile saline solution. The standard suspensions were adjusted by spectrophotometry to show transmittance at 530 nm of 8082%. Aliquots of 1 ml of these conidial suspensions were spread into Petri dishes containing cheese black starch agar (Minas cheese 33%, glucose 2%, peptone 1%, agar 1.5% and black starch 0.003%). Killer yeasts were point-inoculated over the S. schenckii inoculum and incubated at 25 C for 4 days. The killer activity was considered positive if there was an evident zone of inhibition of the fungus around the inoculum of the killer yeast. Results: All S. schenckii strains were inhibited by at least 11 killer yeasts, 96% were inhibited by more than 13 yeasts and 45% by more than 15 yeasts. T. japonicum (QU139), K. lactis (QU30, QU73 and QU99), T. insectorum (QU89), T. faecale (QU100) and K. marxianus (QU103) inhibited all the S. schenckii isolates. Conclusion: Killer yeasts seem promising as a source of new antifungal agents aimed at controlling Sporothrix schenckii.
temperature of 8085 C for 10 min following a centrifugation at 3000 rpm for 10 min, and then the tea extraction was ltered by 0.8 mM lter. Antifungal activity of the tea extractions and EGCG were determined by the EUCAST antifungal MIC method (two fold dilutions, nal tea extract concentration range 5.00.039 mg ml-1) using uconazole as comparator. Results: All 23 tested teas exhibited potent antifungal activity against C. glabrata (MIC range: 0.31250.078 mg ml-1). Six out of nine green teas and three out of eight black teas had MIC of 0.078 mg of tea ml-1, one white tea had MIC of 0.156 mg of tea ml-1, and nally three out of ve oolong teas had MIC against of 0.156 mg of tea ml-1. Three of the 23 teas exhibited activity against C. albicans (one green tea, one black tea, and one oolong tea, MIC against 1.25 mg of tea ml-1). One green tea had MIC against C. parapsilosis of 1.25 mg of tea ml-1. None of the tested teas had effect on C. krusei, C. tropicalis, and A. fumigatus at the concentrations tested. EGCG had MIC against C. glabrata of 0.3125 mg tea ml-1, and MIC against C. albicans and C. parapsilosis of 5.0 mg ml-1. When the pH of the culture medium increased to 7.20, the antifungal effect of the teas was increased. For example, four tested teas had MIC against C. glabrata < 0.039 mg of tea ml-1 at pH 7.20.
P247
In vitro activity of twenty-three tea extractions and epigallocatechin gallate against Candida glabrata M. Chen1, L. Zhai1 and M. C. Arendrup2 1 Rigshospitalet, Copenhagen, Denmark, 2Statens Serum Institut, Copenhagen, Denmark Objectives: The purpose of this study was to investigate the
susceptibility of Candida albicans, C. glabrata, C. krusei, C. tropicalis, C. parapsilosis, and Aspergillus fumigatus to different groups of tea and epigallocatechin gallate (EGCG) isolated from green tea. Methods: Twenty teas belonging to four different groups (green, black, oolong, and white teas) were purchased from China and three teas (green and black teas) were purchased in Denmark. Stock concentrations of tea extract was prepared as follows: 1 g of tea were incubated with 10 ml of boiled water (100 mg of tea ml-1) at
Conclusion: The results demonstrate that the four different groups of teas and EGCG isolated from green tea have in vitro antifungal activity against C. glabrata and some teas have more potent activity than others. Several teas exhibited also in vitro antifungal activity against C. albicans and C. parapsilosis although higher concentrations than those against C. glabrata were needed. These data indicate that components of tea and EGCG might be useful particularly for the treatment of C. glabrata infections and warrants further investigations.
P248
Antifungal activity of isavuconazole and 7 other drugs against Cladophialophora spp., related to chromoblastomycosis H. Badali1, G. S. De Hoog1, I. Curfs-Breuker2 and J. F. Meis2 1 CBS-KNAW Fungal biodiversity Centre, Utrecht, The Netherlands, 2 Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Introduction: Cladophialophora is a genus of black yeast-like fungi
which are frequently encountered in human infections, ranging from
102
mild cutaneous lesions to fatal encephalitis. The genus includes species causing chromoblastomycosis and other skin infections, as well as disseminated and cerebral infections, often in immunocompetent individuals. The type species of Cladophialophora, C. carrionii, is an agent of chromoblastomycosis, histologically characterized by muriform cells in skin tissue. In addition C. samoensis was recently described as a new agent of chromoblastomycosis. Limited standard therapy is available and disease always requires extensive surgical excision coupled with intense antifungal therapy to achieve cure for a long period. Therefore, the purpose of this study was to evaluate the in vitro activity of eight existing and new antifungal drugs against clinical and environmental strains. Methods: The collection has been obtained from the CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands and consisted of the following isolates: 40 strains of C. carrionii and one isolate of C. samoensis. MICs were determined for amphotericin B (AmB), uconazole (FLU), itraconazole (ITC), voriconazole (VOR), posaconazole (POS), isavuconazole (ISA), caspofungin (CAS) and anidulafungin (ANI). Susceptibility testing was done in accordance with CLSI M38-A2 guidelines adjusted spectrophotometrically at a 530 nm wavelength to optical densities that ranged from (6871 T %) in RPMI 1640 MOPS broth with L-glutamine without bicarbonate. Plates were incubated at 35 C for 72 h (insufcient growth was incubated at 96 h). The MIC was determined visually as the lowest concentration of drug showing absence of growth or 50% reduction of growth (for uconazole) compared with that of the growth control. For the echinocandins the MEC was microscopically determined as the lowest concentration of drug that leads to the growth of small, rounded, compact hyphal forms as compared with the long, unbranched hyphal clusters that were seen in the growth control (drug free). The concentrations of AmB, ITC, VOR, and POS ranged 0.01616 mg L-1, ISA, ANI and CAS ranged 0.008 8 mg L-1, and FLU ranged from 0.063 to 64 mg L-1 Drug and fungus free controls were included. Quality control was ensured by including Paecilomyces variotii (ATCC 22319), Candida parapsilosis (ATCC 22019), and Candida krusei ATCC 6258. Results: C. carrionii isolates (n = 40) gave MIC ranges and MIC50 and MIC90 values (mg L-1): Overall, the triazoles ITC, VOR, POS and ISA were active in vitro against these isolates. AmB and the echinocandins demonstrated high MICs. The single C. samoensis isolate gave MICs ITC (0.25 mg L-1) and MICs POS (0.125 mg L-1) for C. samoensis were higher than C. carrionii.
fungal action and avoiding amphotericin B interaction with human cells resulting in toxicity minimization. Results: Animal experiments revealed that FUNGISOME is delivered to lungs in higher quantity and the levels are comparatively much lower in kidneys. In the following 24 h Amphotericin B, concentration in lungs increases almost four folds while levels in kidneys are maintained low indicating high efcacy and low nephrotoxicity. LD50 in commercial product is better than 60 mg kg-1 body wt (it could not be tested further as it is a ready suspension and furthermore volumes could not be administered in animals). FUNGISOME has been in clinical use in India since 2003 with more than 100 000 infusions been given so far. Success rates of higher than 90% in patients with invasive fungal infections (IFI) and less than 2% nephrotoxicity have been recorded. The drug was well tolerated by patients and mild to moderate fever with rigors were observed in only 25% of the patients. In one patient FUNGISOME was given a total dose of 27 g and another given 11.23 g of Amphotericin B and no signicant rise in creatinine was observed. Although the recommended daily dose is 13 mg kg-1 body wt day-1, less than 10% of the patients required dose escalation beyond 1 mg kg-1 body wt day-1. Daily dose cost ranges from 1/6th to 1/10th of the only other liposomal amphotericin B available commercially, making it the most economical treatment of IFI. In addition, being sugar free, it is best suited for treatment of IFI in diabetics. Conclusion: We present a new liposomal amphotericin B formulation manufactured in India and used with success since 2003 for patients with IFI at moderate costs.
P251
Immune responses of mice infected with a Candida albicans O-mannosylation mutant L. Castillo, A.J.P. Brown, A. R. Gow and F. C. Odds University of Aberdeen, Aberdeen, United Kingdom
The MNT1 and MNT2 Genes of Candida albicans are involved in O-glycosylation of cell wall and secreted proteins. Elimination of both Mnt1p and Mnt2p results in truncation of O-linked glycans and reduction in virulence, indicating that these enzymes are important for normal interactions with the host (1). In previous experiments, we showed that cytokine responses to the mnt1mnt2 double mutant were lower than to CAI-4, when they were infected with similar challenge inocula. To determine the role of glycosylation in stimulation of the innate immune response, we infected BALB/c mice intravenously with the C. albicans mnt1mnt2 double null mutant with a higher challenge to achieve the same pathological effects in 3 days as with CAI-4. We studied the histology in the kidneys and gross sequence of production of cytokines and measured chemokines in the serum, kidneys and spleen at intervals up to 48 h post-challenge. No histopathological differences were found between CAI-4, the mnt1mnt2 mutant and mnt1mnt2 +MNT1 reintegrant strains, conrming that infection outcome was similar in all the mice infected. However, initial results show that the cytokine differed considerably, both in times of production and concentration. For example, by 12 h after challenge, renal levels of TNF, G-CSF, IL-6 and MCP-1 were higher in mice infected with the mnt1mnt2 mutant than in those challenged with CAI4 and the MNT1 reintegrant. 24 h post-challenge, renal levels of IL-6, KC, MIP-1b, RANTES, TNF and MCP-1 at 24 h were lower in mice infected with the mnt1mnt2 mutant. Spleen levels of IL-10, TNF, MCP1 and MIG at 12 h were higher than controls in mice challenged with the mutant while by 48 h spleen levels of KC and MCP-1 were lower in the mutant-infected mice. These results demonstrate that an Oglycosylation defect in cell wall mannoproteins alters the mouse cytokine response to C. albicans infection even when the size of the challenge is high enough to eliminate the gross attenuation in virulence associated with the mnt1mnt2 mutation.
Conclusions: ITC, POS and ISA are in vitro the most active drugs
against C. carrionii the agent of chromoblastomycosis. Echinocandins and AmB demonstrated low in vitro activity against C. carrionii. These in vitro results need to be clinically conrmed
P249
FUNGISOME a new liposomal amphotericin B preparation for treatment of invasive fungal infections developed in India L. Verma and J. N. Verma Lifecare Innovations Pvt Ltd, Gurgaon, India Objective: Development of FUNGISOME (a liposomal amphotericin B
formulation) was taken up in India in 1987 as part of a mission of the Government of India to make India self-reliant for this critical lifesaving drug, to address a national priority and a global need. The perceived goal was to retain the broad-spectrum and anti-fungal potency of amphotericin B, remove dose related adverse reactions and nephro-toxicity and ensure that the new preparation remains affordable. Methods: FUNGISOME i.v. is designed to navigate amphotericin B encapsulated in liposomes to target fungal cells resulting in high anti-
Reference
1. Munro C et al. J Biol Chem 2005; 280: 10511060.
103
P252
Exogenous administration of a cocktail mimicking Candida albicans autoregulatory alcohols affects the progression of hematogenously disseminated candidiasis in mice M. Martins1, A.L.l. Lazzell2, M. Henriques1, J. Azeredo1, J. L. Lopez-Ribot2 and R. Oliveira1 1 IBB-Institute for Biotechnology and Bioengineering, Braga, Portugal, 2South Texas Center for Emerging Infectious Diseases, San Antonio, TX, USA
Candida albicans is a polymorphic fungus that causes opportunistic infections in humans. The ability of C. albicans to switch between different morphologies is thought to underlie its success as a pathogen. Recently our group demonstrated that culture supernatants of C. albicans contain a mixture of autoregulatory alcohol molecules capable of inhibiting in vitro lamentous growth of planktonic C. albicans cells. Additionally, a cocktail solution containing isoamyl alcohol, 2phenylethanol, E-nerolidol and E,E-farnesol (simulating a 96-h culture supernatant) was shown to regulate C. albicans morphological transition in a similar fashion. Objectives: The aim of this study was to investigate whether the identied autoregulatory alcohols, through the exogenous administration of the cocktail solution, could affect the progression of infection in a murine model of hematogenously disseminated candidiasis. Methods: For the disseminated candidiasis model, imunocompetent BALB/c female mice (age 68 weeks old) were infected by lateral vein injections with suspensions containing 3105 C. albicans CAF-2 cells (four to eight animals per group). Afterwards, animals were divided into two groups for alcohols administration (1 ml, intraperitoneally): one control group received vehicle solution alone (5% ethanol), and the other group received the cocktail solution of autoregulatory alcohol molecules simulating a C. albicans 96-h supernatant (94 lmol L-1 isoamyl alcohol, 70 lmol L-1, 2-phenylethanol, 3.2 nmol L-1 E-nerolidol and 18 nmol L-1 E,E-farnesol). The effect on infection was monitored by survival curves and by determining fungal organ burden at scheduleds times (days 1, 2 and 3) postinfection. For all animals, upon death or sacrice, brain, spleen, and kidneys were removed for the determination of fungal burden (total CFU per gram of tissue). All experiments were performed in accordance with institutional regulations at the University of Texas at San Antonio. Survival data and organ fungal burdens were analyzed using the MantelCox log rank test and MannWhitney test, respectively. Results: The median survival of control mice receiving the vehicle alone was 6 days. The administration of the cocktail solution signicantly delayed the time of death to 9 days (P = 0.005). At days 1 and 2 post-infection fungal burden in organs retrieved from mice treated with the cocktail solution was similar to control mice. However, on day three animals that received the cocktail solution displayed lower renal and brain fungal burden compared to control mice receiving the vehicle solution alone (P = 0.03). Conclusions: The cocktail solution containing autoregulatory alcohol molecules simulating a 96-h culture supernatant shows an in vivo protective effect against disseminated candidiasis. These ndings indicate that the autoregulatory molecules isoamyl alcohol, 2-phenylethanol, E-nerolidol and E,E-farnesol may play a role during C. albicans pathogenesis.
G-protein associated with opioid receptors (e.g., l opioid receptor MOR) at the cellular membrane level has been known to modulate the activity of some phospholipases (i.e., Cb and A2) (Pan YXDNA Cell Biol. 2005; 24: 736750). Endogenous opioid peptides, such as b endorphin, have a high afnity with MOR and may affect multiple physiological functions in both the central nervous system and peripheral tissues (Slominski A. J Invest Dermatol 2003; 120: 1073 1080). It has been suggested that b -endorphin might play a role in inducing M. pachydermatis cell differentiation towards the production or non-production of phospholipase (Cafarchia et al. Med Mycol. 2007; 45:1115). However, no information is currently available on the expression of MOR on M. pachydermatis cell membranes. Thus, the aim of the present work was to study MOR expression on the membrane of M. pachydermatis cells and its role in modulating phospholipase activity in yeasts isolated from healthy dogs and dogs with skin lesions. Methods: Phospholipase Activity was assessed by means of the eggyolk plate method as previously reported (Cafarchia et al. Med Mycol. 2007; 45: 1115) on 64 mol L-1. pachydermatis isolates using different concentrations of naloxone (Nx), a MOR antagonist. Isolates were divided into Group A (i.e., 40 isolates from 26 dogs with dermatitis) and Group B (i.e., 24 isolates from 12 healthy dogs). The MOR expression was analyzed by Western blot and immunouorescence. Results: A statistically higher p.a. than that of the controls was recorded in isolates from Group A at a Nx concentration of 10 6 mol L-1 (P < 0.05). No isolate in Group B displayed p.a. in either control samples or in the presence of any Nx concentration. Using Western blot analysis, a band corresponding to MOR protein (with a molecular weighting of about 65 kDa) was observed in the protein fraction obtained from both clones of Group A and Group B. An additional band of around 98 kDa was also detected, with a higher expression in the clone from Group B than that from Group A. MOR expression and localization was also demonstrated by immunouorescence in isolates from Groups A and B. Conclusion: This study suggests that opioid receptors are present in isolates of M. pachydermatis and may be involved in mediating the effects of opioid agents. Their expression mechanisms might be strictly related to the chemical composition of the skin and may have a role to play in inuencing the pathogenic or commensal phenotype of Malassezia. Further functional investigations of opioid receptors and their expression mechanism could raise hypotheses about pathogenic processes in animals colonized by M. pachydermatis, thus opening new avenues for the topical control of Malassezia lesions.
P254
Cell wall proteins proles of non-Candida albicans Candida species M. Henriques, S. Silva, A. R. Conde, J. Azeredo and R. Oliveira University of Minho, Braga, Portugal
The major components of the cell wall of opportunistic Candida pathogens are polymers of mannose covalently associated with proteins or glycoproteins (mannoproteins), polymers of glucose (glucans) and chitin. Proteins and glycoproteins exposed in the most external layers of the cell wall structure are involved in morphogenesis and pathohenecity-related aspects, e.g. adhesion to inert materials and animal tissues. Nevertheless, the total number of cell wall proteins and their functions are still poorly known, especially in the non-Candida albicans Candida (NCAC) species. Objectives: The aim of this study was to determine and compare the cell wall protein prole of three NCAC species, C. tropicalis, C. glabrata and C. parapsilosis. Methods: In this study, one reference strain and one clinical isolate of C. tropicalis, C. glabrata and C. parapsilosis were used. Cell wall proteins were extracted by boiling cell walls with SDS (sodium dodecylsulphate) and DTT (dithiothreitol). The fractions obtained were precipitated with trichloroacetic acid/acetone and the total protein quantied by bicinchonic acid (BCA) Kit. Candida cell wall proteins were separated by 2 D electrophoresis using pH = 710 gradient strips
P253
Opioid receptor on Malassezia pachydermatis cells C. Cafarchia, M. E. DellAquila, M. Albrizio, L. Aguiar Figueredo, A. C. Guaricci, T. De Santis and D. Otranto University of Bari, Valenzano (Bari), Italy Objectives: Malassezia spp. may act as opportunistic skin pathogens
of humans and animals (Chen TA, Hill PB. Vet Dermatol 2005; 16: 4 26). Malassezia pachydermatis proliferation and phospholipase production may play a pathogenic role in the occurrence of skin lesions in dogs (Cafarchia C, Otranto D. J Clin Microbiol 2004; 42: 48684869).
104
and 10% SDS polyacrylamide gels. The gels were analyzed and compared using PDQuest-2D analysis software. Results: The different electrophoretic proles obtained, reveal differences between the species under study in terms of cell wall proteins composition. It is possible to observe that C. tropicalis is the species that present higher similarity in terms of cell wall protein prole when compared with the other species and C. glabrata is the species that presents the lower similarity. Moreover, it is possible to observe that, while C. parapsilosis strains present a high homology, for the other two species the similarity was to much higher. Conclusions: Hence, it is possible to conclude that there are several differences on the cell wall protein proles among the different NCAC species and also between different strains of the same species.
P256
Phospholipase production by Malassezia species in response to b-endorphin stimulation: a candidate virulence factor? C. Vlachos1, G. Gaitanis1, E. C. Alexopoulos2, Ch. Papadopoulou1, A. Velegraki3 and I. D. Bassukas1 1 Medical School, University of Ioannina, Ioannina, Greece, 2 Medical School, University of Patras, Patras, Greece, 3Medical School, Athens University, Athens, Greece
Malassezia species are global skin commensals and pathogens causing pityriasis versicolor being implicated in the pathogenesis of seborrheic dermatitis (SD), atopic dermatitis and psoriasis. The aims of our study were: (i) to study the distribution of the anthropophilic Malassezia species within family members with SD; (ii) to assess phospholipase production as a potential virulence marker; and (iii) to study the effect of b-endorphin on phospholipase production by Malassezia isolates. Skin sampling and identication of Malassezia species were performed as previously described (1). Phospholipase activity was measured by the egg-yolk plate method as the rate of the maximum diameter of the colony to the total diameter of precipitation on egg yolk agar. For the assessment of the effect of b-endorphin on phospholipase activity bendorphin (1 or 100 nmol) was added to Malassezia cultures for 4 days prior to the phospholipase activity assay. Statistical inference by means of the v2-square test and logistic regression analysis (SPSS). Forty-ve volunteers (15 males/30 females) belonging to 18 families were sampled and a total of 48 Malassezia strains were isolated (7 M. globosa, 21 M. furfur, 16 M. sympodialis, 4 M. restricta). Fifteen out of the 45 volunteers had SD. Samples from 13 SD patients, three pityriasis versicolor and seven healthy unrelated individuals were also included and 24 Malassezia strains (seven M. globosa, seven M. furfur, seven M. sympodialis, three M. restricta) were isolated from them. M. furfur clustered within families (P < 0.033). Phospolipase production was observed in M. furfur CBS 6001, M. carpae CBS10434, M. pachydermatis CBS1879, M. dermatis CBS 9170, M. obtusa CBS 7876, as well as in M. furfur (28/28), M. globosa (14/14), M. restricta (6/7) and M. sympodialis (20/22) strains. Quantitative production of phospholipase was increased in M. furfur compared to the other Malassezia species (P < 0.05). Strains from SD patients tended to respond to b-endorphin stimulation with increased phospholipase production but this did not reach statistical signicance in the population tested thus far. In conclusion, our results show that: (i) M. furfur tends to cluster within families. (ii) All tested Malassezia species present some phospholipase activity, yet under the current assay conditions this activity is highest in M. furfur. (iii) M. furfur responds to b-endorphin stimulation with increased phospholipase activity compared to other Malassezia species. Increasing the sample size, complementing conventional mycological results with molecular typing methods and optimizing our phospholipase assay for species specic testing could highlight whether production of phospholipase by M. globosa, M. restricta and M. sympodialis as a virulence factor is altered by b-endorphin stimulation following disease associated pattern.
P255
Candida dubliniensis pathogenicity: comparison with other Candida species C.Y. Koga-Ito, C.A.P. Martins, T. C. Vasconcellos and E. Y. Komiyama o o Sa Paulo State University, Sa Jose dos Campos, Brazil Objectives: In vivo studies on virulence using murine models
suggested that C. dubliniensis is less virulent than C. albicans. However, there are not previous studies on the comparative virulence of C. dubliniensis with non-albicans species. Also, C. dubliniensis infection kinetics is rarely discussed in the literature. This study aimed to compare the virulence and infection kinetics of C. dubliniensis with other non-albicans species, in particular C. tropicalis. Also, to investigate the virulence of C. dubliniensis in relation to C. albicans, by using clinical isolates. Methods: Experimental pathogenicity was determined by using mice in a model of systemic infection (Ethic Committee approval 056-PH/ CEP). Survival rate and behavioral changes were registered for 28 days. Results were compared by KaplanMeier survival analysis (log-rank test, a = 5%). Infection kinetics was determined by using mice in a model of systemic infection and by microbiologic evaluations (expressed in values of colony-forming units per gram of organ-cfu per gram) of each organ (liver, spleen, kidneys, lungs and brain). Results: The higher mortality rate was observed for C. albicans (9/20), followed by C. tropicalis (3/20), C. dubliniensis (1/20) and C. krusei (0/20) (P = 0.002). No animal inoculated with C. dubliniensis showed behavioral or postural alterations. Animals inoculated with C. albicans and C. tropicalis showed inclination of the head that suggests involvement of the central nervous system. High number of C. dubliniensis cells was isolated from the lung 6 h after the inoculation. C. dubliniensis showed high capacity of dissemination to the kidney when compared with other species. All the tested species were isolated from the spleen and total elimination was observed for C. tropicalis, C. krusei and C. dubliniensis, but not for C. albicans. C. dubliniensis was also detected in the liver with slower clearance in relation to the other species. A reduction of C. albicans, C. tropicalis and C. krusei counts was observed for all the organs during the experimental period. This reduction tendency of counts was observed for C. dubliniensis in lungs and spleen. A continuous elevation of C. dubliniensis counts was observed for kidney and brain even at day 21. C. albicans clinical isolates (n = 4) were more virulent than C. dubliniensis ones (n = 4) (P = 0.000). Conclusions: C. dubliniensis was less virulent for mice in relation to C. albicans and C. tropicalis. C. dubliniensis caused persistent infection in kidney and liver. C. dubliniensis clinical isolates were less virulent than C. albicans ones.
Reference
1. Gaitanis G, Velegraki A, Alexopoulos EC. Malassezia furfur ngerprints as possible markers for human phylogeography. ISME J 2009; 3(4): 498502.
P257
Detection of siderophore production of Aspergillus and Candida species A. Seyer, A. Kalkanci, A. Fouad and S. Kustimur Gazi University, Ankara, Turkey Objectives: Siderophore-mediated iron acquisition has been well
studied in many bacterial pathogens because it contributes to virulence. In contrast, siderophore-mediated iron acquisition by fungi has received relatively little attention. A welsknown and widely used method for detection of siderophore production by microorganisms in solid medium is the universal chrome azurol S (CAS)-agar plate assay.
105
This study proposes a molecular quantitative assay for the detection of siderophores of Aspergillus fumigatus and Candida albicans strains. Methods: Aspergillus fumigatus, Candida albicans strains and a positive control Aspergillus niger strain were used for the detection of siderophores in the CAS-agar plates. CAS-agar plates were preperad according to Schwyn and Neilands protocol published in 1987. But, we modied the original methodology by preparing CAS-blue agar plates overlaid with a layer of nutrient agar. A realtime reverse-transcription (RT-PCR) protocol has been developed to analyse the expression pattern of the sidA gene of A. fumidatus and SIT1 gene of C. albicans in relation to siderophore production. Fungal RNA was isolated and the RT-PCR was performed with cDNA of A. fumigatus and C. albicans strains. PCR was conducted using the LightCycler 2.0 instrument (Roche Diagnostics, GmbH Mannheim, Germany). Reaction mixtures contained a total volume of 20 ll consisting of; SYBR Green I PCR Master Mix (Roche Diagnostics, Germany) and corresponding primers. Results: Siderophore producing microorganisms were detected by measuring the advance of the color-changes on the CAS-agar, from blue to orange, purple or dark purplish-red. Relative transcript levels of the SidA gene of A. fumigatus and SIT1 gene of C. albicans were quantied. Mean copy number of SidA gene was 2.25 103 and it was SIT1 gene was 2.62 103. Conclusion: We describe a quantitative molecular assay compared to CAS-agar plate assay, which make it possible to select and evaluate the siderophore production by several microorganisms according to different culture conditions. Detection of sideophores by CAS-agar plate method or by a quantitative PCR method would be usefull to understand the pathophysiological mechanisms were conducted by fungal agents during human diseases.
suggesting that this assay is more sensitive to the analysis of SAP activity regardless of the species studied. Financial support: FAPEAM.
P259
Adhesion of clinical isolates of C. albicans and C. tropicalis to immobilized extracellular matrix proteins K.R.C. Costa, J. C. Ferreira, M. D. Baruf and R. C. Candido o FCFRP USP, Ribeira Preto, Brazil
Extracellular matrix (ECM) proteins components form a complex network which provides multiple binding sites for attachment of microorganisms. Among ECM proteins, laminin and bronectin could be involved in adherence in C. albicans. Objectives: The aim of this study was to evaluate the adhesion of C. albicans and C. tropicalis to immobilized laminin and bronectin. Methods: A collection of 15 C. albicans and 15 C. tropicalis recovered from the oral cavity of patients with clinical signs of candidiasis were used in the study. The adhesion of Candida cells to the ECM proteins was evaluated by ELISA. Wells of polystyrene microtiter plates were coated with 100 ll of laminin or bronectin (10 lg ml-1 in 0.2 mol L-1 bicarbonate buffer pH 9.4) by passive adsorption overnight at 4 C. Non-specic binding was blocked by incubating the plates for 2 h with a 1% solution of gelatin and the inoculum used was 107 yeast cells per well. The ELISA procedure was carried out using a mouse anti-Candida monoclonal antibody followed by addition of an anti-mouse IgG peroxidase conjugate with the respectives steps of washing and incubating period. The reaction was developed with the substrate Ophenylenediamine dihydrochloride (OPD) and the absorbance at 490 nm (A490) was measured using an automated reader. Bovine serum albumin (BSA) was used as positive control. Each experiment was done in triplicate and the results were expressed as the relative adhesion index for laminin and bronectin calculated as A490 ECM protein/A490 BSA. Results: All isolates of C. albicans and C. tropicalis presented an adhesion index higher than 1.00, which suggests a positive binding to the immobilized extracellular matrix proteins laminin and bronectin. Conclusion: These ndings indicates that C. albicans and C. tropicalis interact specically with laminin and bronectin. Financial support: FAPEAM.
P258
Evaluation of the secreted aspartic proteinase activity of clinical isolates of C. albicans and C. tropicalis using two different methods K.R.C. Costa, J. C. Ferreira, M.A.S. Lavrador and R. C. Candido o FCFRP USP, Ribeira Preto, Brazil
The role of secreted aspartic proteinase (SAP) as a virulence factor of Candida has been intensively investigated during the last decades. A traditional semi-quantitative plate method using albumin as the sole source of nitrogen is widely used to evaluate SAP activity, especially of C. albicans. On the other hand, a quantitative assay using yeasts cultured in broth medium followed by spectrophotometric analysis has emerged as an interesting alternative for this purpose. Objectives: The aim of this study was to determine if there is correlation in the in vitro SAP activity of C. albicans and C. tropicalis isolates employing the two described methods. Methods: A collection of 15 C. albicans and 15 C. tropicalis recovered from the oral cavity of patients with clinical signs of candidiasis were used in the research. The semi-quantitative method to determine SAP activity was assessed according to Ruchel et al. (1982) and the enzymatic activity was expressed as a precipitation zone (PZ), which is the ratio between the diameter of the colony and the diameter of the zone corresponding to degradation of substrates. The quantitative assay was carried out as described by Kuriyama et al. (2003) and one SAP activity unit was dened as a 0.1 increase in the OD280/h. This value was related to cell number per millilitre to calculate nal SAP activity. All experiments were done in triplicate and the Pearsons correlation test followed by two-tailed permutation assay was applied. Results: In the semi-quantitative method, all C. albicans isolates presented moderate activity while 40% and 60% C. tropicalis isolates had moderate and no activity, respectively. The quantitative assay showed SAP activity of all C. albicans and C. tropicalis isolates. However, the activity average was higher for C. tropicalis isolates. A low correlation between these assays was revealed by the statistic test. Conclusion: The traditional semi-quantitative method is appropriate to characterize the production of SAP by all strains of C. albicans studied; however, when dealing with C. tropicalis isolates, this method showed low sensitivity. Conversely, the quantitative method was able to demonstrate the enzimatic activity of C. albicans and C. tropicalis,
P260
Response to macrophage infection by Candida parapsilosis sensu strictum isolates with different multilocus genotypes R. Sabino1, P. Sampaio2, L. Rosado3 and C. Pais2 1 de Universidade do Minho/Instituto Nacional de Sau Dr. Ricardo Jorge, Lisboa, Portugal, 2Universidade do Minho, Braga, de Portugal, 3Instituto Nacional de Sau Dr. Ricardo Jorge, Lisboa, Portugal
Candida parapsilosis is the cause of serious nosocomial infections being the second most common Candida species isolated from bloodstream infections in any regions of the world, including Portugal. Due to its association with parenteral nutrition and central lines, C. parapsilosis affects mainly critically ill neonates, cancer patients and surgical intensive care unit patients. Despite the growing importance of these pathogens little is known about their virulence attributes. Given the complexity of C. parapsilosis virulence and the critical role played by macrophages in balancing colonization/infection caused by this yeast, the analysis of C. parapsilosis response to macrophage infection is important to understand the virulence potential of different isolates of this species. Since the genetic background may inuence the strain virulence attributes, we identied new polymorphic microsatellite markers, applied them in C. parapsilosis sensu strictum genotyping and selected isolates with different multilocus genotypes to access macrophage infection.
106
Objectives: The main objective of this work was to analyze the behavior of strains with different multilocus genotypes, as determined by microsatellite genotyping, upon contact and internalization by macrophages. Methods: Two hundred and thirty three C. parapsilosis sensu strictum independent clinical isolates from European and American hospitals, as well as environmental strains were genotyped using four polymorphic microsatellite markers. Selected strains with different multilocus genotypes and origins were analyzed regarding their virulence attributes by accessing phagocytosis and intracellular killing using the macrophage-like cell line J774A.1. After growing in YEPD medium overnight, yeast cells (2 107 cells ml-1) were added to the 24-well macrophage monolayer (4 105 cells ml) at an effector/target ratio of 1 : 10 and incubation was performed at 37 C, 5% CO2-95% air during 1 h. The number of viable C. parapsilosis yeast cells was determined by CFU counting after 24 h at 37 C on YEPD agar plates. Determination of macrophage death rate was also performed at 1, 2, 3, 4, 6, 8 and 12 h after infection by iodium propide staining. Results: The percentage of phagocytosis after one hour of infection varied between 11.0% and 44.6%. Interestingly, the strain with the lowest percentage of phagocytosis was an environmental isolate whereas the highest percentage was found in a bloodculture isolate. Microscopic examinations conrmed our previous ndings and showed that C. parapsilosis can develop pseudohyphae inside macrophages. Conclusion: Our observations suggest that C. parapsilosis isolates with different multilocus genotypes have distinct virulence potential and studies are in progress to understand the mechanisms underlying this behavior. Raquel Sabino holds a PhD fellowship (SFRH/BD/22100/2005) from Fundacao para a Ciencia e Tecnologia (FCT).
P262
Biolm production by isolates of Candida species and by mixed Candida species recovered from 100 denture wearers C. Marcos-Arias, E. Eraso, J. M. Aguirre and G. Quindos Universidad del Pas Vasco, Leioa, Spain
Denture stomatitis (DS) is a lesion of the mucosa that has been associated to Candida. Although its aetiology is multifactorial, it seems to depend on the development of complex and poorly characterized biolms. Candida albicans is the most frequently isolated yeast from DS, but other species of Candida, are regularly isolated. Biolm formation is a major virulence factor in the pathogenicity of Candida because of their high antifungal resistance. Objective: To examine the differences in biolm production by clinical isolates of different species of Candida from denture wearers, as well as in biolm production by two or more Candida species together (mixed biolm). Methods: One hundred and fty-one Candida isolates recovered from the denture and/or the underlying mucosa from 100 patients were studied (45 with different types of DS and 55 without DS). When two or more species were isolated from the same patient, these isolates were grouped for the study of a mixed biolm. Isolates included 101 Candida albicans, 18 Candida tropicalis, 13 Candida glabrata, 11 Candida guilliermondii, 4 Candida parapsilosis, 2 Saccharomyces cerevisiae, and 1 isolate each of Candida dubliniensis and Candida krusei. C. albicans NCPF 3153 and the hypha-decient mutant C. albicans Ca2 were used as controls. Biolms were formed according to Ramage et al. and evaluated by a colorimetric method to monitor the metabolic activities of yeast cells. Data were analysed using the Students t-test (P < 0.05). Results: Most isolates produced biolm, being C. albicans and C. tropicalis the major producers, without signicant differences between them. Among the isolates from patients with DS, C. albicans produced more biolm than other species of Candida did. In the group of patients without DS, the same difference was found in 24 h biolms. In relation to mixed species biolm, C. albicans was present in most of them. Moreover, the most common combination was C. albicans and C. tropicalis. The rank of mature biolm production (48 h) was as follow: C. tropicalis and C. glabrata > C. albicans and C. tropicalis > C. albicans, C. glabrata and C. tropicalis > C. albicans and C. glabrata > C. albicans and C. guilliermondii = C. albicans and C. parapsilosis. However, C. tropicalis and C. glabrata combination produced more biolm at 24 h of incubation than the C. albicans and C. tropicalis combination. In all cases, no relationship was found within the origin of the isolates and biolm production. Finally, those mixed biolms in which C. albicans was present showed more biolm production at 24 h of incubation than biolm produced uniquely by C. albicans. Further studies are required in order to understand how the different species of fungi cooperate to biolm formation. Conclusion: Mixed biolm including C. albicans are more proliferant than those produce by C. albicans or other species of Candida separately. Funding: Projects GIC07 123-IT-222-07 (Departamento de n, Universidades e Investigacio n, Gobierno Vasco), Educacio S-PE08UN35 (Saiotek 2008, Departamento de Industria, Comercio y Turismo, Gobierno Vasco) and PI061895/2006 (Fondo de Investiga cion Sanitaria del Ministerio de Sanidad y Consumo de Espana).
P261
Comparison of biolm formation ability among Candida clinical isolates A. Silva-Dias, I. Miranda, C. Pina-Vaz and A. G. Rodrigues University of Porto, Porto, Portugal Objectives: Candida albicans is the Candida species most associated with mucocutaneous and systemic mycosis, but recently, non-albicans species have been increasingly responsibility for such conditions. The ability of Candida species to form biolms has important clinical repercussions since it results in a reservoir of cells with promoted antifungal resistance. Our aim was to evaluate the biolm formation by distinct Candida clinical strains (isolated from patients admitted at Hospital S. Joao) regarding their metabolic activity and total biomass. Methods: Clinical isolates of Candida (n = 165), corresponding to C. albicans (n = 45), C. parapsilosis (n = 45), C. glabrata (n = 45) and C. tropicalis (n = 30), were obtained from different human samples. Biolm were quantied colorimetrically with a crystal violet assay and a XTT assay after 24 and 48 h of incubation. Results: Data obtained using the above methodologies were discrepant: a lack of correspondence between biomass formation and metabolic activity was found. C. tropicalis showed the higher ability to form biolm followed by C. parapsilosis, C. glabrata and C. albicans when quantied by crystal violet. However quantication with XTT assay showed that, C. albicans strains showed higher biolm metabolic activity followed by C. glabrata,C. parapsilosis and C. tropicalis .A marked variability intra and inter species was noticed. Conclusion: Candida albicans despite being the species with higher metabolic activity displayed lower biomass formation comparing to non-albicans species. For all species, biolm formation showed to be strain or species dependent.
P263
Glucans induce higher IL-8 and TNF-a mRNA production in Cystis Fibrosis Transmembrane conductance Regulator (CFTR) decient than in non-decient respiratory epithelial cells Ph. Poirier1,2, A. Hinzpeter3, C. Farrugia1, F. Botterel1, P. Fanen3 and S. Bretagne1 1 pital Henri Mondor, CRETEIL, France, 2Ho pital Gabriel Ho pital Henri Mondor, Montpied, CLERMONT-FERRAND, France, 3Ho CRETEIL, France Objectives: Glucans are major structural components of the fungal cell wall and are known to activate invertebrate innate immune
107
systems. These carbohydrates are also known to induce nuclear factorjB (NF-jB) and therefore inammatory reactions in macrophages [1]. Inammatory effect of fungi can impact on several respiratory pathologies such as cystic brosis (CF). Indeed, defective cells for CF Transmembrane conductance Regulator (CFTR) are more sensitive to inammatory effects of lipo-polysaccharide from Pseudomonas aeruginosa, which is the main pathogen involved in these patients [2]. In CF patients, Aspergillus fumigatus is also responsible for inammatory injuries of the respiratory tract. We have already shown that fungal growth is the main stimulus for the production of inammatory mediators using A549 cell lines [3]. The aim of this study was to investigate whether (i) glucans could be responsible for proinammatory effects on respiratory epithelium, and (ii) CFTR could be involved in this pro-inammatory effect. Methods: Two in vitro models of respiratory epithelium were exposed to 100 lg/mL of commercial glucans from Saccharomyces cerevisiae: the A549 cells without CFTR expression, and the Calu3 cells with strong expression of CFTR. Levels of mRNA of 3 inammatory mediators [Interleukine 8 (IL-8), Tumor Necrosis Factor a (TNF-a) and Granulocyte Macrophage Colony Stimulating Factor (GM-CSF)] were quantied using quantitative real time PCR. The results were expressed as the N-fold difference in target gene expression relative to the TBP gene as the reference gene (Ntarget = 2DCt sample). Results: Glucans (4 h exposition, 100 lg/mL) induced a signicant higher expression of IL-8 mRNA and TNF-a in A549 than in Calu3 [NA549 = 18 vs. NCalu3 = 2 (P = 0.02); TNF-a: NA549 = 9 vs. NCalu3 = 2 (P = 0.05), respectively). The addition of the specic CFTR inhibitor (CFTR(inh)172) on Calu3 cells did not lead to a higher IL-8 and TNF-a induction by glucans by these cells. No signicant difference in GM-CSF induction between the two cell lines was observed (GM-CSF NA549 = 21 vs. NCalu3 = 17). Conclusion: Our results suggest that glucans are involved in the inammatory response of respiratory epithelium to fungi. In CF patients, the absence of CFTR at the plasma membrane could be responsible for an over expression of IL-8 and TNF-a. This could explain at least in part the respiratory damages in CF patients colonized with A. fumigatus.
armadillos were virulent in the animal model. P. brasiliensis express proteins that interact in various ways with the extracellular environment and generally involve ligands produced by the pathogen and is capable to adhere to extracellular matrix proteins (ECM). This approach has not been studied with the armadillos isolates. Then, we studied the capacity P. brasiliensis armadillos isolates to infect to pulmonary epithelial cells (A549), as well as the protein prole of these isolates and ECM ligands. Our data conrmed previous studies that more virulent P. brasiliensis isolates have greater adhesion and invasion capacity epithelial cells. The comparative analysis of the different extracts showed isolate T10 (more virulent) presented more than double spots differentially expressed if compared with isolate T7 (intermediate virulence), which may be related to virulence. In addition, T10 presented remarkable difference with an elevated number of ligands collagen type I and similar to collagen type IV, bronectin and laminin if comparated with other isolates. Therefore, one of the armadillo isolate has additional ligands to three ECM proteins. The isolates from armadillo presented more ligands to collagens compared to the human isolates. The data presented here support the conclusion of host-site-specic inuences on protein expression and different proles may be related to micro niche of the fungus in the host and this difference may occur in the rst contact with the human tissues. Supported by FAPESP, PADC-FCF-UNESP and CAPES.
P271
Disease severity inuences pharmacokinetics of voriconazole J.W.C. Alffenaar, J.G.W. Kosterink, S.M.G.J. Daenen, M.G.G. Rodgers, D.R.A. Uges and T. S. Van der Werf University Medical Center Groningen, Groningen, The Netherlands Background: A standard loading dose of voriconazole might be too low to reach steady state concentrations in some or all critically ill patients. This may be related to capillary leakage which is a hallmark of sepsis. For several antimicrobial products, an increase in the volume of distribution has been reported. Patients with sepsis who are admitted to an Intensive Care Unit (ICU) may have altered pharmacokinetics compared to healthy volunteers and less ill patients, in whom the loading dose was established. In this study we test the hypotheses that 1) the disease severity (according to validated scoring systems) correlate with the volume of distribution; and that 2) the area under the concentration time curve (AUC) of voriconazole decreases with increased severity of disease. Methods: In a prospective observational pharmacokinetic study in patients, aged 18 years and older, suspected to have a fungal infection, voriconazole was started in a loading dose of 6 mg kg-1 followed by 4 mg kg-1 IV or 400 mg respectively 200 mg PO. Blood samples were collected on day one and two at t = 0, 1, 2, 4, 8, 12 h after voriconazole administration; and on day 3, 5 and 8, samples were collected at t = 0, 1, 3 h after voriconazole administration. All samples were analyzed by LC/MS/MS. Disease severity was assessed by Simplied Acute Physiology Score (SAPSII) and Sequential Organ Failure Assessment (SOFA) scoring systems. The study was approved by the Ethics Committee of the University Medical Center Groningen, Groningen, The Netherlands, and written informed consent was given. Results: Eighteen patients were included in this study, (ICU n = 8; ward n = 10). The median AUCday 1 voriconazole of 15.3 (IQR 10.3 22.2 mg*h l-1) in patients admitted to the ICU was lower (but not signicantly; P = 0.07) compared to the median AUC of 29.3 (IQR 27.137.4) mg*h l-1 in patients on the ward. The median AUCday 2 in patients admitted at the ICU (30.1; IQR 16.338.0) was signicantly lower (P = 0.01) compared to the AUC of patients admitted at the ward (median 51.5; IQR 42.363.9). The correlation (R) between the two disease severity scores and the AUCday 1 was non-signicant; R = 0.1 (P = 0.7) for the SAPSII score and R = 0.36 (P = 0.14) for the SOFA score. There was a near signicant correlation between AUCday 1 and SAPSII if voriconazole was administered intravenously
References
1. Kataoka K, Muta T, Yamazaki S, Takeshige K. Activation of macrophages by linear (1right-arrow3)-beta-D-glucans. Impliations for the recognition of fungi by innate immunity. J Biol Chem 2002; 277: 3682531. 2. Perez A, Issler AC, Cotton CU, Kelley TJ, Verkman AS, Davis PB. CFTR inhibition mimics the cystic brosis inammatory prole. Am J Physiol Lung Cell Mol Physiol 2007; 292: L38395. 3. Bellanger AP, Millon L, Khoufache K, Rivollet D, Bieche I, Laurendeau I, Vidaud M, Botterel F, Bretagne S. Aspergillus fumigatus germ tube growth and not conidia ingestion induces expression of inammatory mediator genes in the human lung epithelial cell line A549. J Med Microbiol 2009; 58: 1749.
P264
Adhesion proles and extracellular matrix ligands of paracoccidioides brasiliensis isolates obtained from armadillos (dasypus novemcinctus) R. Peres da Silva1, R. Cordeiro Theodoro2, E. Bagagli2 and M.-J. Soares Mendes Giannini1 1 ncias Farmace uticas de Araraquara-UNESP, Faculdade de Cie ncias de Botucatu-UNESP, Brasil Brasil, 2Instituto de Biocie
Paracoccidioidomycosis (PCM) is a systemic mycoses caused by P. brasiliensis, with a wide distribution in Latin America. The clinical manifestations include cutaneous and systemic forms, and can attack various tissues, specially the lungs. Recently, P. brasiliensis strains with typical morphology have been isolated from Dasypus novemcinctus, conrming as the primary natural reservoir of this fungus. Its geographic distribution is similar to that of human PCM. Isolates from
108
(R 0.6; P = 0.077) or when the SAPSII score was ignored for the parameters chronic diseases and type of admittance (R = 0.4; P = 0.1). A signicant correlation was observed between Cmax 1 and SOFA score (R = 0.48; P = 0.044). Conclusions: A correlation between disease severity and pharmacokinetics of voriconazole seems likely but remains presently unproven. Effect size may be smaller than initially expected, or more likely, case mix may have been too large to reach statistical signicance in the present study. A larger study is warranted to explore the need for new dosing strategies of voriconazole in critically ill patients.
activity and forms the basis for further investigations to isolate active components, elucidated the structures and evaluate them against wider range of microbial strains with the goal to nd new the therapeutic principles. Substitution of commonly used antifungal and inhibiting chemicals by natural extracts such as Myrtle is recommended.
P274
Pharmacokinetic/pharmacodynamic (PKPD) analysis of Itraconazol against Aspergillus spp. in patients with fungal infection-investigation by using the Monte Carlo simulation K. Yonezu1, H. Kasai2, H. Igari1 and M. Nakano1 1 Janssen pharmaceutical K.K., Tokyo, Japan, 2Pharmacokinetics Analysis Group, Tokyo, Japan Objectives: Since the 1990s, in the area of antimicrobial
research, rapid advances have been made in pharmacokinetic (PK) studies, including maximum blood concentration (Cmax), area under the blood concentrationtime curve (AUC), elimination half-life (T1/ 2); and in pharmacodynamic (PD) studies, including minimum inhibitory concentration (MIC) and timekilling curve, greatly contributing to development of proper therapies for infections and development and marketing of novel antimicrobial agents. A notable achievement in this area was identication of the PKPD parameters correlated with in vivo bactericidal action of antimicrobial agents. This enabled prediction of the therapeutic effect of a certain antimicrobial agent to some degree, based on pharmacokinetic characteristics as represented by such parameters as Cmax, AUC, and T1/2, and pharmacodynamic characteristics as represented by such parameters as breakpoint value, MIC50, and MIC90. On the other hand, in the eld of antifungal research, evaluation of the optimal dosage based on PKPD is not established enough. In this analysis, we performed Monte Carlo simulation using these pharmacokinetic parameters of Itraconazole in Japanese patients with mold infection, and the susceptibility data of Itraconazole against clinical isolates of Aspergillus spp. in Japan. Methods: Previously determined population pharmacokinetic (PK) parameters and plasma concentrations of itraconazole were used to postulate total clearance (CL) in individual patients. The area under the plasma concentrationtime curve (AUC) at a dose of 200 mg was then determined by 200/CL. Finally, the ratio of AUC to the minimum inhibitory concentration (MIC) against Aspergillus spp. (AUC/MIC) was determined to investigate its correlation with clinical efcacy. The Monte Carlo simulation was performed with the distribution data of MIC of Itraconazole against these clinical isolates to generate the MIC data for n = 10 000. Based on the time-course of blood concentrations and MIC for n = 10 000, determined the probability of target attainment (TA%) for each range of AUC/MIC of these fungal infectious patients. Analyses were performed using NONMEM software (version V, level 1.1) (GloboMax LLC, Hannover, USA). Results: (i) The data of distribution of 11 isolated Aspergillus spp are shown in Table 1. (ii) The pharmacokinetic pharmacodynamic (PKPD) parameters obtained from the analyses are shown in Table 2. (iii) The correlation between the probability of target attainment (TA%) and AUC/MIC is shown in Figure 1. (iv) Using standard doses of itraconazole against Aspergillus spp, it was demonstrated that AUC/ MIC were smaller than 10, and 90% cases were included in 0.510 (Figure 1).
P272
Inhibitory effects of geranium (Pelargonium) oils on Aspergillus avus toxin productions L. Modiri Islamic Azad University(I.A.U), Lahijan, Iran
Mycotoxins are metabolites formed by molds growing in food stuffs, fodder and organic waste materials. All molds produce specic mycotoxins and species can be characterized by their mycotoxin spectra as well as natural habitation. To identify preventive maintenance procedures wich limit funal colonization, growth and amplication/toxicogenesis of natural oils this studay was conducted . Hens escential oil of geranium (pelargonium) was tested for inhibitory activity against Aspergillus avus isolated from corn bulks. The disc diffusion method was used to evalute the zone of fungal growth inhibition at various concentrations of the oil so that the minimal inhibitory corcentration (mic) and minimal fungicidal concentration (mfc) to be determined. It was found that geranium (pelargonium) oil has static effect at 1:4 dilution ratio as well as fungicidal property at 1:2 ratio so on. The extent of inhibition of fungal growth was dependent on used concentration of the essential oil, so, substitution of currently used antifungal chemicals by natural compounds is recommended for animal and human food or for crope conservations.
P273
In vitro minimum inhibitory concentration (MFC) of Myrtus communis oils in comparison to nystatin on clinical isolates and standard strains of Candida albicans L. Modiri Islamic Azad University (I.A.U), Lahijan, Iran
Use of plants as a source of medicine has been inherited and is an important component of the health care system in Traditional medicines. So, The objective of laboratory testing with plant antimicrobial extract is to obtain reproducible indications of the susceptibility of clinical Isolates of Candida albicans from Vulvovaginal Candidiasis and Standard Strain of C. albicans against Myrtus communis extract and nystatin. 45 isolates of Candida albicans originally obtained from clinical sources were included in the study. The plant extract was obtained from Barij essence co. The type strain of C. albicans (ATCC90028) were prepared as control strain from Iranian Research Organization for science of technology (IROST). In this research, A reference method for antifungal susceptibility testing of yeasts used. Inbibitory effects of the extract in comparison with nystatin analyzed by serial dilution broth technique. Based on the data analysis the best MIC of M. Communis extract on clinical isolates and type strain of C. albicans were 25 mg ml-1 and 2.5 mg ml-1, respectively . Also the best MIC of nystatin on clinical Isolates and type strain of C. albicans were 36 mg ml-1 the obtained results showed that Myrtle extract has inbibitory effect on clinical isolates and type strain of C. albicans in lower concentrations than nystatin drug . The present study suggest consideration of the plants extract with the highest antimicrobial
109
Table 1 MIC distribution of itraconazole
P275
Population pharmacokinetics of liposomal amphotericin B, caspofungin and the combination of both in allogeneic hematopoietic stem cell recipients A.H. Groll1, C. Young2, C. Lanvers-Kaminsky2, G. Silling2, G. Hempel2, J. Boos2 and G. Wurthwein2 1 Childrens University Hospital, Mu nster, Germany, 2University Hospital, Mu nster, Germany Background: Liposomal amphotericin
B (LAMB), caspofungin (CAS) and the combination of both (CASLAMB) are used for management of invasive fungal infections in allogeneic hematopoietic stem cell (aHSCT) recipients. Little is known, however, about the disposition of both agents and their combination in this special population. Methods: The population pharmacokinetics and interactions of LAMB and CAS were investigated within a risk-stratied, randomized, multicenter phase II trial in 53 adult, cyclosporine-immunosuppressed aHSCT patients in the setting of granulocytopenia and refractory fever (CASLAMB trial). Patients received either LAMB (3 mg kg-1 QD), CAS (50 mg QD; d1:70 mg) or the combination of both until defervescence and granulocyte recovery. Pharmacokinetic sampling was performed on days 1 and 4. Drug concentrations in plasma (LAMB: 405, CAS: 458 samples) were quantied by HPLC and were analyzed using NONMEM version 5 and XPOSE 3.1. Results: CAS concentration data tted best to a two-compartment model with proportional error model and interindividual variability (IIV) on clearance (CL) and central volume (V1) [CL: 0.426 L h1 24%, V1: 9.25 L 29%, intercompartimental clearance (Q): 0.823 L h-1, peripheral volume (V2): 3.06 L]. Concentration data of LAMB tted best to a two-compartment model with combined error model and IIV on all parameters (CL: 0.786 L h-1 69%, V1: 18.6 L 42%, Q: 2.86 L h-1 56%, V2: 81.7 L 60%). Internal validation showed that both models adequately described the observed data. None of the covariates tested (LAMB- or CAS- comedication, respectively, sex, weight, age, bilirubin, creatinine clearance) further improved the models. Conclusions: The disposition of LAMB and CAS was best described by two compartment models. Drugs exposures in aHSCT patients were comparable to those in other populations, and no pharmacokinetic interactions were observed between the two compounds.
Table 2 AUC/MIC of Itraconazole in patients of mol
P276
Effects of varying amounts of a liquid nutritional supplement on the pharmacokinetics of posaconazole in healthy volunteers G. Krishna1, L. Ma1, D. Vickery1, X. Yu1, I. Wu1, E. Power2, E. Beresford1 and S. Komjathy3 1 Schering-Plough, Kenilworth, NJ, USA, 2Cubist Pharmaceuticals, Lexington, MA, USA, 3PRA International, Raleigh, NC, USA Objective: To evaluate the pharmacokinetics (PK) of posaconazole
(POS) when administered with varying amounts of an oral nutritional supplement (Boost Plus). Methods: This was a single-dose, crossover, 5-treatment (Trt), 5xed sequence study in 30 healthy subjects who were randomized to receive the following Trts: Trt A, POS 400 mg orally (PO) alone under fasting conditions; Trt B, 1 oz Boost Plus followed by POS 400 mg PO; Trt C, 2 oz Boost Plus followed by POS 400 mg PO; Trt D, 4 oz Boost Plus followed by POS 400 mg PO; Trt E, 8 oz Boost Plus followed by POS 400 mg PO. Blood samples were collected at predetermined time points to evaluate the plasma PK of POS. Log-transformed POS PK parameters were analyzed using ANOVA. Results: POS bioavailability increased almost linearly with increasing amounts of the nutritional supplement, Boost Plus (Table). Based on log-transformed data, the relative bioavailability (AUC) of POS was 35% (fasting), 48% (1 oz), 60% (2 oz), and 77% (4 oz), compared with AUC of POS with 8 oz Boost Plus. Compared with fasting conditions,
Figure 1 AUC/MIC of itraconazole against aspergill.
Conclusion: In this investigation, using standard dose of itraconazole against Aspergillus spp, AUC/MIC were under 10, and thus, 90% of patients receiving administration of 200 mg day-1 itraconazole would be included from 0.15 to 10. To make sure of optimal AUC/MIC parameter for mold infection in clinical practices, we need further more investigation.
110
POS AUC and Cmax increased 2.9- and 3.5-fold, respectively, when given with 8 oz Boost Plus. These ndings were in agreement with previous results (Sansone-Parsons et al. Antimicrob Agents Chemother. 2006;50:18811883). Boost Plus increased the extent of absorption; however, Tmax was not affected. Table 1
P278
Intracellular antifungal concentrations in peripheral blood mononuclear cells, polymorphonuclear leucocytes and erythrocytes F. Farowski Uniklinik Ko Ko Germany ln, ln, Introduction: Peripheral blood mononuclear cells (PBMC) and
polymorphonuclear leucocytes (PMN), are important components of the host defense against invasive fungal infections (IFI). Information on the penetration and concentration of antifungal drugs in peripheral blood cells is, however, limited. Prior results from exclusively laboratory-based experiments on the interaction of uconazole and voriconazole with PMN showed that both agents are characterized by rapid intracellular uptake and elution. While uconazole concentrations were only twice as high as in the surrounding medium,(Ballesta et al., 2005) voriconazole concentrations were 8.5 fold.(Pascual et al., 1993) Experiments comparing the concentration of posaconazole in human plasma and alveolar cells yielded a 33 fold increased intracellular concentration, i.e. for Cmax as well as the area under the curve (AUC). (Conte et al., 2009) Even at lower posaconazole plasma concentrations breakthrough infections during prophylaxis are rare.(Cornely et al., 2007) We suspect that the efcacy of antifungals might correlate with their intracellular concentrations. Hence, we developed a method to determine the intracellular concentrations of a number of antifungals, i.e. anidulafungin, caspofungin, isavuconazole, micafungin, posaconazole, and voriconazole, by liquid chromatography tandem mass spectroscopy in the different compartments of the peripheral blood. Methods: Patient samples are being collected as part of the Cologne biobank protocol on Improving Diagnosis of Severe Infections in Immunocompromised Patients (ISI) (Cornely et al.). Whole blood, collected in EDTA treated tubes, was separated by double-discontinuous FicollHypaque density gradient centrifugation into PBMC, PMN and red blood cells (RBC). The intracellular concentrations were determined by liquid chromatography tandem mass spectroscopy (LCMS/MS). Preliminary results: The limit of quantication is sufcient for the expected concentrations. The accuracies of all concentrations above the limit of quantication were within 15%. The correlation coefcients of calibration curves were 0.99 or better. Recently analyzed blood samples of twelve patients receiving posaconazole showed that the posaconazole concentrations within the PBMC and PMN fractions were signicantly increased compared to plasma concentrations. Conclusion: To our knowledge, we established the rst method to determine azole and echinocandin antifungals within one sample. The accuracies of the method are expected to be sufcient for determination of intracellular concentrations of these antifungals.
Conclusion: Following a single-dose administration of 400 mg POS

oral suspension, POS bioavailability increased almost linearly with increasing amounts of the nutritional supplement Boost Plus. Relative to administration of 400 mg POS with 8 oz of Boost Plus, POS AUC was 77% with 4 oz of Boost Plus and 35% under fasting conditions.
P277
In vitro interaction of voriconazole with imipenem/cilastatin and piperacillin/tazobactam against clinical Candida albicans isolates S.E.M.A. Keceli Ozcan and B. Mutlu Kocaeli University, Kocaeli, Turkey Objectives: Patients suffering from invasive mycoses often receive concomitant antifungal therapy and antibacterial agents. Currently, in our hospital, piperacillin/tazobactam (P/T) and imipenem/cilastatin (I/C) and as an antifungal agent, voriconazole are used especially for the treatment of febrile neutropenic patients. These antibiotics was previously observed to demonstrate the in vitro synergistic interactions with an antifungal agent, caspofungin acetate. It was also previously shown that uoroquinolones enhanced the activity of caspofungin and voriconazole. However, the interaction between P/T and I/C antibiotics with voriconazole againstCandida albicans isolates is not clearly known yet. Methods: Totally 25 C. albicans isolates isolated from various clinical sites were included into this study. In vitro interaction of voriconazole with P/T and I/C antibiotics were tested by CLSI M27-A2 microdilution chequerboard technique. The interaction was analyzed according to values of fractional inhibitory concentration index (FICI). The breakpoint of minumum inhibitory concentration value for voriconazole susceptibility was accepted as 4 microgram ml-1. Results: Only in seven isolates synergistic interactions were observed (FICI 0.5); however, in 18 isolates additive or indifferent interactions were observed (FICI >0.52). There was no antogonism detected between all isolates. Conclusion: These interactions should also be tested in animal experiments and the results should be conrmed with clinical experience. Although broad spectrum antibiotics were not expected to have antifungal effect, the knowledge of the interaction between antifungals and antibiotics may guide to treat immunosuppresed patients who are under risk of invasive candidiasis.
P279
Lack of pharmacokinetic drug interaction between oral posaconazole and caspofungin or micafungin G. Krishna1, D. Vickery1, L. Ma1, X. Yu1, E. Power2, E. Beresford1, C. Noren1 and M. Medlock3 1 Schering-Plough, Kenilworth, NJ, USA, 2Cubist Pharmaceuticals, Lexington, MA, USA, 3PPD Development, Austin, TX, USA Objective: To determine the effect of posaconazole (POS) on caspofungin (CAS) and micafungin (MICA) PK.
Methods: This was a phase 1, open-label, parallel, randomized PK

drug-interaction study in healthy volunteers; 62 of 67 subjects completed treatment. Cohort 1: Treatment arm (TA) 1 (n = 16) received CAS 70 mg day (d) 1 (QD; 1-h infusion), 50 mg (QD; 1-h infusion) d2d14. TA 2 (n = 15) received CAS+POS oral suspension 400 mg BID. Cohort 2: TA 1 (n = 15) received MICA 150 mg (QD; 1-h infusion) d1d7. TA 2 (n = 16) received MICA+POS oral suspension 400 mg BID d1d7. Study drugs were taken after high-fat meals. CAS,
111
MICA, and POS plasma levels were evaluated at predetermined time points. Log-transformed PK parameters were analyzed using ANOVA. Results: Mean PK parameters for CAS and MICA, alone and with POS, are shown (Table). Median Tmax for all four arms was 1 h. Based on log-transformed data, CAS Cmax in the CAS+POS arm was ~90% (d1, d14) of CAS alone. CAS AUC in the CAS+POS arm was 89% (d1) and 98% (d14) of CAS alone. MICA Cmax in the MICA + POS arm was ~111% (d1) and 104% (d7) of MICA alone. MICA AUC in the MICA + POS arm was 109% (d1, d7) of MICA alone. Mean POS Cmax and AUC were not affected to a clinically relevant extent when given with CAS or MICA. Table 1
performed at a ow rate of 0.8 ml min-1 with injections of 40 ll for each sample. The retention times were found to be approximately 3.01 min for posaconazole and 5.91 min for itraconazole. The validation was assessed by running four core assays with the standards and samples in duplicate. The assay was compared with a standard posaconazole bioassay. Results: All standard curves were found to be linear, for the specic concentrations used (r = 0.996). The lowest limit of quantication was determined at a concentration of 0.1 lg ml-1. The mean intra run precision (%CV) ranged from 2.34 to 7.40%, for the calibration standards and from 0.47 to 1.97% for the QC samples,. Spiked samples of plasma and serum presented relatively identical results (P = 0.999).The recovery of posaconazole ranged between 97100%. Preliminary measurements of posaconazole levels were performed in serum samples from patients receiving the drug at 400 mg day-1 bd. The mean trough levels were determined to be 0.6 lg ml-1. Comparison with the bioassay will be presented in the poster. Conclusions: The results attained have shown that this method is linear, precise, accurate and easy to perform. Its use and further evaluation procedures to support dose adjustment and to ensure a more effective and safer use of posaconazole is recommended.
P281
In vitro interactions of antifungal agents with uoroquinolones in the presence of cyclosporine or neutrophils against Candida albicans and Aspergillus fumigatus T. Stergiopoulou1, J Meletiadis2, T. J. Walsh3 and E. Roilides1 1 Aristotle University, Thessaloniki, Greece, 2University of Athens, Athens, Greece, 3National Cancer Institute, Bethesda, MD, USA Conclusion: After repeated dosing, POS did not affect CAS or MICA
PK. In this healthy population, oral POS 400 mg BID was safe and well tolerated when given with CAS or MICA.
P280
A novel HPLC method for the measurement of posaconazole levels in serum S. Seaton1, T. A. Vyzantiadis2, R. L. Gorton1 and C. C. Kibbler1 1 Royal Free Hampstead NHS Trust, London, UK, 2Aristotle University, Thessaloniki, Greece Objectives: Posaconazole is a comparatively new and potent triazole
antifungal with an extended broad spectrum activity. It has similar in vitro activity but lower MICs against various fungi than itraconazole and has proved effective in cases when fungi were resistant to itraconazole. It exhibits variable oral bioavailability and in certain clinical settings, the drug concentrations in blood should be determined. The aim of this study was to develop and validate a HPLC method for determination of posaconazole levels in serum, for therapeutic drug monitoring in a clinical mycology laboratory. Methods: An established HPLC method for the determination of itraconazole levels in serum has been in service at the RFH Department of Microbiology for a number of years and this method was adapted for posaconazole measurement. The primary modication was the use of itraconazole as the internal standard as posaconazole is very similar in chemical structure to itraconazole. The two antifungals were prepared in DMSO/Methanol to obtain the respective stock solutions of 5 mg ml1 . Working solutions at concentrations of 10 lg ml-1 were prepared in absolute methanol. A calibration curve with posaconazole concentrations of 0.1, 0.25, 0.5, 1.0, 2.5 and 4.0 lg ml-1 were used for the analytical runs with quality control samples (QC) of 0.4, 2.0 and 5.0 lg ml-1 for the evaluation of the method. The chromatographic separations were achieved using a reverse phase C18 Hypersil column and the HPLC system employed was an Agilent 1100 series consisting of a binary pump, an auto-sampler and an UV detector set at 263 nm. The mobile phase consisted of a solution of ammonium acetate buffer (pH 8.0, 0.01 M) and acetonitrile (35:65 vv). Analytical runs were
Objectives: Immunocompromised patients are at risk for both bacterial and fungal infections. These patients often receive immnosuppressive agents, such as cyclosporine A (CsA), and antifungal therapy concomitantly with antibacterial agents, such as uoroquinolones. Both, antifungal agents and uoroquinolones can exert immunomodulatory effects on human neutrophils. We, therefore, studied the in vitro interactions between antifungal agents and uoroquinolones with or without CsA or neutrophils against C. albicans and A. fumigatus. Methods: Three clinical isolates of C. albicans and A. fumigatus were studied in triplicate against (i) the combination of ciprooxacin, levooxacin and moxioxacin with amphotericin B, caspofungin and voriconazole (or uconazole for C. albicans) and (ii) the combination of ciprooxacin with amphotericin B and CsA, using broth microdilution method. Neutrophils from healthy donors were added in the combination of ciprooxacin with amphotericin B against A. fumigatus. and hyphal damage was assessed by XTT colorimetric assay. The interactions were analyzed using (i) the isobolographic model for the combinations of uoroquinolones with antifungals (ii) the FIC index for ciprooxacin, amphotericin B and CsA combination and (iii) the Bliss model for the combination of ciprooxacin with amphotericin B in the presence of neutrophils. Results: Synergistic interactions [interaction indices (Is) 0.690.83, P < 0.05] were observed between amphotericin B (0.070.31 mg l-1) and either ciprooxacin (0.197.65 mg l-1) or levooxacin (0.4132.88 mg l-1) against C. albicans and A. fumigatus. Synergy (Is 0.560.87, P < 0.05) was also found between voriconazole (0.09 0.14 mg l-1) and ciprooxacin (0.2211.41 mg l-1) and between caspofungin (8.9422.07 mg l-1) and levooxacin (0.145.17 mg l-1) against A. fumigatus. Some antagonistic (Is 1.161.29, P < 0.05) interactions were observed between moxioxacin/levooxacin and uconazole against C. albicans. Synergistic interactions against C. albicans were observed at the combinations of amphotericin B and ciprooxacin and CsA. The MICs of amphotericin B were signicantly decreased (FICmin = 0.13) from 0.250.5 to 0.150.03 mg l-1 at 0.0953 mg l-1 of CsA and 08.5 mg l-1 of ciprooxacin. For A. fumigatus, signicant decreases of MICs (FICmin = 0.37 and FICmax = 0.52) were observed in the presence of 0.060.25 mg l-1,
112
1.53 mg l-1 and 4.2568 mg l-1 of amphotericin B, CsA and ciprooxacin, respectively. Synergy was observed for the combination of amphotericin B and PMNs against A. fumigatus growth at amphotericin B concentrations 0.06 to 0.5 mg l-1. The triple combination of ciprooxacin, ampothericin B and neutrophils was not more effective than the double combination of ciprooxacin and amphotericin B. Conclusions: There are signicant in vitro interactions (i) between antifungal agents and uoroquinolones, (ii) between amphotericin B, ciprooxacin and CsA against C. albicans and A. fumigatus. The selection of the best combination among the antifungal agents and uoroquinolones could potentially improve the outcome of a patient with fungal infection. The combination of amphotericin B and ciprooxacin appears to be equally effective in the presence or absence of neutrophils suggesting equal efcacy in neutropenic and nonneutropenic patients.
P291
Utilization of probiotics for control the prevalence of oral candida in patients complete dentures users K.H. Ishikawa, E. G. da Silva, C. R. Paula, V. H. Matsubara, D. Lopes and A.E.M. Nakamae o o Universidade de Sa Paulo, Sa Paulo, Brazil Background: The probiotic bacteria have the ability to modify the
microbiological balance of the host and reduce the growth of pathogenic such as Candida. Elderly patients are very vulnerable to diseases caused by this yeast. Objective: The objective of this study was demonstrated of the behavior of these bacteria in humans in the control and elimination of oral Candida in the elderly patients. Methods: Forty eight patients complete dentures users, uni or bimaxilares, were included in the research. The study was a randomized double-blind. In a rst moment, the samples were collected by method SWAB in the region of the palate and in culture media Sabouraud Dextrose Agar with cloranfenicol, by 24 to 48 h, for identication and quantication in colony forming units per ml (CFU/ ml) the presence of yeast. Subsequently the patients with positive Candida received the product A or B, A (probiotic) and B (placebo). New collections were performed the fth and tenth weeks of product use. Results: The patients probiotic group had reduced 82% in CFU/ml the presence of Candida. The results obtained with chi-square test, suggested association statistical signicance between the Candida and reduce the use of probiotics P = 0.005. Conclusion: The use of probiotic may be effective in the control, prophylaxis and elimination of Candida in the oral cavity.
P282
Efcacy of azoles against various clinical Aspergillus fumigatus isolates with cyp51A mutations E.M. Mavridou1, R. J. Bruggemann1, W.J.G. Melchers1, J. W. Mouton2 and P. E. Verweij1 1 Radboud University Nijmegen Medical Center, Nijmegen, The Netherlands, 2Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Introduction: Azole resistance in Aspergillus fumigatus (Af) has been
associated with substitutions in the cyp51A gene. These substitutions cause different susceptibility proles and it is unclear if the in vitro activity corresponds with in vivo efcacy. We investigated the correlation between in vitro activity of posaconazole (POS) and voriconazole (VCZ) against clinical Af isolates with L98H, G54W, and M220I substitutions and in vivo survival. Methods: In vitro activity of VCZ and POS was determined based on the CLSI M-38A method. A total of 36 groups (n = 11/group) of CD-1 mice, were randomized into eight groups for the four different Af isolates and were infected i.v. Oral therapy with VCZ at 80, 40, and 10 mg kg-1 and with POS at 128, 64, 16 and 4 mg kg-1 once daily was begun 24 h post challenge for 14 days. Control groups received saline orally. Mortality data was analyzed by the long rank test. Survival was determined on day 14. Additional 48 groups (n = 3/group) have been used to determine the pharmacokinetics (PK). PK index was determined in infected animals by collecting plasma at day 2 of treatment through the orbital vein at eight different time points. Results were analyzed by survival curve analysis and plotting PD indices against survival and tting the Hill equation with variable slope (HEVS) using Prism 5.0. Results: The MICs of POS were: 0.031 mg l-1 (WT), 0.5 mg l-1 (M220I and L98H) and >16 mg l-1 (G54W). For POS the AUC was strongly correlated with dose in a linear fashion from 1 to 16 mg kg-1 (r2 = 0.99). However, higher dosages of 64 mg kg-1 resulted in a slightly less linear relation (r2 = 0.92). Survival curves indicated that exposure responses were obtained for all 4 strains, with increasing exposure needed to obtain the same result if the MIC was higher. Survival best correlated with AUC/MIC ratio; an AUC/MIC survival plot of all four strains indicated a clear sigmoid exposure-response. The HEVS tted the data well with a R2 of 0.93. The ED50 was 321 (95% CI 222.1573.8). The AUC dose correlation of POS is linear for dosages up to 16 mg kg-1. In case of VCZ the MICs were: 0.25 mg l-1 (WT, M220I), 0.125 mg l-1 (G54W) and 2 mg l-1 (L98H).VCZ treatment improved survival of the L98H M220I and G54W groups compared to controls (P < 0.001). However, compared to WT and M220I, the dose-response curve of mice infected with the G54W and L98H isolates were shifted to the right indicating that a higher dose was required to achieve maximum response against these strains (R2 of 0.5034, ED50 of 58, 71, Hillslope of 1, 338). Survival best correlated with AUC/MIC ratio (R2 of 0.99, ED50 of 35.3). Conclusion: There was a clear in vitroin vivo correlation for POS and VCZ.
P292
Posaconazole has superior clinical efcacy and cost-effectiveness than itraconazole for antifungal prophylaxis in allogeneic stem cell transplant recipients: a single-centre experience R.F. Duarte1, B. Patino1, C. Munoz1, M. Arnan1, T. Peralta1, C. Gudiol1, I. Sanchez-Ortega1, R. Parody1, A. Clopes1, 2 J. L. Lopez-Belmonte , F. J. Sabater2 and A. F. de Sevilla1 1 ` Institut Catala dOncologia Hospital Duran i Reynals, Barcelona, a, Spain, 2Schering-Plough Espan Madrid, Spain
Posaconazole (POSA) has shown to be superior to uconazole and/or itraconazole (ITRA) as antifungal prophylaxis in patients with prolonged neutropenia or GVHD. Here, we present our experience with POSA prophylaxis during the neutropenic phase post-allogeneic stem cell transplant (alloSCT). Forty nine consecutive recipients of a rst alloSCT with no prior history of invasive fungal infection (IFI) received either ITRA (n = 16; oral and/or iv; up to May 2007) or POSA (n = 33; 200 mg 8 h-1 oral; from May 2007) for primary antifungal prophylaxis. Clinical outcome and total costs (including medical resource use and drugs) were assessed for 100 days postalloSCT, our established antifungal prophylaxis period. Unit costs were obtained from the hospital pharmacy and the Soikos database, and are expressed in Euros 2008. Compared to the ITRA group, more patients in the POSA group were T-cell depleted (39% vs 0%; P = 0.003), and had a trend towards an increased use of unrelated donor grafts (39% vs 12%; P = 0.055) and reduced intensity conditioning (67% vs 37%; P = 0.053). Otherwise, age (50, 20 68), sex (61% men), disease (35 MDS-AML, 7 lymphoid, 4 CML, 3 ALL), days to neutrophil engraftment (18.2 7.9 days), and the incidence of grade IIIV acute GVHD (33%) were similar in both groups. ITRA patients received oral suspension or IV drug based on their tolerance. POSA patients had no signicant problems with oral compliance or toxicity. The incidence of neutropenic fever (84%) and prolonged (>72 h) neutropenic fever (27%) were comparable in both groups, although the cumulative incidence of antifungal prophylaxis failure (i.e. change from prophylaxis to antifungal treatment) showed a trend towards a reduction in the POSA patients (15%) compared with their ITRA counterparts (31%; P = 0.144). In addition, patients in the POSA group had a lower cumulative incidence of proven or
113
probable IFI (0% vs 13%; P = 0.036), which associated with a higher probability of IFI-free survival (88% vs 56%; P = 0.002) and an improved probability of overall survival (88% vs 63%; P = 0.031) compared with ITRA patients. Total cost per patient up to day +100 were 46,562 in the POSA group (3% conditioning costs, 67% hospitalization and laboratory tests costs, 20% antifungal drug costs and 10% other drug costs) and 45,079 in the ITRA group (6% conditioning costs, 73% hospitalization and laboratory tests costs, 11% antifungal drug costs and 10% other drug costs). Incremental cost-effectiveness of POSA vs ITRA per IFI avoided was 11,858. In conclusion, our experience shows that in addition to neutropenia and GVHD, as established by the registration trials, POSA may be superior to ITRA as primary antifungal prophylaxis during the early high-risk neutropenic period after alloSCT in terms of clinical efcacy and costeffectiveness. In the absence of randomized trials with POSA in this indication, our single-centre study provides supporting evidence for the use of POSA for antifungal prophylaxis in this important clinical setting.
that these fungi give rise to some diverse clinical presentations. The purpose of present study was to isolate and determine the causative fungi of onychomycosis in the population in Tehran, Iran. Methods: Totally nail materials of 504 patients with prediagnosis of onychomycosis during 2005, were examined both with direct microscopy observation of fungal elements in KOH preparations and culture to identify the causative agent. All samples were inoculated on (i) Sabouraud dextrose agar (SDA, Merk) (ii) SDA with 5% chloramphenicol and cycloheximide in dublicate for dermatophyte and (iii) SDA with 5% chloramphenicol triplicate for mould isolation. Results: Out of a total of 504 cases examined, 216 (42.8%), were mycologically proven cases of onychomycosis (144 nger nails, 72 toe nails). Among the positive results, dermatophytes were diagnosed in 46 (21.3%), yeasts in 129 (59.7%) and non dermatophytic mould in 41(19%). Trichophyton mentagrophytes was the most common causative agent (n = 22), followed by Trichophyton rubrum (n = 13), Candida albicans (n = 42), C. spp. (n = 56) and Aspergillus spp. (n = 21). Conclusions: Near the half of clinical suspected fungal nail infections is onychomycosis and yeast is responsible for most of the infections in Iran.
P293
Antifungal prophylaxis in acute myeloid leukemia and high-risk myelodysplastic patients: a single centre experience R.B. Bergantim1, I. Carvalhais1, F. Trigo1 and J. E. Guimaraes2 1 o, Hospital S.Joa Porto, Portugal, 2Universidade do Porto, Porto, Portugal
Invasive Fungal Infection (IFI) is an important cause of mortality and morbidity in leukemic patients undergoing intensive chemotherapy. IFI prophylaxis emerges as a logical approach for these patients. From December 2008 to date, either de novo or relapsed acute myeloid leukemia or high-risk myelodysplastic patients received primary prophylaxis with posaconazole (group 1). Before, those patients received uconazol (group 2) or no prophylaxis (group 3). Our aim was to compare these three approaches over a 6 month period. Patients started prophylaxis on day one of neutropenia (ANC <500 mm3) until recovery (ANC >500 mm3 at least 3 days) and IFI was dened as possible/probable/proven according EORTC criteria. We analysed 40 patients (group 1, n = 20; group 2, n = 12; group 3 = 8) with similar demographic [age, median 53 (1773) years; 62.5% female] and clinical characteristics (acute myeloid leukemia, 92.5%; high risk myelodysplastic syndrome, 7.5%; de novo patients, 77.5%; relapsed patients 22.5%). Median duration of neutropenia was 27 (range 1047) days on group 1, 19 (1550) days on group 2 and 21 (1058) days on group 3. Group 2 received lgastrim 10 ug kg-1 day-1 until ANC recovery. The number of chemotherapy cycles (induction, consolidation and salvage) was 40 on group 1, 15 on group 2 and 24 on group 3. Possible/probable/proven IFI was diagnosed in 2/40 (5%) cycles on group 1, 5/15 (33%) cycles on group 2 and 2/24 (8%) cycles on group3. Empyrical use of antifungal agent due to prolonged febrile syndrome was necessary on 1/40 (2.5%) cycles on group 1, 1/15 (6%) cycles on group 2 and 1/24 (4%) cycles on group 3. The possible/ probable/proven IFI were candidemia (Candida albicans and parapsilosis) on group 1 and suggestive imagiologic pulmonary aspergilosis on groups 2 and 3. Two patients died of respiratory distress on group 3. Although the small follow-up period and discrepancy on the number of cycles by each group, these results suggest that posaconazole prophylaxis is effective in reducing the incidence of IFI in this population of patients.
P302
Epidemiological and aetiological survey of dermatophytosis over the last two decades M. Christodou, S. Vamvacopoulou, E. Diaz, V. Stamouli, C. Bartzavali, S. Vamvakopoulou, G. Dimitracopoulos, E.D. Anastassiou and M. Christodou University of Patras, Patras, Greece Objectives: To determine the prevalence of dermatophytosis and causal distribution in outpatients during a period of 18 years (1991 2008). Methods: A total of 5971 patients with suspicion of dematophytosis were examined for causative fungi. Skin scrapings, hair and nail specimens were collected from relative anatomical sites with clinical signs of infection. After a direct microscopy examination with 30% KOH, specimens were cultured on a Sabouraud Dextrose Agar with chloramphenicol and cycloheximide and on Dermatophytes Test Medium agar plates. Cultures were incubated at 25280 C for 21 days. Identication of dermatophytes was based on microscopic and macroscopic characteristics of colonies and on urea test. Results: Analysis of all specimens examined (5971) was performed chronologically in two periods. More specically, 2962 specimens reected the period 19911999, whereas, 3009 the period 2000 2008. A total of 769 specimens were found positive for dermatophytes, 480 (16, 2%) during the rst period and 289 (9.6%) the second one. During the rst period Microsporum canis was isolated from 280 specimens (59%), Trichophyton rubrum from 169 (35%), Trichophyton mentagrophytes from 19 (4%), whereas, 2% belonged to other species. The respective dermatophytes isolated during the second period were: M. canis 132 (46%), T. rubrum 125 (43%), T. mentagrophytes 28 (10%), whereas, 1% consisted of other species. Concerning the sites of infection found that during the rst period it was 321(67%) originated from skin scrapings, with predominant species M. canis (221 cases, 70%), 57 (12%) from hair, with predominant species M. canis (42 cases, 74%), whereas, 102 (21%) from nail scrapings, with predominant species T. rubrum (86 cases, 84%). On the other hand, during the second period, there were 177 (61%) from skin scrapings with predominant species M. canis (104 cases, 59%), 36 (13%) from hair with predominant species M. canis (28 cases, 78%), and 76 (26%) from nail scrapings with predominant species T. rubrum (64 cases, 84%). Of infected patients, 42 were children, 36 cases (86%) with tinea capitis due to M. canis and 6 cases with tinea corporis due to T. rubrum (4 cases, 9.5%) and T. mentagrophytes (2 cases, 4.5%). Conclusions: The prevalence of dermatophytosis seems to decreases during the last decade as compared to the previous one from 16.2% to 9.6%. Isolation of M. canis also decreased from 59% to 46%, whereas, isolation of T. rubrum increased from 35% to 43%, ndings that characterize developed countries. The most common form of dermat-
P301
Onychomycosis due to non dermatophytic mould in Tehran J. Hashemi1, H. Hosseinjani2 and N. Nasrollahi3 1 TUMS, Tehran, Iran, 2Pharmaco collage, Mashhad, Iran, 3Islamic Azad University/tonekabon branch, Tonekabon, Iran Objectives: Onychomycosis, a common nail disorder results from
invasion of the nail plate by a dermatophytes, yeasts or mould species
114
ophytosis among the children remains tinea capitis due to M. canis (100%). T. rubrum is the most frequent aetiological agent of tinea unguium (81%).
P304
Stress vulnerability and life-contentedness in patient suffering from recurrent vulvovaginal discomfort of Candida origin P. Jilek1, M. Pokorna1, L. Hajkova1, J. Spacek2, J. Kestranek2, V. Buchta2 and P. Klemera1 1 Charles University, Hradec Kralove, Czech Republic, 2Charles University and University Hospital, Hradec Kralove, Czech Republic Objectives: Recurrent vulvovaginal discomfort (RVVD) caused by
Candida is frequent reasons of gynecological interventions. The etiology of this disorder is so far ambiguous. The aim of study is to investigate the role of stress and life-contentedness in RVVD. Methods: Data from women have been obtained through questionnaires with one part comprising a set of questions aimed at life contentment and a degree of stress vulnerability. These questionnaires have been completed in relatively homogenous group of 329 university student (age 1925 years,) with a return ratio was 82.7%. Women were categorized by questionnaire data (symptoms frequency, reported physician diagnosis and therapy) into three groups: obvious RVVD, unclassable (not evaluated more) and control group without of any signs of RVVD. Data were statistically analyzed by means of Students ttest. The questionnaire of life satisfaction includes seven areas. Each area is evaluated by using seven questions. Results: The RVVD group includes 18.7% women highly vulnerable to stress. There are 62.5% respondents who have displayed moderate stress vulnerability. As for the control group, high vulnerability has been noticed in case of 12.9% respondents, whereas 68.8% respondents have claried moderate vulnerability to stress. The average sum value of responses according to the graded scale shows higher scoring for RVVD category in comparison to the control group. This nding suggests higher stress vulnerability of the RVVD category. Women from RVVD group are less satised with their life, their average value of score was 4.65 (out of the 7-point scale) in comparison with the control group (average score 5.17). The maximal differences were found in the area that deals with health. The differences were statistically signicant in all seven items. The most signicant differences were in questions related to bodily health state, immunity, feelings of pain and the rate of illness. In descending order, leisure time, housing, nancial situation, partnership and marriage, family and friends are the other areas with the biggest differences we found out from data analyzed. Conclusion: The results of the study revealed that women suffering from recurrent vulvovaginal discomfort are more vulnerable to stress and less well-content with various spheres of their lives. The ndings cannot prove whether reveal RVVD is the cause or the consequence of stress vulnerability. Acknowledgement: The study was supported by the Research project LC531 of the Ministry of Education, Czech Republic.
increasingly evident that other Non-C. albicans Candida (NCAC) spp such as C. parapsilosis are emerging as important human pathogens. Despite the recognition of C. parapsilosis as an opportunistic pathogen the genetic and virulence factors that enable C. parapsilosis to cause disease remain poorly understood. Increased awareness of such factors is important to facilitate the development of more effective management strategies against this organism. Hence, the objectives of this study were to assess the invasive capability of C. parapsilosis in a Reconstituted Human Oral Epithelium (RHOE) and to detect the expression of SAPgenes during the invasion process. Methods: Candida parapsilosis originally recovered from the oral cavity (n = 2), vagina (n = 2), and urinary tract (n = 2) together with C. parapsilosis ATCC 22019 were used to infect RHOE, which was incubated for 12 and 24 h. One half of the tissue was xed in paraformaldehyde and sectioned. The rehydrated sections (20 lm) were then stained with concanavalin A-Alex 594 and Hoechst nucleic acid dye to assess C. parapsilosis colonization and invasion pattern using Confocal Scanning Laser Microscopy (CSLM). The remaining half of unxed tissue was used for RNA extraction. This RNA together with broth culture extracts were subjected to RT-PCR targeting three secreted aspartly proteinases genes (SAPP1-3). Results: CLSM revealed that all strains colonised the RHOE, although the extent was highly strain dependent as it was the morphology of the C. parapsilosis strains. After 12 h of incubation, C. parapsilosis invaded the upper three cell layers of the epithelium and it was evident some extensive epithelial damage after 24 h infection. Expression of SAP genes was also strain dependent with differences found between infecting and planktonically cultured Candida. Reduced expression of SAPP3, and increased expression of SAPP1 and SAPP2 for infecting strains was detected. Conclusion: This work conrmed the effectiveness of RHOE as an in vitro model to study Candida virulence attributes and conclusively demonstrated that C. parapsilosis, whilst not highly invasive was able to induce signicant damage to the tissue structure. SAPP1 and SAPP2 could be contributing factors in the invasion process and causing RHOE damage.
P306
Fusarium onychomycosis: epidemiologcal and clinical characteristics from a retrospective multicenter study C. Hennequin1, C. Lacroix2, G. Buot3, G. Cremer1, F. Foulet3, C. Viguie4, M. F. de Chauvin2, C. Bachmeyer5, O. Chosidow5 and C. Hennequin1 1 pital St Antoine, Paris, France, 2APHP, Ho pital St Louis, APHP-Ho pital Henri Mondor, Cre teil, France, Paris, France, 3APHP, Ho 4 pital Cochin, Paris, France, 5APHP, Ho pital Tenon, PARIS, APHP, Ho France Objectives: Onychomycoses are one of the most frequent forms of
fungal infections. They are mainly due to dermatophytes but molds seem to be increasingly reported as causative agents, particularly Fusarium spp. However, available data on Fusarium onychomycoses remain scarce. The aim of this study was to specify the incidence of Fusarium onychomycosis through a large multicenter study and to dene their epidemiological and clinical characteristics. Methods: Dermato-mycologists from six Parisian centres were asked to review retrospectively data regarding the respective distribution of fungi isolated from ungual samples during the year 2006. Among patients with positive culture for Fusarium, those having twice a positive pure culture were enrolled for epidemiological and clinical charts review. Results: Among 6355 patients seen in 2006 for suspected onychomycosis, the main etiologic agents were dermatophytes (n = 2557) and Candida spp (n = 141). Fusarium was isolated in 118 patients among which, Fusarium onychomycosis was considered in 29 cases. There were 24 females and ve males. The mean age was 52 18 year-old. No particular predisposing factors were noted except corticosteroid therapy and diabetes mellitus found in one patient each. Three patients had a history of ungual dermatophytosis and four reported a local traumatism. Four patients had involvement of two or more nails. Hand
P305
Characterisation of Candida parapsilosis infection of an in vitro reconstituted human oral epithelium S. Silva1, M. Henriques1, R. Oliveira1, J. Azeredo1, S. Malic2 and D. Williams2 1 Minho University, Braga, Portugal, 2Cardiff University, Cardiff, United Kingdom Objectives: A variety of Candida spp can colonise the oral mucosal
surface and co-exist as harmless commensals. However, if the host becomes debilitated, as seen in individuals with HIV infection, diabetes mellitus or those receiving drug therapy and broad spectrum antibiotics, candidosis can occur. Candida albicans is the most frequently isolated species from oral candidosis, although it is becoming
115
and foot nails were involved in 3 and 32 cases, respectively. In the latter, toe nail was involved in 21 cases. Main clinical forms included leuconychia, either supercial (n = 6) or sub-ungual (n = 11), onycholysis (n = 9) and hyperkeratosis (n = 5). Five patients had an associated paronichia. The course of the disease was chronic in 17 patients. The presence of irregular, vacuolated fungal elements sometimes associated with chlamydospores was noted on sample direct examination for all the cases. Identication of the causative species was only done for seven patients and retrieved Fusarium solani (n = 4) and Fusarium oxysporum (n = 3). At least six different therapeutic regimens were found. They mainly included antifungal treatment single or associated, local amphotericin B (n = 10), bifonazole (n = 3), econazole (n = 2), ciclopyroxolamine (n = 1) or systemic terbinane (n = 1), and chemical avulsion with urea (n = 7). Longterm follow-up was available for only 11 patients but failures appeared in seven cases. Conclusion: Fusarium onychomycoses only represent a fraction of Fusarium isolated from nails. Careful direct examination of the nail samples and clinical presentation may suggest the diagnosis. Further prospective clinical trials are required regarding the high levels of therapeutic failures.
was excellent for ve isolates but one isolate was identied as Candida holmii and for two isolates the proles obtained were dubious and a molecular identication was necessary. Although resistance to itraconazole or other azole antifungal was not observed, two isolates were dose-dependent susceptible to this drug (MIC = 0.25 lg ml-1). Theses isolates were very susceptible in vitro to the rest of the eight antifungal tested, including the other four azole antifungal agents. Conclusions: Saccharomyces cerevisiae vaginitis can have a difcult aetiological diagnosis as conventional mycological methods and new rapid DNA Afrm VPIII test can give results similar to those obtained for Candida infections. Funding: Projects GIC07 123-IT-222-07 (Departamento de Educa n, cion, Universidades e Investigacio Gobierno Vasco), and PI061895/ n 2006 (Fondo de Investigacio Sanitaria del Ministerio de Sanidad y Consumo de Espana).
P308
Molecular analysis of cutaneus Malassezia load in Turkish patients with atopic dermatitis at/in different anatomical cites with different severities M. Onder1, A. Kalkanci1, C. Tevlekci1, M. A. Gurer1 and T. Sugita2 1 Gazi University, Ankara, Turkey, 2Meiji Pharmaceutical University, Teikyo, Japan Objectives: Atopic dermatitis (AD) is a multifactorial disease in
which both hereditary and environmental factors play a role. Malassezia species are also considered to be one of the factors that exacerbate AD, based on the nding that AD patients (but not healthy subjects) have specic serum immunoglobulin E (IgE) antibodies against Malassezia spp. Methods: The diversity of Malassezia ora in Turkish patients with atopic dermatitis of three different clinical severities (mild, moderate, and severe) were compared using quantitative real time polymerase chain reaction (qRT-PCR) method. Fourthy-seven individuals with AD were sampled in this study. Seventy-ve adult healthy individuals were also enrolled in this study. The patients had been diagnosed with AD according to the criteria of Hanin and Rajka. The investigations were conducted according to the Declaration of Helsinki Principles. OpSiteTM (3 7 cm; Smith and Nephew Medical, Hull, UK) was applied rmly to lesion and non-lesion sites of the face including the neck in the AD patients. The scale was weighed immediately and stored at 20C[[AUTHOR: 200C has been changed to -20C. Please check.]] until DNA extraction. DNA extraction was performed and puricated with phenol-chloroform-isoamyl alcohol. Detection of Malassezia DNA by realtime PCR was conducted using the two sets of primers reported previously. Genus specic primers were designed in the internal transcribed spacer 1 and IGS 1 regions of the rRNA gene. Fungal DNA were quantied using a real-time PCR assay with TaqMan probe, using the ABI PRISM 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA). We used Fischers exact test to compare the Malassezia DNA copy numbers between the groups. A P value of <0.05 was considered statistically signicant. Results: The extent of total Malassezia colonization in the skin of 47 AD patients and 75 healthy subjects was determined using real-time PCR. Total number of patients was 122, including 62 female, 60 male patients. Severity of AD was mild in nine patients, moderate in 26 patients, and severe in 12 patients. Quantitative analysis of Malassezia colonization in the AD group and healthy control group was evaluated based on plasmid copy number in a real-time PCR assay. As for the real-time PCR assay, the detection limit was between copy numbers 10 and 100. There was no statisticaly signicant difference between the AD and healthy control groups in terms of Malassezia colonization rate (t = 0.962, 2-tailed = 0.341). In patients with severe AD, Malassezia colonization was not different that in mild and moderate AD patients and healthy individuals, and the differences among them were not statisticaly signicant (P = 0.409). Conclusion: Althougt we hypothesized that the colonization rate of Malassezia in AD patients were higher than that in healthy controls, we could not nd any difference between the groups. Skin diseases should be
P307
Characteristics of vulvovaginitis caused by Saccharomyces cerevisiae and antifungal susceptibility of clinical isolates E. Echeverria-Irigoyen1, E. Eraso2, J. Cano3, M. Gomariz1, J. Guarro3 and G. Quindos2 1 Hospital Donostia, San Sebastian, Spain, 2Universidad del Pas Vasco, Bilbao, Spain, 3Universitat Rovira i Virgili, REUS, Spain
Vulvovaginitis caused by Saccharomyces cerevisiae has been reported but genital infections caused by fungi other than Candida are uncommon. At the Hospital Donostia, S. cerevisiae has been the etiological agent of 0.231.16% of vulvovaginitis during the period 20052008, with an increasing trend since the rst isolation in 2005. Clinical presentation of these infections is indistinguishable from vulvovaginitis caused by species of Candida and mycological diagnosis can be difcult in a clinical laboratory. Objective: To described eight episodes of acute vulvovaginitis caused by Saccharomyces cerevisiae and the difculties found for a correct aetiological diagnosis. Methods: Vaginal specimens were plated onto Sabouraud glucose agar. Detection of microbial DNA (Candida, Gardnerella and Trichomonas) was assessed by the Afrm VPIII test (Becton-Dickinson, USA). Isolates were identied by conventional mycological methods, including growth in chromogenic agars, germ tube and chlamydoconidia production, and carbohydrate assimilation using the API ATB ID32C (Biomerieux, France). S. cerevisiae isolates identities were conrmed by DNA amplication with primers SC1d (5-ACATATGAAGTATGTTTCTATATAACGGGTG-3) and SC1r (5-TGGTGCTGGTGCGGATCTA-3) and sequencing the large subunit (26s) ribosomal RNA gene with primers NL-1 (5-GCATATCAATAAGCGGAGGAAAAG) and NL-4 (5GGTCCGTGTTTCAAGACGG) in a PCR assay. In vitro activities of current (5-uorocytosine, amphotericin B, uconazole, itraconazole, and ketoconazole) and new (caspofungin, posaconazole and voriconazole) antifungal agents were assessed by Sensititre YeastOne 8 (Trek Diagnostic Systems, USA). MICs were determined at the recommended endpoints and time intervals by manufacturers and CLSI M27-A3 document. Results: Eight isolates of S. cerevisiae were yielded on Sabouraud dextrose agar from seven patients with clinical diagnosis of vulvovaginitis. All patients have acute infections and one of them suffered from three episodes by S. cerevisiae and one episode by Candida guilliermondii, during 2008 and from four previous episodes by S. cerevisiae, Candida albicans, Candida lusitaniae, and by a non identied Candida since 2004. Afrm VPIII test was positive with the Candida probe for all the vaginal specimens. All isolates grew as white colonies on ChromID Candida (Biomerieux) and as violet colonies on Candida Chromogenic agar (Laboratorios Conda, Spain). Identication based on API ATB ID32C
116
evaluated carefully in the near future for the presence of microorganisms as an important factor of pathogenesis of the disease. In order to determine the objective feature of the distribution and the character of Malassezia yeast on skin, more comprehensive quantitative studies should be conducted by selecting subjects from various ethnic and geographical backgrounds.
P309
Report of two cases of tinea nigra in the city of Caxias do Sul, RS, Brazil B.C.A. Zoppas, F. C. Casal, C.U.T. Triaca and J. F. Fracasso Universidade de Caxias do Sul, Caxias Do Sul, Brazil
Tinea nigra (TN) is a supercial fungal mycosis caused by a dematiaceous fungus, Hortae werneckii, which affects the palms, stratum corneum and more occasionally, the soles and other body parts. It is characterized by macules with clearly dened, brown to black, noninammatory and asymptomatic hyperpigmentation. This dermatomycosis is also called epidermic keratomycosis, keratomicosis nigricans, pityriasis nigra and microsporiosis nigra, being considered a rare fungal infection, and it occurs most frequently in regions with tropical and subtropical climates. This study describes two case reports of this mycosis in the palm region: a 4-year-old boy who lives in the city of Caxias do Sul, RS and a female, 23-year-old university student living in the city of Farroupilha, RS. Epidemiologic and clinic issues are discussed. These are the only described cases in the northeast region of the State of Rio Grande do Sul, thus showing the rarity of the infection in this geographic area.
drugs administered to the patient. According the CLSI recommendations for moulds (M38-A2), the following MICs were obtained: Voriconazole 0.5 ug ml-1, posoconazole 0.5 ug ml-1, caspofungin >8 ug ml-1 and anidulafungin >8 ug ml-1. The MICs for voriconazole did not evidence a rise and, apparently, the fungus did not develop resistance in vitro over time. Despite these favorable ndings in MIC, the results demonstrate that the fungus was not eradicated, a nding which contrasts with previous reports. Presently, the patient is being treated with topical and oral voriconazole and oral terbinan and she is able to count ngers. The isolation of Paecilomyces lilacinus four times in the setting just described is unique in literature, as far as we know, and does not appear to result from a change in the resistance pattern of the fungus. Rather, it suggests a peculiar relationship of the microorganism with the environment from where it was isolated.
P311
Tinea pedis in patients with tinea unguium in the Athens greater area during 20032008: a retrospective study H. Papadogeorgakis1, K. Theodoridou1, E. Rallis2, V. Athanasopoulou1, E. Frangoulis1 and E. Koumantaki1 1 A. Sygros University Hospital, Athens, Greece, 2Army General Hospital, Athens, Greece Background: Tinea pedis and tinea unguium are common in the
general population worldwide. Their clinical importance relies on the fact that they are a reservoir of chronic infection, produce esthetic disgurement, secondary bacterial infections and usually therapeutic difculties. Objectives: The objective of this retrospective study was to specify the importance of tinea pedis as a risk factor of tinea unguium in patients in the greater Athens area during 20032008. All patients were reviewed from the records of the A Sygros University Hospital for Skin and Venereal Diseases and the Army General Hospital in Athens, Greece. Both hospitals receive patients from Central Greece and the surrounding islands as well as from Athens. Methods: Mycological diagnosis was based on both positive direct microscopical examination with 20% potassium hydroxide and positive culture of nail scrapings, subungal debris and skin samples from the toe web. A total of 705 patients with the clinical diagnosis of onychomycosis mean age 37.5 years non diabetic, non psoriatic and with no obvious clinical orthopaedic disorder were studied retrospectively. Results: Tinea unguium was present in 41.2% of these patients. Men were more affected (53.3%) than women. T. rubrum was the prevailing cause (84.32%) with T. mentagrophytes var. interdigitale as the second following agent (10.22%). E. occosum was present in 1.08% of the cases studied while moulds and yeasts consisted 4.38% of the aetiological agents. Tinea pedis was present in 85.9% of all studied cases. Conclusions: The role of tinea pedis as a risk factor for tinea unguium is obvious and in agreement with many studies worldwide. This indicates the need that patients with tinea unguium should be screened for the presence of tinea pedis. More retrospective and epidemiological studies are needed for Greece to establish the risk factors in the different parts of the country with well evaluated methods for the diagnosis.
P310
Paecilomyces lilacinus keratitis: in vitro susceptibility and clinical outcome M.D. Pinheiro1, R. Portugal1, J. Palmares1 and E. Pinto2 1 o, Hospital S. Joa Porto, Portugal, 2University of Porto, Porto, Portugal
Paecilomyces lilacinus is one of the two most common species of Paecilomyces genus. They occur worldwide as soil saprophytes, insect parasites and agents of biodeterioration. In addition, they belong to a heterogeneous group of lamentous fungi with hyaline hyphae when observed in tissue sections. This species is rarely pathogenic to humans, however Paecilomyces lilacinus is a well-documented agent of eye infection as we report in this case. A 53 year old school teacher was observed in the hospital in February 2008, complaining of photophobia and pain in the right eye for 3 months. She recalled a hit on the eye while walking in the school courtyard before the symptoms began. At the hospital, a fungal keratitis was suspected and treatment with topical and oral uconazol began. However, the diagnosis of fungal keratitis was established only in March 2008, when a sample of the cornea was cultured after the patient was submitted to penetrating keratoplasty for the rst time. From February 2008 to March 2009, the patient was admitted to the hospital ve times and then followed up in an outpatient setting. During this entire period of time, she was submitted three times to penetrating keratoplasty and treated with topical and oral uconazol and voriconazole. Nevertheless, the same Paecilomyces lilacinus strain was isolated four times from eye products (two corneas, one cornea swab and an aquous humor sample) that had been sent to the microbiology laboratory. The fungus grew rapidly in chocolate and blood agar and Sabouraud-chloranphenicol-gentamicin as ocoose white colonies, that became lilac as time passed. On microscopy, a rough walled conidiphore, with metula densely clustered, bearing whorls of two to four phialids, abruptly tapering to narrow necks was observed; the conidia were smooth and ellipsoidal. The four strains isolated were tested for in vitro susceptibility to azoles and echinocandins. The objective was to evaluate the hypothesis of a rise on MICs values and the presence or emergence of resistance to the antifungal
P312
Interdigital tinea pedis in the greater Athens area during 20042008 E. Koumantaki1, E. Rallis2, V. Athanassopolou1, K. Theodoridou1, E. Frangoulis1 and H. Papadogeorgakis1 1 A. Sygros University Hospital, Athens, Greece, 2Army General Hospital, Athens, Greece Background: The prevalence of tinea pedis in the adult population
has been rising steadily in the recent years. The most common clinical type is the interdigital type, affecting the interdigital spaces. Objectives: The objective of this study was to determine the aetiology of tinea pedis in Greek patients in the greater Athens area during the last
117
ve years 20042008. These patients were examined at the Outpatient Departments of the A. Sygros University Hospital for Skin and Venereal Diseases and the Army General Hospital in Athens, Greece. Both hospitals receive patients from Athens and a large area from Central Greece and the surrounding islands. Methods: The assessment of these symptomatic patients was based on the clinical evaluation and the microbiological analysis. As tinea pedis we had dened the presence of clinical symptoms combined with a positive direct microscopical examination and a positive culture of a sample from the toe web and the surrounding skin collected by scraping with a sterile scalpel. Results: Out of 1655 symptomatic patients 640 (38.7%) were found to fulll the above criteria. The prevalence was higher in men (58.5%) than in women. The aetiological agents were as follows: T. rubrum (85.3%), T. mentagrophytes var.interdigitale (10.5%), T. tonsurans (3.1%), E. occosum (1.1%) and Fusarium spp. (1.0%). Corynobacterium minutissimum was the prevailing bacterial pathogen, isolated in 160 cases (9.7%). Conclusions: Dermatophytes seem to be the main cause in the aetiology of tinea pedis interdigitalis in our study. Appropriate therapeutic approach should be considered for these patients since tinea pedis is a dynamic infectious niche for tinea unguium whose diagnosis and treatment present well known difculties.
Conclusions: We found a high agreement of Candida isolates from

sexual partners, suggesting the high possibility of sexual transmition of genital Candida infection. Concerning the timing of the partner visit, partners presenting within 2 weeks after the index case seem to be more likely to test concordant. Restriction endonuclease analysis of mitochondrial DNA is a method that provides interstrain differention rapidly, efciently and reproducibly. It is easy to perform, not very expensive and is applicable to Candida spp other than C. albicans.
P314
Oropharyngeal candidiasis: a 21-year study in a general teaching hospital T. Pelaez, B. Gama, P. Munoz, L. Alcala, G. Ramos, R. Flores, J. Guinea and E. Bouza o Hospital Gregorio Maran n, Madrid, Spain Objective: Oropharyngeal candidiasis is not a life-threatening condition, however, as it can impair nutrition and progress to esophagitis, specic treatment is often required. Moreover, antifungal resistant strains have been frequently reported in adult patients. We aimed to evaluate the incidence, etiology and antifungal resistance patterns of oral candidiasis episodes over a 21-year period in a large teaching institution. Methods: From 1988 to 2008, all episodes of oropharyngeal candidiasis were collected and divided into two periods: (P1) (1988 1997) and (P2) (19982008). Both adult and pediatric populations were analyzed. Antifungal susceptibility patterns of amphotericin B (AMB), uconazole (FZ), itraconazole (IZ), ketoconazole (KZ), voriconazole (VZ), ucytosine (FC), and caspofungin (CAS) were determined by Sensititre YeastOne and/or by the E-test. Results: A total of 3626 episodes from 3116 patients (2681 adult patients and 435 pediatric patients) were recorded. The distribution of episodes and patients during the study period was as follows: P1(1920/ 1650) and P2 (1706/1466). The incidence of oral candidiasis, in P1 and P2 was, respectively, 3.12 and 2.01 cases per 1000 admissions. The incidence of oral candidiasis in adult and pediatric patients during both periods was as follows: 19881997 (2.7/0.44) and 19982008 (1.7/0.34). The distribution of species causing oral candidiasis in P1/ P2 was Candida albicans (77.6%/65.8%), non-albicans Candida(20.7%/ 31.5%), and non-Candida yeasts (1.7%/2.7%). The MICs90 (lg ml-1) of 460 available yeasts were as follows: AB (1), FZ (16), IZ (0.5), KZ (0.5), VZ (0.125), FC (0.25) and CS (0.125). Conclusions: The global incidence of oral candidiasis decreased in our hospital during the study period, especially in the adult population (the incedence of oral candidiasis in HIV-infected patients, during the post-HAART period, has decreased).Most cases of oral candidiasis were caused by C. albicans, although the incedence of other, more antifungal-resistant yeasts increased during the second period. To our knowledge, this is the largest series of oral candidiasis reported to date.
P313
Typing of genital Candida isolates from couples using mitochondrial DNA typing C. Lisboa1, E. Ricardo1, F. Azevedo2, A. R. Costa2, T. Goncalves3, A. G. Rodrigues3 and C. Pina-Vaz3 1 Faculty of Medicine Porto, Porto, Portugal, 2Hospital S.JoAo, Porto, Portugal, 3Faculty of Medicine, Coimbra, Portugal Objectives: Genital candidosis is a common problem worldwide.
Despite therapeutic advances, the reservoir of infection isnt yet fully elucidated. Genital candidosis can be sexually transmitted; neverthless, its contribution to the pathogenesis of Candida spp infection remains unknown. Molecular strain typing is a key tool in investigation. This study aims to compare Candida spp isolates recovered from couples suffering from genital candidosis using mitochondrial DNA. Patients and methods: Men and women attending STD clinic suffering from genital candidosis were recruited. The respective sexual partners were offered clinical and microbiological evaluation. Participants who had taken or applied antifungal therapy within 6 weeks before enrollment were invariably excluded. Specimen collection interval between the visit of the index case and the corresponding partners visit did not exceed 4 weeks. Specimens for yeast culture were collected from the glans penis and inner preputial layer in men and vaginal exsudate in women and cultured in CHROMagar Candida (CHROMagar Company, Paris, France). API 20C AUX galleries (BioMerieux) were additionally used to characterize Candida spp isolates. In order to compare Candida strains a restriction endonuclease analysis of mitochondrial DNA (mtREA) with the restriction enzyme HinfI followed by conventional electrophoresis was performed. Results: From 44 heterosexual couples, the same Candida species was recovered from the genital area just in 14 (31.8%). These 28 participants were aged between 16 and 51 years (mean age 32.7), all of them assumed a single sexual partner during the last 6 months and reported sexual intercourse in the 6 days previous to specimen collection. All the men were uncircumcised. In seven couples both members had genital candidosis and in the remaining couples just the index case had signs and symptoms of candidosis. C. albicans was isolated from 12 couples; C. glabrata and C. parapsilosis were isolated from a couple each. Comparing the mtREA patterns for Candida spp isolates within sexual partners we found agreement of strain types in 11 couples (78.6%). C. glabrata and C. parapsilosis showed the same typing pattern. Different strain patterns of C. albicans were present in 3 couples; in such couples the timing of the partners visit had been four weeks apart from the visit of the index cases. Interestingly, in concordant couples the specimen collection interval had never exceed 2 weeks.
P315
Maxillary sinus fungus ball due to Rhizomucor pusillus : an uncommon clinical presentation of mucormycosis F. Grenouillet, C. Ridoux, F. Floret, G. Reboux, K. Bardonnet, L. Millon and L. Tavernier CHU Jean Minjoz, Besancon, France Objectives: Mucormycosis are highly severe invasive infections occurring mostly in immunocompromised patients such as those with diabetes mellitus or with neutropenia. Non-invasive clinical manifestations due to Mucorales are rarely described. Paranasal sinus fungus ball were mainly due to Aspergillus species, especially Aspergillus fumigatus. We described a case of maxillary sinus fungus ball due to
118
Rhizomucor pusillus, diagnosed by PCR-sequencing of fungal rDNA performed on fresh ball specimen. Case report: A 38 years-old-Caucasian woman was followed for positional dizziness and headhaches. Ear and sinus computed tomographic was realized, showing fortuitously an isolated heterogeneous opacity, ling the left maxillary sinus with a tooth foreign body. She described neither nose disorders (as obstruction, or rhinorea), nor sinus pain or fever episodes. No immunodeciency or diabetes mellitus was reported. A endonasal endoscopic surgical treatment was undertaken with a head middle turbinectomy and a middle left meatotomy. The examination of the sinus showed purulent secretion and a fungus ball. The fungus ball was removed and biopsy of the sinus mucous was performed. The sinus was washed with physiological serum and an Albertini drain was let in place. Microscopical direct examination of the fungus ball showed broad, hyaline, wide-angled branching, pauciseptate irregular fungal hyphae and dehiscent sporangiae, without apophyse. PCR-sequencing of D1 D2 region of large subunit rDNA performed on fresh ball specimen culture revealed a 100% homology with Rhizomucor pusillus. Culture on Sabouraud and Czapeck agar remained negative. The histology found an inammatory recasting mucous but no fungal invasion of mucosa. No antifungal agent was given and post-operative survey did not show any disorders, with endonasal secretions at day 23 negative for fungi by direct examination and culture. Patient did not present precipitins against Rhizomucor pusillus (only one arc with electrosyneresis). Biochemical analysis of ball using atomic absorption spectrometry revealed high concentration of zinc in ball (1.4% w/w). Conclusion: Paranasal sinus fungus ball due to Mucorales are very uncommon. Antifungal agents are not required for management of patient, in absence of invasion of sinus mucosa. rDNA PCRsequencing proved to be a highly sensitive and rapid method to identify etiology of culture-negative sinus fungus ball. High levels of zinc determined in ball proved the role of tooth foreign body (zinc eugenate) in pathogenesis of this maxillary fungus ball.
Conclusions: The prevalence of tinea pedis in Cuban top athletes is

similar to those reported worldwide. Microscopy with blankophor provides a more sensitive screening method. Isolation and identication of the fungal agent is required for the diagnosis of dermatophytosis.
P321
Rhinocerebral mucormycosis as the rst presentation of diabetes mellitus in a 48 year-old-woman F. Abbasi, M. Aghahasani, K. A. Sarhangipour and S. K. Fardkhani Shaheed Beheshti Medical University, Tehran, Iran Background: Rhinocerebral mucormycosis is a devastating, rapidly
progressive and often fatal opportunistic fungal infection predominantly affecting individuals with underlying metabolic or immunological compromise. Patients: We presented a case of rhinocerebral mucormycosis as rst presentation of diabetes mellitus. She had negative history of DM, presentented with coryza, erythema and swelling of left periorbital area 1 week before admission. Symptoms progressed quickly and she developed ptosis and chemosis and epistaxis. Paranasal CT scan showed destrauction of left and right maxillary sinuses with exention to other sinuses, nose, orbit and base of skull. Operation was done. Orbital exenteration, debridment of intranasal mocus membrane and necrotic tissue was done. Despite extensive surgical debridment and medical therapy the patient expired. Conclusion: The diagnosis of rhinocerebral mucormycosis should be considered in the clinical setting of necrotic sinusitis and acute neurologic decit in diabetic patients. Early diagnosis and treatment are crucial factors leading to a good outcome. Keywords: Mucormycosis, rhinocerebral, amphitericin-B, diabetes mellitus.
P316
Prevalence of tinea pedis in top athletes from Cuba T. M. Iglesias-Hernandez1, G. F. Martnez-Machn2, M. R. Perurena-Lancha2, W. Carvajal-Veita1, M. Brito-Galloso3, I. Curfs-Breuker4, J. F. Meis4 and M.T. Illnait-Zaragoz2 1 National Sports-Medicine Institute, Havana, Cuba, 2Instituto Pedro Kouri, Havana, Cuba, 3Enrique Cabrera Hospital, Havana, Cuba, 4Canisius Wilhelmina Hospital, Nijmegen, The Netherlands Background: Tinea pedis is by far the most common fungal disease
of man. Because its high frequency, a prevalence study of this pathology in high-performance athletes from Cuba was studied. Method: A total of 411 sequential subjects from 30 sport disciplines of The National School for Athletes, Havana, Cuba were included. Clinical data and skin scrapings (feets free borders, soles and interdigital region) were collected. All the specimens were examined with KOH 20% and cultured on Sabouraud dextrose agar. Positive cultures were identied by conventional techniques. One hundredthirty skin samples were additionally microscopically examined with blankophor uorescent staining. Results: The presence of fungal-like structures was detected in 34.5% when samples were examined with KOH vs 37.7% when it was done with blankophor. Culture was positive from 69 scrapings (16.8%) and the identied species were Trichophyton rubrum (65.2%), Trichophyton mentagrophytes (15.9%), Epidermophyton occosum (7.2%), Candida albicans, Candida krusei, Candida lusitaniae, (2.9% each one), Rhodotorula sp. and Trichosporon beigelii (1.4% each one). Cases with signs and symptoms and/or positive direct examination when culture was negative were considered as positive (29.4%). Cases without clinical symptoms and signs but with positive culture, independently of direct examination results, were considered as carriers (5.7%). Agreement among all the criteria was achieved in 50 cases (12.1%). Athletics and rowing were the sports with highest prevalence of tinea pedis (6% each).
P322
Experimental systemic cryptococcosis in immunocompetent animal model (BALB/c) and immunodecient (BALB /c-SCID): treatment with amphotericin B and uconazole E. G. da Silva, S. de Souza, C. Viani, G.C.M. Batista, V. K. Perinazzo, R. A. Prates, M. S. Ribeiro and C. R. Paula o IPEN, Sa Paulo, Brazil Background: Cryptococcosis is a disseminated fungal disease that
occurs mainly in immunocompromised individuals, characterized by high mortality rates. This disease is caused by the yeast Cryptococcus neoformans. Systemic spread from a primary focus of cryptococcal infection commonly involves the central nervous system, manifested as meningitis or meningoencephalitis. The treatment of most infections is based on results of the sensitivity in vitro, these results may predict the clinical answer, and however, this answer depends on several factors intrinsic to the antifungal the host as well as pathogen versus host interaction. Objective: This study was evaluate, the efcacy antifungal therapy of uconazole associated with amphotericin B in experimental systemic cryptococcosis in immunocompetent (BALB/c) and immunodecient (BALB/c-SCID). Methods: The animals were inoculated through into the tail vein. The treatment was initiated one day after infection, and animals were treated daily for fteen days. Results: The study demonstrated that immunocompetent and immunodecient animals, treated for thirteen days and fteen days respectively, survived the study period and brain tissue of these animals were free of Cryptococcus neoformans. Conclusion: The present results suggest that the combination amphotericin B (1.5 lg kg-1 day-1) and uconazole (30.0 lg kg1 day-1) was effective in the treatment of cerebral cryptococcosis in two models studied.
119
P323
Effects of IL-6 on the efcacy of liposomal amphotericin B alone or with caspofungin for treatment of murine pulmonary Aspergillus fumigatus infection J. Olson, D. Constable, T. Chang and J. Adler-Moore Cal Poly Pomona, Pomona, CA, USA Objectives: Cytokines of the innate immune response play a critical
role in controlling pulmonary aspergillosis and this response can be modulated by antifungal drugs. The present study was done to examine the immune effects of combining liposomal amphotericin B (AmBisome, AmBi) with caspofungin (Cancidas, CS) or IL-6 for the treatment of Aspergillus fumigatus murine pulmonary infection. Methods: Swiss Webster (SW, Study 1) or DBA/2 (DB, Study 2) mice were immunosuppressed d - 3, d0, d + 2 with 6 mg kg-1 (Study 1) or 2 mg kg-1 triamcinolone acetonide (Study 2) and challenged intranasally with 5.8 X 10ex7 (SW) or 7.0 X 10ex6 (DB) A. fumigatus conidia/ mouse. IV dosing post-challenge was initiated at 2 h for SW and at 24 h for DB: Study 1 (treatments on d0d5), 5% dextrose (D5W), 5 mg kg-1 AmBi, 5 mg kg-1 CS, 5 mg kg-1 AmBi + 5 mg kg-1 CS; Study 2 (treatments on d1d3), D5W, 10 mg kg-1 AmBi, 0.2 lg IL-6 or 10 mg kg-1 AmBi + 0.2 lg IL-6. In both studies, mice (n = 7/ group) were monitored for morbidity for 14 days. In Study 1, blood was collected (n = 5/group) 24 h after the last treatment for cytokine analysis including cIFN, IL1a, IL4, IL6, IL10, IL12, IL17, MIP1a and TNFa. Lung tissue (n = 7/group) was collected for determination of Log10 CFU/g (CFU) 24 h after 6 treatments (Study 1) or 2 treatments (Study 2). Results: In Study 1, IL-6 and cIFN mean levels were signicantly lower (P 0.05) for AmBi (12 ng ml-1 IL6; 52 ng ml-1 cIFN; 100% survival) or AmBi + CS (11 ng ml-1 IL6; 28 ng ml-1 cIFN; 100% survival) vs CS (70 ng ml-1 IL6; 102 ng ml-1 cIFN; 0% survival). IL-6 and cIFN levels for AmBi (100% survival) and D5W (58% survival) were similar. There was also signicantly lower lung fungal burden for AmBi (2.1CFU) or AmBi + CS (2.6 CFU) vs CS (4.7 CFU) or D5W (4.5 CFU) (P 0.01). In Study 2, survival was better for AmBi (72%) vs D5W (0%) (P = 0.002), IL-6 treatment (14%) (P = 0.02) or IL-6 + AmBi (43%); there was also signicantly lower lung fungal burden (P = 0.0006) for AmBi (4.1 CFU) vs IL-6 treatment (7.1 CFU), AmBi + IL-6 (6.9 CFU) or D5W (7.3 CFU). Conclusion: Compared to CS, AmBi generated signicantly lower proinammatory IL-6 and cIFN levels and AmBi was more effective than CS for treating steroid immunosuppressed A. fumigatus murine pulmonary aspergillosis. The efcacy of AmBi was signicantly decreased by the addition of exogenous IL-6.
reduce further the metabolic activity of the fungus with respect to that observed with the most active single drug. AFG at 1 and 5 mg kg-1 day-1, AMB at 1 mg kg-1 day-1 and combination therapies prolonged the survival of neutropenic mice with invasive aspergillosis (P ranging from 0.0013 to 0.0165) (Figure 2). Additionally, AFG given at 5 mg kg-1 day-1, alone or combined with AMB, reduced the kidney fungal burden as measured by either CFU or qPCR (P = 0.0095). Again, the combination was not superior than the most active single drug. Neither single drugs nor combinations were active in brain tissues. Consistent with these data, a decreased number of fungal microabscesses was observed in kidney tissues, but not in brain tissues, of mice treated with AFG at 5 mg kg-1 day-1 alone or combined with AMB. No differences in the number of fungal microabscesses were observed when AMB and AFG were both given alone or in combination at 1 mg kg-1 day-1. Overall, our results showed that the new echinocandin AFG has the potential to be used as a therapeutical treatment against invasive aspergillosis. The combination therapy of AFG with AMB did not improve the outcomes analysed in the present study, although antagonism was never observed.
P325
Posaconazole salvage treatment in pediatric patients: a multicenter survey A.H. Groll1, A. Attarbaschi2, M. Duerken2, J. Garbino2, U. Kontny2, S. Luer2, R. Phillips2, J. Scholz2, T. Wiesel2, H. J. Wagner2, B. Gruhn2 and T. Lehrnbecher2 1 Childrens University Hospital, Mu nster, Germany, 2Childrens Hospital, Vienna, Austria Background: While a pediatric dosage has not been dened,
posaconazole is occasionally used in pediatric patients. We conducted a multicenter retrospective survey to obtain data on pediatric patients considered to require posaconazole salvage therapy. Methods: The survey identied 15 pts. (median age: 10 years; range, 3.617.5; 9 female, 6 male) with hematologic malignancies (10), marrow failure (one), solid tumor (one), soft tissue trauma (one), CGD (one), and diabetes mellitus (one) who received posaconazole for proven (nine) or probable (six) invasive fungal infections [zygomycosis (seven), mold infection (four), aspergillosis (two), chronic disseminated candidiasis (two)]. Posaconazole was administered until intolerance or maximum efcacy at dosages individually determined by the responsible physician for refractory infection (eight), intolerance of other agents (one) or as best therapeutic option (six) following pretreatment for a median of 22 days (r, 4319). Results: The 15 patients received posaconazole for a median of 32 days (r, 4 to 262) as single agent (six) or in combination (nine).
P324
Anidulafungin in combination with amphotericin B against Aspergillus fumigatus E. Spreghini, G. Scalise and F. Barchiesi ` Universita Politecnica delle Marche, Ancona, Italy
We investigated the in vitro and in vivo effects of anidulafungin (AFG) alone and in combination with amphotericin B (AMB) against three clinical isolates of Aspergillus fumigatus. The minimum effective concentrations (MECs) of AFG ranged from 0.001 to 0.002 mg l-1 and were signicantly lower than AMB MICs (P < 0.0001). When the drugs where given in combination, the indifference (i.e.: fractional inhibitory concentration index >0.50 and 4.0) was the only type of interaction observed by the checkerboard method. MFCs values for AFG were all >16 mg l-1, while AMB MFCs ranged from 0.5 to 2.0 mg l-1. Although the MFCs of the two drugs given in combination were statistically lower than those yielded by AFG alone (P < 0.0001), they were not lower than those observed for AMB alone, indicating again an indifferent type of interaction. The metabolic activity measured by the XTT assay (Figure 1) showed that AFG was active, generally in a dose-dependent manner, against conidia, but not against hyphae. The combination approach did not
120
Results: Caspofungin MICs for C. albicans and C. krusei isolates were

0.06 and 0.25 mg l-1, respectively. PAFE for C. albicans isolates were >48 h. PAFE was never observed for C. krusei. Lethality of the control mice infected with C. albicans was >90% within 12 days. All used caspofungin regimens improved the survival (P < 0.0001). For isolates 10920 and 4780, the most benecial caspofungin doses were 1 mg kg1 day-1 and a single 5 mg kg-1, respectively. In case of isolate 4780 10 mg kg-1 single caspofungin dose was the best regimen. Lethality of the control mice infected with C. krusei was 50100%. The 1 mg kg-1 daily dose signicantly increased the survival for all three C. krusei isolates. In case of isolates 5029 and 4363 single doses of 5 and 10 mg kg-1 caspofungin signicantly increased the lethality (logrank test for trend: 0.0357 and 0.0034, respectively). In case of mice inoculated with C. krusei isolate 5029 but not with isolates 4363 and 27393 the kidney tissue fungal burdens signicantly decreased for all doses when compared to the untreated controls (P = 0.0204). Conclusions: Efcacy of the single high dose caspofungin treatment against Candida species may be species-dependent; long PAFE duration is a good predictor for efcacy. The median daily dosage was 21 mg kg-1 (r, 4.833.3). In none of patients was therapy discontinued due to adverse events. Clinical adverse events were mostly mild to moderate and observed in 11 patients (73%). Relevant increases in laboratory parameters to 3 the baseline value at end of treatment were limited to serum bilirubin (3 pts.) and SGOT (1 pt). Complete or partial responses were observed 4/7 pts. with zygomycosis, 3/4 pts. with invasive mold infections, 1/2 pts. with invasive aspergillosis and 1/2 pts. with CDC. Altogether, 6 patients had a complete and 3 patients a partial response, accounting for an overall response rate of 60%. Overall survival at three months post start of treatment was 73% (11/15). Conclusion: Posaconazole displayed favorable safety and tolerance and was useful for management of individual pediatric patients with invasive infections.
P327
In vivo efcacy of amphotericin B, uconazole, voriconazole and caspofungin against Candida orthopsilosis in a neutropenic mouse model L. Majoros1, J. Szilagyi1, S. Bayegan1, A. Tavanti2, A. Kemeny-Beke1, G. Kardos1, A. Adnan1 and R. Gesztelyi1 1 ` University of Debrecen, Debrecen, Hungary, 2Universita di Pisa, Pisa, Italy Objectives: Candida orthopsilosis is a newly described Candida species. We determined the in vivo efcacy of amphotericin B, uconazole, voriconazole and caspofungin against C. orthopsilosis. Methods: CP 85 and CP 25 C. orthopsilosis isolates were used in the in vivo experiments. BALB/c male mice were immunosuppressed with a single 200 mg kg-1 cyclophosphamide dose. In the tissue burden experiments, mice were infected intravenously with 56 106 CFU/ mice in a 0.2-ml volume. There were seven to eight animals in each control and treatment group. Intraperitoneal treatment with 1 mg kg-1 amphotericin B (Fungizone), 1, 5 and 10 mg kg-1 uconazole (Mycosist), 6 mg kg-1 voriconazole (Vfend) and 1 mg kg-1 caspofungin (Cancidas) daily doses was started after 24 h after inoculation and continued for 5 days. Drug efcacy was assessed by determining the number of CFUs per kidney pair. For statistical analysis we used KruskalWallis test followed by Dunns post testing. Results: All mice survived in the experiments. Fluconazole at 1 and 5 mg kg-1 doses was ineffective (P > 0.05) against both isolates (MIC values were 8 mg l-1 for both). Fluconazole at 10 mg kg-1 dose, voriconazole (MIC values for both isolates were 0.12 mg l-1) and amphotericin B (MIC values for CP 25 and CP 85 were 0.25 and 0.5 mg l-1, respectively) signicantly decreased the kidney tissue fungal burdens in case of both isolates (P < 0.05). Caspofungin was effective only in case of CP85 (MIC was 0.12 mg l-1 for both isolates) (P < 0.001). Conclusions: C. orthopsilosis seems to possess decreased susceptibility to uconazole in vivo. Voriconazole and amphotericin B might be good alternatives for invasive infections caused by C. orthopsilosis. To assess the efcacy of caspofungin further studies are required.
P326
Correlation between postantifungal effect and the efcacy of single 5 and 10 mg kg-1 caspofungin doses for treatment of disseminated candidiasis in a neutropenic mouse model L. Majoros, S. Bayegan, A. Kemeny-Beke, J. Szilagyi, G. Kardos, A. Adnan and R. Gesztelyi University of Debrecen, Debrecen, Hungary Objectives: It was suggested that the efcacy of the same cumulative dose echinocandins administered as a single dose is comparable to the traditional regimen of smaller daily doses. This is supported by the in vitro ndings that echinocandins show long postantifungal effect (PAFE) duration against some Candida species. Methods: Three C. krusei (4363, 5029, 27393) and three C. albicans (17471, 10920 and 4780) clinical isolates were used in the in vitro and in vivo experiments. MICs and PAFEs were determined for all isolates. BALB/c female mice were immunosuppressed with one (C. albicans) or two 200 mg kg-1 cyclophosphamide doses (C. krusei). In the lethality experiments mice were infected intravenously with 105 or 107 cfu/mice in a 0.2-ml volume with C. albicans or C. krusei, respectively. Four groups of ten mice for each isolate were assigned as follows: no treatment, 1 mg kg-1 daily dose for 5 days, a single dose of 5, and 10 mg kg-1 caspofungin (Cancidas). Intraperitoneal caspofungin treatment against C. albicans and C. krusei was started after 10 and 24 h after the inoculation, respectively. Tissue burden experiments were performed with C. krusei isolates, using seven to eight mice inoculated intravenously with 12 106 CFU/mouse both in the treatment and the control group. Otherwise we used the same conditions as in the lethality experiments. Drug efcacy was assessed by determining the number of CFU per kidney pair. Survival of mice was described by KaplanMeier survival curve. To assess the efcacy of caspofungin, logrank test was performed on all groups as well as on the caspofungin treated groups only. In tissue burden experiments control and treated groups were compared with KruskalWallis test followed by Dunns post testing.
P328
In vitro effectiveness of photodynamic therapy with low potency ArGaAl laser for the elimination of Candida albicans in dental root canals C.Y. Koga-Ito1, L. D. Oliveira1, L. P. Freitas1, C. T. Carvalho1, A. O. Jorge1, M. C. Valera1 and C. Silva2 1 o o Sa Paulo State University, Sa Jose Dos Campos, Brazil, 2Federal University of Bahia, Vitoria Da Conquista, Brazil
121
Objective: Candida albicans has been associated with refractory

endodontic infections. The several virulence factors of this species associated to its ability to invade dentinal tubules and resistance to commonly used intracanal medicaments, such as calcium hydroxide, may explain its association with cases of refractory root canal infections. Other factors, such as presence of Enterococcus faecalis or endotoxins, have been also related to failure of endodontic treatment. Antimicrobial photodynamic therapy has been cited as a promising alternative for the treatment of some infections. No previous study on the effectiveness of this therapy on C. albicans in dental root canals is found in the literature. The aim of this study was to evaluate the effectiveness of antimicrobial photodynamic therapy (PDT) using ArGaAl low potency laser with azulene in the elimination of intracanal single-species biolm of C. albicans ATCC18804 and multi-species biolm (C. albicans, E. faecalis ATCC29212 and Escherichia coli ATCC25922). Methods: (Ethic Committee approval 060/2005) Forty freshly extracted human dental roots standardized in 16 mm and properly prepared were used. The specimens were contaminated by microbial suspensions in vitro and incubated during 14 days. Culture medium was refreshed every 48 h. After the period of contamination, the specimens were divided into two groups: PDT (n = 10 single species biolm, n = 10 multi-species) and control (n = 10 single species biolm, n = 10 multi-species). In the PDT group, teeth were instrumented (Kerr #3580) and then the root canal system was incubated with 25% azulene gel for 5 min followed by exposure to 660-nm diode laser light delivered into the root canal via a 200-micro ber. Specimens included in control group were only instrumented. Microbial examination of the root canal content was performed after the end of contamination period, immediately after the instrumentation/PDT and after 7 days by plating method. Results: PDT resulted in signicant lower counts of C. albicans in relation to the control (P = 0.007) immediately after the therapy. After 7 days of incubation, these counts increased in both PDT and control groups, with no signicant difference between them (P = 0.071). Regarding the multi-species biolm, the immediate effect was observed and evidenced by a signicant reduction in relation to the control (P = 0.044). After 7 days, the counts of C. albicans were signicantly higher in PDT group in relation to the control (P = 0.001). Conclusion: PDT was effective for immediate reduction of C. albicans in root canals enhancing the effect of instrumentation both in single and multi-species biolm testing. However, after 7 days the number of yeasts was equal to the control in both single and multi-species biolm, suggesting that the therapy has only supercial effect.
tion except low dose corticosteroids (CS). Primary endpoint was global success at 6 months (M6) dened as complete or partial radiological response and mycological eradication. Diagnosis of CPA and response to VORI were conrmed by a data review committee. Results: Forty-one of forty-eight included patients were conrmed CPA: 22 chronic cavitary pulmonary aspergillosis (CCPA) and 19 chronic necrotizing pulmonary aspergillosis (CNPA) including 1 tracheo-bronchial aspergillosis. A. fumigatus was isolated in all cases. Mean age was 58 (2581) and BMI 19 (1339). Prior underlying pulmonary disease was reported in 40 cases (18 COPD, 11 tuberculosis). 15 patients received inhaled (12) and/or systemic (6) CS. By M6, global success was achieved in 13/41 (32%) (10 CNPA vs 3 CCPA, P = 0.01). Stability was observed in 18 patients and progression in 1. At EOT, global success was achieved in 18/41 (11 CNPA, 7 CCPA). 5 patients had died none related to CPA, 7 were withdrawn for safety, 1 was lost to follow-up, 3 have relapsed. Conclusions: VORI conrms to be an efcient drug for primary therapy of CPA especially in chronic necrotizing forms with an acceptable safety prole. Chronic cavitary pulmonary aspergillosis requires over 6 months of therapy.
P330
Caspofungin and liposomal amphotericin B used singly and in combination for the treatment of experimental cerebral aspergillosis I. Ullmann, R. Strahm, S. L. Leib and S. Zimmerli University of Bern, Bern, Switzerland Objectives: Central nervous system aspergillosis is an often fatal complication of invasive Aspergillus infection. Effective therapy is lacking. To evaluate the efcacy of antifungal drugs against Aspergillus we used an established model of cerebral aspergillosis in nonimmunosuppressed infant rats that is 100% lethal for untreated animals. Methods: Eleven-day-old non-immunosuppressed male Wistar rats were infected by intracisternal injection of 10 ll of a conidial suspension containing 7.18 log10 colony-forming units (CFU) of Aspergillus fumigatus. Treatment started 22 h after infection and was given once daily for 10 days. Regimens were Caspofungin (CAS) 1 mg kg-1 day-1 i.p., liposomal Amphotericin B (L-AmB) 5 mg kg-1 day-1 i.p. and both drugs combined at the same dosage. Infected controls were given NaCl 0.9% or glucose 5% i.p. Seriously ill animals were sacriced for ethical reasons. Animals were sacriced at predetermined time points by an overdose of Pentobarbital and brains were perfused with 20 ml PBS before homogenization and quantitative fungal culture. In survival experiments brains were examined at the time of death. To more closely monitor cerebral fungal burdens, both treated and untreated animals were sacriced at 2, 3, 5, and 11 days after infection. Animals sacriced for ethical reasons were excluded from this part of the study. Results: (i) Survival experiments: All untreated controls (n = 14) developed cerebral infection that resulted in death within 311 days. Median survival time was 4.4 days. Treatment with CAS (n = 20) alone and combined with L-AmB (n = 21) signicantly increased survival time to 10.5 and 9.3 days, respectively. There was no signicant difference between treatment regimens. Cerebral fungal burden declined over time in all animals including untreated ones; interestingly, there was no signicant difference between controls and treated animals. (ii) Time course of cerebral fungal load: Untreated controls showed highest cerebral fungal burden on day 3 after infection (5.5 log10 CFU g-1, n = 6). No animals survived until day 5. In the treatment groups cerebral fungal burden was highest on day 2 after infection (CAS: 5.7 log10 CFU g-1, n = 40; L-AmB: 5.8 log10 CFU g-1, n = 18; CAS + LAmB: 5.8 log10 CFU g-1, n = 23) and declined over time. After 10 days of treatment, brain cultures were found sterile in 2/40 animals treated with CAS, 1/18 animals treated with L-AmB and 2/23 animals of the combination group. Again there was no signicant difference in cerebral fungal burden between treated animals and controls. Conclusions: CAS alone and in combination with L-AmB signicantly prevents mortality in a lethal model of cerebral aspergillosis. Cerebral fungal burden, which was similar in treated and control
P329
Voriconazole for primary therapy of proven chronic pulmonary aspergillosis: a prospective multicenter trial C. Hennequin1, J. Cadranel2, B. Philippe3, A. Bergeron4, E. Bergot5, P. Chanez6, V. Cottin7, T. Jeanfaivre8, C. Godet9, M. Pineau10 and P. Germaud11 1 pital Universitaire Saint-Antoine, Paris, France, 2Ho pital Tenon, Ho pital Foch, Paris, France, 4Ho pital Saint-Louis, Paris, France, 3Ho pital Co de Nacre, Caen, France, 6Ho te pital Paris, France, 5Ho pital Louis Pradel, Arnaud de Villeneuve, Montpellier, France, 7Ho pital Universitaire, Angers, France, 9Ho pital La Lyon, France, 8Ho pital Miletrie, Poitiers, France, 10Pzer Inc, Paris, France, 11Ho Laennec, Nantes, France Background: Antifungals are recommended for chronic pulmonary
aspergillosis (CPA), but prospective trials designed to evaluate the efcacy of voriconazole (VORI) on CPA are lacking. Methods: From July 2005 to May 2007, a phase II open multicenter trial evaluated VORI (200 mg BID) given for 612 months in CPA with 6 months follow-up after end of treatment (EOT). Inclusion criteria were compatible chest CT scan and/or endoscopic lesion, both positive culture of respiratory sample and serological testing for Aspergillus and no antifungal within the past 6 months. Exclusion criteria were simple aspergilloma, ABPA, immunocompromised condi-
122
animals, does not correlate with mortality. The hosts immune reaction may thus be key in determining mortality. Experiments are ongoing to characterize the effects of antifungal drugs on the hosts local immune response to cerebral aspergillosis.
Material and methods: We obtained yeast with resistance to

uconazol from pediatric patients from the hospital Fray Antonio Alcalde. The inoculum was standardized and the Minimal Inhibitory Concentration was tested by microdilution method In RPMI medium. We use 20 rats of the wistar strain with a weight of 250300 g previously anesthetized and catheterized at the arterial carotid 48 h after the rats were inoculated with a inoculum of 1.5 106 CFU. We evaluated two groups: one group with treatment of caspofungin and a second group without treatment they were sacriced 6 days after inoculation in order to isolate vegetations for microbiological and histological assays. Results: We got a MIC of 0.16 lg/ml for the strains obtained from the hospital and we got a signicative difference between the hemocultures from the group without treatment and the group with treatment (P < 0.05). With the culture of brinoids vegetations we observed a markedly difference between the groups. The group without treatment had a mean of 5000 CFU and the rats with treatment was around of 25 CFU (P 0.05), just a one rats observed some yeast by in damage state. Conclusion: Caspofungin has an inhibitory effect against C. albicans in fungal endocarditis and show the capacity of cross the barrier of the vegetation.
P331
Resistant Candida glabrata involved in chronic vertebral osteomyelitis; a case report with favorable outcome I. Anyfantis1, P. Tofas1, A. Toskas1, M. Drogari-Apiranthitou1, A. Stoupis2, G. L. Daikos1 and G. Petrikkos1 1 Research Laboratory for Infectious Diseases and Antimicrobial Chemotherapy G.K. Daikos, National and Kapodistrian University of Athens, Athens, Greece, 2Athens Medical Center, Athens, Greece Introduction: Vertebral osteomyelitis due to Candida species is very
rare. Risk factors include the presence of a central venous catheter, antibiotic use, immunosuppression, and injection drug use. We present a case of a female patient with mild diabetes with chronic osteomyelitis of the spinal column after spondylodesis surgery. Case report: The patient, a 74 year old diabetic female, had undergone an extensive spondylodesia operation, due to degenerative disorders of the spinal column, 3 years prior to admittance in our hospital. After having suffered several infections of the operated area with MRSA and fungi, she was treated with surgical debridement and antimicrobial therapy. Despite several regimens of antifungal therapy she developed multiple uid collection cysts around the operated area from which Candida glabrata was consistenly isolated. The C. glabrata strain was resistant to uconazole, itraconazole and posaconazole and sensitive to amphotericin B, voriconazole, caspofungin and 5-uocytosine. After complete removal of the metal parts of spondylodesis and treatment with liposomal amphotericinin B (L-ampB) in combination with caspofongin for a month followed by a combination of L-ampB with 5- uocytosine for over 4 months, the cysts decreased in size and cultures were negative. A new spondylodesis and drainage of the multiple cysts took place and the patient responded remarkably well after surgery. She was released following a progressive mobilization program without any further antimicrobialor antifungal treatment. Conclusions: Candida glabrata strains are usually refractory to several antifungals and infections are hard to treat. In our case, both surgery and antifungal therapy with L-amp B and caspofungin followed with combination with 5- uocytosine proved to be a successful combination.
P333
Experimental models of pulmonary aspergillosis in domestic birds S. Thierry, G. Le Loch, E. Mazzola, A. Desouter, F. Femenia, D. Huet, M. Deville, R. Chermette, J. Guillot and P. Arne Afssa Lerpaz, Maisons-Alfort, France
Aspergillosis has been described worldwide in a very large number of avian species. Turkey poults in large connement houses, quails, marine birds that are brought into rehabilitation, captive raptors, and penguins being maintained in zoological parks commonly die from aspergillosis. In turkey poults, aspergillosis leads to consequential economic losses related to mortality, low productivity, and carcass condemnations at slaughter inspection. Aspergillosis occurs in immunocompromised birds or in birds exposed to overwhelming numbers of fungal spores. In most cases, the primary site of development is the respiratory tract (air sacs and lungs) but blood dissemination frequently occurs leading to macroscopic lesions in a wide range of organs or tissues. The use of experimental models is required to better understand hostpathogen interactions and develop diagnostic and therapeutic tools. Experimental aspergillosis has already been described in various domestic species, especially chickens and turkeys. The aim of the present study was to develop avian experimental models. We tested several inoculation routes: injection of conidia into a thoracic air sac and inhalation of conidia. In the latter model, ve-day-old chicks (SPF Leghorn PA12) were used and exposed to different concentrations of conidia. After inoculation, the number of inhaled conidia was estimated by grinding of lungs and seeding onto Malt medium. The number of conidia in lung was determinated immediately after inoculation and on each sacried animals. During all the experimentation, the animals were maintained in ltering cages, in a specic chamber in depression. All the chicks were weighed and examined daily from +6 to +168 hours post challenge. Observations included the monitoring of clinical signs, feeding and drinking behaviour.
P332
Evaluation of therapeutic effect of caspofungin in an animal model of infective endocarditis by candida albicans G. Becerra, C. Rivera, A. Plascencia, F. Velarde, M. Domnguez and I. Hernandez Ivan Departamento de Microbiologa y patologa, CUCS, Mexico Background: Candida albicans is the most isolated pathogen in disseminated fungemies like endocarditis. The endocarditis involve the vegetation formation which is barrier to antimicotical to the access to target molecules yield fails in treatment, therefore, the endocarditis model in a good systems to evaluate the efcacy of antimicrobians in adversals conditions. Caspofungin has been proved in many disseminated fungemias by not in endocarditis. The objective of the study was to evaluate the inhibitory effect of caspofungin in an animal model of infective endocarditis by C. albicans.
123

Poster Presentations: 2009 The Authors Journal Compilation 2009 Blackwell Verlag GMBH - Mycoses, 52 (Suppl. 1), 29-123

Caricato da

Informazioni sul documento

Descrizione originale:

Titolo originale

Copyright

Formati disponibili

Condividi questo documento

Condividi o incorpora il documento

Opzioni di condivisione

Hai trovato utile questo documento?

Questo contenuto è inappropriato?

Copyright:

Formati disponibili

Poster Presentations: 2009 The Authors Journal Compilation 2009 Blackwell Verlag GMBH - Mycoses, 52 (Suppl. 1), 29-123

Caricato da

Copyright:

Formati disponibili

Poster Presentations

Acknowledgement: The authors acknowledge the Fundacao para

Conclusions: (i) Presence of serum tends to alter the MICs of all

Methods: We studied a global of 55 isolates of Aspergillus spp. (21

Table 1 GM: geometric mean

Conclusion: In our study, Etest method showed to be rapid and easy

Conclusions: POS was the most active drug against these A.

F. pedrosoi AmB Range MIC50 MIC90

Acknowledgments: This investigation was supported by grants

Methods: During a period of thirteen months blood samples taken

Figure 1. Denddrogram, MALDI-TOF identications

Conclusions: Both BG and GM are non-invasive tools for the

Conclusions: Candidemia is predominantly caused by C. albicans

Methods: Environmental samples are collected prospectively over a

Results: In the study period, 83 candidemia episodes were identied.

zoophilic M. canis was observed, and tended to exceed that of T. violaceum.

Figure 1 Primary cutaneous zygomycosis of right abdomen.

Conclusion: There is an urgent need for high index of clinical

Figure 1 Candidemia in TWMU 20042007.

Figure 2 Antifungal susceptibility.

Figure 3 MIC correration of antifungal agents.

Figure 4 Survival curve.

Species Candida albicans Candida glabrata Candida tropicalis Candida parapsilosis

2004 (%) 67.8 11.7 7.7 3.9

2005 (%) 63.7 19.2 5.6 2

2006 (%) 64.5 16.5 8.5 4

2007 (%) 73.8 11.9 5.7 4.3

2008 (%) 66 15.7 6.7 5.6

Conclusion: The candidemia incidence in Norway has increased

Conclusions: In endocarditis, apoptosis could be linked to the ability

Comments: Congenital candidiasis, and especially meningitis is very

Case: A set of female dizygotic twins, were born 32 weeks of

Case report: A 79-year-old woman presented with one-month

Conclusions: With early initiation of L-AMB in patients with

Objectives: Aspergillus species can be isolated from respiratory

Methods: Identication of A. fumigatus or A. avus was performed by

Objective: To assess the efcacy of voriconazole when used as

Figure 1 RAPD patterns with primer JWFF of Candida spp.

Table 1 MIC distribution of itraconazole

Table 2 AUC/MIC of Itraconazole in patients of mol

Figure 1 AUC/MIC of itraconazole against aspergill.

Conclusion: Following a single-dose administration of 400 mg POS

Methods: This was a phase 1, open-label, parallel, randomized PK

Conclusions: We found a high agreement of Candida isolates from

Conclusions: The prevalence of tinea pedis in Cuban top athletes is

Results: Caspofungin MICs for C. albicans and C. krusei isolates were

Objective: Candida albicans has been associated with refractory

Material and methods: We obtained yeast with resistance to

Potrebbero piacerti anche