ISSN 1007-9327 (print) ISSN 2219-2840 (online)

World Journal of Gastroenterology

World J Gastroenterol 2011 January 28; 17(4): 409-544

www.wjgnet.com

Editorial Board
2010-2013
The World Journal of Gastroenterology Editorial Board consists of 1144 members, representing a team of worldwide experts in gastroenterology and hepatology. They are from 60 countries, including Albania (1), Argentina (8), Australia (29), Austria (14), Belgium (12), Brazil (10), Brunei Darussalam (1), Bulgaria (2), Canada (20), Chile (3), China (69), Colombia (1), Croatia (2), Cuba (1), Czech (4), Denmark (8), Ecuador (1), Egypt (2), Estonia (2), Finland (8), France (24), Germany (75), Greece (14), Hungary (10), India (26), Iran (6), Ireland (7), Israel (12), Italy (101), Japan (112), Jordan (1), Kuwait (1), Lebanon (3), Lithuania (2), Malaysia (1), Mexico (10), Moldova (1), Netherlands (29), New Zealand (2), Norway (11), Pakistan (2), Poland (11), Portugal (4), Romania (3), Russia (1), Saudi Arabia (3), Serbia (3), Singapore (10), South Africa (2), South Korea (32), Spain (38), Sweden (18), Switzerland (11), Thailand (1), Trinidad and Tobago (1), Turkey (24), United Arab Emirates (2), United Kingdom (82), United States (249), and Uruguay (1).

HONORARY EDITORS-IN-CHIEF James L Boyer, New Haven Ke-Ji Chen, Beijing Martin H Floch, New Haven Emmet B Keeffe, Palo Alto Geng-Tao Liu, Beijing Lein-Ray Mo, Tainan Eamonn M Quigley, Cork Rafiq A Sheikh, Sacramento Nicholas J Talley, Rochester Ming-Lung Yu, Kaohsiung PRESIDENT AND EDITOR-INCHIEF Lian-Sheng Ma, Beijing ACADEMIC EDITOR-IN-CHIEF Tauseef Ali, Oklahoma City Mauro Bortolotti, Bologna Tarkan Karakan, Ankara Weekitt Kittisupamongkol, Bangkok Anastasios Koulaouzidis, Edinburgh Bo-Rong Pan, Xian Sylvia LF Pender, Southampton Max S Petrov, Auckland George Y Wu, Farmington STRATEGY ASSOCIATE EDITORS-IN-CHIEF Peter Draganov, Florida Hugh J Freeman, Vancouver Maria C Gutirrez-Ruiz, Mexico Kazuhiro Hanazaki, Kochi Akio Inui, Kagoshima Kalpesh Jani, Baroda Javier S Martin, Punta del Este

Natalia A Osna, Omaha Wei Tang, Tokyo Alan BR Thomson, Edmonton Harry HX Xia, Hanover Jesus K Yamamoto-Furusho, Mexico Yoshio Yamaoka, Houston ASSOCIATE EDITORS-IN-CHIEF You-Yong Lu, Beijing John M Luk, Singapore Hiroshi Shimada, Yokohama GUEST EDITORIAL BOARD MEMBERS Chien-Jen Chen, Taipei Yang-Yuan Chen, Changhua Jen-Hwey Chiu, Taipei Seng-Kee Chuah, Kaohsiung Wan-Long Chuang, Kaohsiun Ming-Chih Hou, Taipei Kevin Cheng-Wen Hsiao, Taipei Po-Shiuan Hsieh, Taipei Tsung-Hui Hu, Kaohsiung Wen-Hsin Huang, Taichung Chao-Hung Hung, Kaohsiung I-Rue Lai, Taipei Teng-Yu Lee, Taichung Ching Chung Lin, Taipei Hui-Kang Liu, Taipei Hon-Yi Shi, Kaohsiung Chih-Chi Wang, Kaohsiung Jin-Town Wang, Taipei Cheng-Shyong Wu, Chia-Yi Jaw-Ching Wu, Taipei Jiunn-Jong Wu, Tainan Ming-Shiang Wu, Taipei

Ta-Sen Yeh, Taoyuan Hsu-Heng Yen, Changhua Ming-Whei Yu, Taipei MEMBERS OF THE EDITORIAL BOARD

Albania Bashkim Resuli, Tirana

Argentina Julio H Carri, Crdoba Eduardo de Santibaes, Buenos Aires Bernardo Frider, Buenos Aires Carlos J Pirola, Buenos Aires Bernabe Matias Quesada, Buenos Aires Silvia Sookoian, Buenos Aires Adriana M Torres, Rosario Maria Ines Vaccaro, Buenos Aires

Australia Leon Anton Adams, Nedlands Richard Anderson, Victoria Minoti V Apte, New South Wales Andrew V Biankin, Sydney Filip Braet, Sydney Christopher Christophi, Melbourne Philip G Dinning, Koagarah Guy D Eslick, Sydney Michael A Fink, Melbourne

WJG|www.wjgnet.com

January 7, 2011

Robert JL Fraser, Daw Park Jacob George, Westmead Mark D Gorrell, Sydney Alexander G Heriot, Melbourne Michael Horowitz, Adelaide John E Kellow, Sydney William Kemp, Melbourne Finlay A Macrae, Victoria Daniel Markovich, Brisbane Vance Matthews, Melbourne Phillip S Oates, Perth Shan Rajendra, Tasmania Rajvinder Singh, Elizabeth Vale Ross C Smith, Sydney Kevin J Spring, Brisbane Nathan Subramaniam, Brisbane Phil Sutton, Melbourne Cuong D Tran, North Adelaide Debbie Trinder, Fremantle David Ian Watson, Bedford Park

Brunei Darussalam Vui Heng Chong, Bandar Seri Begawan

Bulgaria Zahariy Krastev, Sofia Mihaela Petrova, Sofia

Fu-Sheng Wang, Beijing Xiang-Dong Wang, Shanghai Nathalie Wong, Hong Kong Justin CY Wu, Hong Kong Wen-Rong Xu, Zhenjiang An-Gang Yang, Xian Wei-Cheng You, Beijing Chun-Qing Zhang, Jinan Jian-Zhong Zhang, Beijing Xiao-Peng Zhang, Beijing Xuan Zhang, Beijing

Canada Alain Bitton, Montreal Michael F Byrne, Vancouver Kris Chadee, Calgary Wangxue Chen, Ottawa Ram Prakash Galwa, Ottawa Philip H Gordon, Montreal Waliul Khan, Ontario Qiang Liu, Saskatoon John K Marshall, Ontario Andrew L Mason, Alberta Kostas Pantopoulos, Quebec Nathalie Perreault, Sherbrooke Baljinder Singh Salh, Vancouver Eldon Shaffer, Calgary Martin Storr, Calgary Pingchang Yang, Hamilton Eric M Yoshida, Vancouver Claudia Zwingmann, Montreal

Colombia Germn Campuzano-Maya, Medelln

Croatia Tamara Cacev, Zagreb Marko Duvnjak, Zagreb

Austria Herwig R Cerwenka, Graz Ashraf Dahaba, Graz Peter Ferenci, Vienna Valentin Fuhrmann, Vienna Alfred Gangl, Vienna Alexander M Hirschl, Wien Kurt Lenz, Linz Dietmar fner, Salzburg Markus Peck-Radosavljevic, Vienna Markus Raderer, Vienna Stefan Riss, Vienna Georg Roth, Vienna Michael Trauner, Graz Thomas Wild, Kapellerfeld

Cuba Damian C Rodriguez, Havana

Czech Jan Bures, Hradec Kralove Milan Jirsa, Praha Marcela Kopacova, Hradec Kralove Pavel Truneka, Prague

Chile Marcelo A Beltran, La Serena Xabier De Aretxabala, Santiago Silvana Zanlungo, Santiago

Denmark Leif Percival Andersen, Copenhagen Asbjrn M Drewes, Aalborg Morten Frisch, Copenhagen Jan Mollenhauer, Odense Morten Hylander Mller, Holte Sren Rafaelsen, Vejle Jorgen Rask-Madsen, Skodsborg Peer Wille-Jrgensen, Copenhagen

Belgium Rudi Beyaert, Gent Benedicte Y De Winter, Antwerp Inge I Depoortere, Leuven Olivier Detry, Lige Philip Meuleman, Ghent Marc Peeters, De Pintelaan Freddy Penninckx, Leuven Jean-Yves L Reginster, Lige Mark De Ridder, Brussels Etienne M Sokal, Brussels Kristin Verbeke, Leuven Eddie Wisse, Keerbergen

China Hui-Jie Bian, Xian San-Jun Cai, Shanghai Guang-Wen Cao, Shanghai Xiao-Ping Chen, Wuhan Chi-Hin Cho, Hong Kong Zong-Jie Cui, Beijing Jing-Yuan Fang, Shanghai De-Liang Fu, Shanghai Ze-Guang Han, Shanghai Chun-Yi Hao, Beijing Ming-Liang He, Hong Kong Ching-Lung Lai, Hong Kong Simon Law, Hong Kong Yuk-Tong Lee, Hong Kong En-Min Li, Shantou Fei Li, Beijing Yu-Yuan Li, Guangzhou Zhao-Shen Li, Shanghai Xing-Hua Lu, Beijing Yi-Min Mao, Shanghai Qin Su, Beijing Paul Kwong-Hang Tam, Hong Kong Yuk Him Tam, Hong Kong Ren-Xiang Tan, Nanjing Wei-Dong Tong, Chongqing Eric WC Tse, Hong Kong

Ecuador Fernando E Semprtegui, Quito

Egypt Zeinab Nabil Ahmed, Cairo Hussein M Atta, El-Minia

Brazil Jos LF Caboclo, So Jos do Rio Preto Roberto J Carvalho-Filho, So Paulo Jaime Natan Eisig, So Paulo Andre Castro Lyra, Salvador Marcelo Lima Ribeiro, Braganca Paulista Joao Batista Teixeira Rocha, Santa Maria Heitor Rosa, Goiania Damiao C Moraes Santos, Rio de Janeiro Ana Cristina Simes e Silva, Belo Horizonte Eduardo Garcia Vilela, Belo Horizonte

Estonia Riina Salupere, Tartu Tamara Vorobjova, Tartu

Finland Saila Kauhanen, Turku

WJG|www.wjgnet.com

II

January 7, 2011

Thomas Kietzmann, Oulu Kaija-Leena Kolho, Helsinki Jukka-Pekka Mecklin, Jyvaskyla Minna Nystrm, Helsinki Pauli Antero Puolakkainen, Turku Juhani Sand, Tampere Lea Veijola, Helsinki

France Claire Bonithon-Kopp, Dijon Lionel Bueno, Toulouse Sabine Colnot, Paris Catherine Daniel, Lille Cedex Alexis Desmoulire, Limoges Thabut Dominique, Paris Francoise L Fabiani, Angers Jean-Luc Faucheron, Grenoble Jean Paul Galmiche, Nantes cedex Boris Guiu, Dijon Paul Hofman, Nice Laurent Huwart, Paris Juan Iovanna, Marseille Abdel-Majid Khatib, Paris Philippe Lehours, Bordeaux Flavio Maina, Marseille Patrick Marcellin, Paris Rene Gerolami Santandera, Marseille Annie Schmid-Alliana, Nice cedex Alain L Servin, Chtenay-Malabry Stephane Supiot, Nantes Baumert F Thomas, Strasbourg Jean-Jacques Tuech, Rouen Frank Zerbib, Bordeaux Cedex

Germany Erwin Biecker, Siegburg Hubert Blum, Freiburg Thomas Bock, Tuebingen Dean Bogoevski, Hamburg Elfriede Bollschweiler, Kln Jrgen Borlak, Hannover Christa Buechler, Regensburg Jrgen Bning, Lbeck Elke Cario, Essen Bruno Christ, Halle/Saale Christoph F Dietrich, Bad Mergentheim Ulrich R Flsch, Kiel Nikolaus Gassler, Aachen Markus Gerhard, Munich Dieter Glebe, Giessen Ralph Graeser, Freiburg Axel M Gressner, Aachen Nils Habbe, Marburg Thilo Hackert, Heidelberg Wolfgang Hagmann, Heidelberg Dirk Haller, Freising Philip D Hard, Giessen Claus Hellerbrand, Regensburg Klaus R Herrlinger, Stuttgart Eberhard Hildt, Berlin Andrea Hille, Goettingen Joerg C Hoffmann, Berlin Philipe N Khalil, Munich Andrej Khandoga, Munich Jorg Kleeff, Munich Ingmar Knigsrainer, Tbingen Peter Konturek, Erlangen

Stefan Kubicka, Hannover Joachim Labenz, Siegen Michael Linnebacher, Rostock Jutta Elisabeth Lttges, Riegelsberg Peter Malfertheiner, Magdeburg Oliver Mann, Hamburg Peter N Meier, Hannover Sabine Mihm, Gttingen Klaus Mnkemller, Bottrop Jonas Mudter, Erlangen Sebastian Mueller, Heidelberg Robert Obermaier, Freiburg Matthias Ocker, Erlangen Stephan Johannes Ott, Kiel Gustav Paumgartner, Munich Christoph Reichel, Bad Brckenau Markus Reiser, Bochum Steffen Rickes, Magdeburg Elke Roeb, Giessen Christian Rust, Munich Hans Scherubl, Berlin Martin K Schilling, Homburg Joerg F Schlaak, Essen Rene Schmidt, Freiburg Andreas G Schreyer, Regensburg Karsten Schulmann, Bochum Henning Schulze-Bergkamen, Mainz Manfred V Singer, Mannheim Jens Standop, Bonn Jurgen M Stein, Frankfurt Ulrike S Stein, Berlin Wolfgang R Stremmel, Heidelberg Harald F Teutsch, Ulm Hans L Tillmann, Leipzig Christian Trautwein, Aachen Joerg Trojan, Frankfurt Arndt Vogel, Hannover Siegfried Wagner, Deggendorf Frank Ulrich Weiss, Greifswald Fritz von Weizscker, Berlin Thomas Wex, Magdeburg Stefan Wirth, Wuppertal Marty Zdichavsky, Tbingen

Yvette Mndi, Szeged Zoltan Rakonczay, Szeged Ferenc Sipos, Budapest Zsuzsa Szondy, Debrecen Gabor Veres, Budapest

India Philip Abraham, Mumbai Vineet Ahuja, New Delhi Giriraj Ratan Chandak, Hyderabad Devinder Kumar Dhawan, Chandigarh Radha K Dhiman, Chandigarh Pankaj Garg, Panchkula Pramod Kumar Garg, New Delhi Debidas Ghosh, Midnpore Uday C Ghoshal, Lucknow Bhupendra Kumar Jain, Delhi Ashok Kumar, Lucknow Bikash Medhi, Chandigarh Sri P Misra, Allahabad Gopal Nath, Varanasi Samiran Nundy, New Delhi Jagannath Palepu, Mumbai Vandana Panda, Mumbai Benjamin Perakath, Tamil Nadu Ramesh Roop Rai, Jaipur Nageshwar D Reddy, Hyderabad Barjesh Chander Sharma, New Delhi Virendra Singh, Chandigarh Rupjyoti Talukdar, Guwahati Rakesh Kumar Tandon, New Delhi Jai Dev Wig, Chandigarh

Iran Mohammad Abdollahi, Tehran Peyman Adibi, Isfahan Seyed-Moayed Alavian, Tehran Seyed Mohsen Dehghani, Shiraz Reza Malekzadeh, Tehran Alireza Mani, Tehran

Greece Helen Christopoulou-Aletra, Thessaloniki T Choli-Papadopoulou, Thessaloniki Tsianos Epameinondas, Ioannina Ioannis Kanellos, Thessaloniki Elias A Kouroumalis, Heraklion Ioannis E Koutroubakis, Heraklion Michael Koutsilieris, Athens Andreas Larentzakis, Athens Emanuel K Manesis, Athens Spilios Manolakopoulos, Athens Konstantinos Mimidis, Alexandroupolis George Papatheodoridis, Athens Spiros Sgouros, Athens Evangelos Tsiambas, Ag Paraskevi Attiki Ireland Billy Bourke, Dublin Ted Dinan, Cork Catherine Greene, Dublin Ross McManus, Dublin Anthony P Moran, Galway Marion Rowland, Dublin

Israel Simon Bar-Meir, Hashomer Alexander Becker, Afula Abraham R Eliakim, Haifa Sigal Fishman, Tel Aviv Boris Kirshtein, Beer Sheva Eli Magen, Ashdod Menachem Moshkowitz, Tel-Aviv Assy Nimer, Safed Shmuel Odes, Beer Sheva Mark Pines, Bet Dagan Ron Shaoul, Haifa Ami D Sperber, Beer-Sheva

Hungary Gyrgy M Buzs, Budapest Lszl Czak, Szeged Gyula Farkas, Szeged Peter Hegyi, Szeged Peter L Lakatos, Budapest

WJG|www.wjgnet.com

III

January 7, 2011

Italy Donato F Altomare, Bari Piero Amodio, Padova Angelo Andriulli, San Giovanni Rotondo Paolo Angeli, Padova Bruno Annibale, Rome Paolo Aurello, Rome Salvatore Auricchio, Naples Antonio Basoli, Rome Claudio Bassi, Verona Gabrio Bassotti, Perugia Mauro Bernardi, Bologna Alberto Biondi, Rome Luigi Bonavina, Milano Guglielmo Borgia, Naples Roberto Berni Canani, Naples Maria Gabriella Caruso, Bari Fausto Catena, Bologna Giuseppe Chiarioni, Valeggio Michele Cicala, Rome Dario Conte, Milano Francesco Costa, Pisa Antonio Crax, Palermo Salvatore Cucchiara, Rome Giuseppe Curr, Messina Mario M DElios, Florence Mirko DOnofrio, Verona Silvio Danese, Milano Roberto de Franchis, Milano Paola De Nardi, Milan Giovanni D De Palma, Naples Giuliana Decorti, Trieste Gianlorenzo Dionigi, Varese Massimo Falconi, Verona Silvia Fargion, Milan Giammarco Fava, Ancona Francesco Feo, Sassari Alessandra Ferlini, Ferrara Alessandro Ferrero, Torino Mirella Fraquelli, Milan Luca Frulloni, Verona Giovanni B Gaeta, Napoli Antonio Gasbarrini, Rome Edoardo G Giannini, Genoa Alessandro Granito, Bologna Fabio Grizzi, Milan Salvatore Gruttadauria, Palermo Pietro Invernizzi, Milan Achille Iolascon, Naples Angelo A Izzo, Naples Ezio Laconi, Cagliari Giovanni Latella, LAquila Massimo Levrero, Rome Francesco Luzza, Catanzaro Lucia Malaguarnera, Catania Francesco Manguso, Napoli Pier Mannuccio Mannucci, Milan Giancarlo Mansueto, Verona Giulio Marchesini, Bologna Mara Massimi, Coppito Giovanni Milito, Rome Giuseppe Montalto, Palermo Giovanni Monteleone, Rome Luca Morelli, Trento Giovanni Musso, Torino Mario Nano, Torino Gerardo Nardone, Napoli Riccardo Nascimbeni, Brescia Valerio Nobili, Rome Fabio Pace, Milan Nadia Peparini, Rome

Marcello Persico, Naples Mario Pescatori, Rome Raffaele Pezzilli, Bologna Alberto Piperno, Monza Anna C Piscaglia, Rome Piero Portincasa, Bari Michele Reni, Milan Vittorio Ricci, Pavia Oliviero Riggio, Rome Mario Rizzetto, Torino Ballarin Roberto, Modena Gerardo Rosati, Potenza Franco Roviello, Siena Cesare Ruffolo, Treviso Massimo Rugge, Padova Marco Scarpa, Padova C armelo Scarpignato, Parma Giuseppe Sica, Rome Marco Silano, Rome Pierpaolo Sileri, Rome Vincenzo Stanghellini, Bologna Fiorucci Stefano, Perugia Giovanni Tarantino, Naples Alberto Tommasini, Trieste Guido Torzilli, Rozzano Milan Cesare Tosetti, Porretta Terme Antonello Trecca, Rome Vincenzo Villanacci, Brescia Lucia Ricci Vitiani, Rome Marco Vivarelli, Bologna

Japan Kyoichi Adachi, Izumo Yasushi Adachi, Sapporo Takafumi Ando, Nagoya Akira Andoh, Otsu Masahiro Arai, Tokyo Hitoshi Asakura, Tokyo Kazuo Chijiiwa, Miyazaki Yuichiro Eguchi, Saga Itaru Endo, Yokohama Munechika Enjoji, Fukuoka Yasuhiro Fujino, Akashi Mitsuhiro Fujishiro, Tokyo Kouhei Fukushima, Sendai Masanori Hatakeyama, Tokyo Keiji Hirata, Kitakyushu Toru Hiyama, Higashihiroshima Masahiro Iizuka, Akita Susumu Ikehara, Osaka Kenichi Ikejima, Bunkyo-ku Yutaka Inagaki, Kanagawa Hiromi Ishibashi, Nagasaki Shunji Ishihara, Izumo Toru Ishikawa, Niigata Toshiyuki Ishiwata, Tokyo Hajime Isomoto, Nagasaki Yoshiaki Iwasaki, Okayama Satoru Kakizaki, Gunma Terumi Kamisawa, Tokyo Mototsugu Kato, Sapporo Naoya Kato, Tokyo Takumi Kawaguchi, Kurume Yohei Kida, Kainan Shogo Kikuchi, Aichi Tsuneo Kitamura, Chiba Takashi Kobayashi, Tokyo Yasuhiro Koga, Isehara Takashi Kojima, Sapporo Norihiro Kokudo, Tokyo Masatoshi Kudo, Osaka Shin Maeda, Tokyo

Satoshi Mamori, Hyogo Atsushi Masamune, Sendai Yasushi Matsuzaki, Tsukuba Kenji Miki, Tokyo Toshihiro Mitaka, Sapporo Hiroto Miwa, Hyogo Kotaro Miyake, Tokushima Manabu Morimoto, Yokohama Yoshiharu Motoo, Kanazawa Yoshiaki Murakami, Hiroshima Yoshiki Murakami, Kyoto Kunihiko Murase, Tusima Akihito Nagahara, Tokyo Yuji Naito, Kyoto Atsushi Nakajima, Yokohama Hisato Nakajima, Tokyo Hiroki Nakamura, Yamaguchi Shotaro Nakamura, Fukuoka Akimasa Nakao, Nagogya Shuhei Nishiguchi, Hyogo Mikio Nishioka, Niihama Keiji Ogura, Tokyo Susumu Ohmada, Maebashi Hirohide Ohnishi, Akita Kenji Okajima, Nagoya Kazuichi Okazaki, Osaka Morikazu Onji, Ehime Satoshi Osawa, Hamamatsu Hidetsugu Saito, Tokyo Yutaka Saito, Tokyo Naoaki Sakata, Sendai Yasushi Sano, Chiba Tokihiko Sawada, Tochigi Tomohiko Shimatan, Hiroshima Yukihiro Shimizu, Kyoto Shinji Shimoda, Fukuoka Yoshio Shirai, Niigata Masayuki Sho, Nara Shoichiro Sumi, Kyoto Hidekazu Suzuki, Tokyo Masahiro Tajika, Nagoya Yoshihisa Takahashi, Tokyo Toshinari Takamura, Kanazawa Hiroaki Takeuchi, Kochi Yoshitaka Takuma, Okayama Akihiro Tamori, Osaka Atsushi Tanaka, Tokyo Shinji Tanaka, Hiroshima Satoshi Tanno, Hokkaido Shinji Togo, Yokohama Hitoshi Tsuda, Tokyo Hiroyuki Uehara, Osaka Masahito Uemura, Kashihara Yoshiyuki Ueno, Sendai Mitsuyoshi Urashima, Tokyo Takuya Watanabe, Niigata Satoshi Yamagiwa, Niigata Taketo Yamaguchi, Chiba Mitsunori Yamakawa, Yamagata Takayuki Yamamoto, Yokkaichi Yutaka Yata, Maebashi Hiroshi Yoshida, Tokyo Norimasa Yoshida, Kyoto Yuichi Yoshida, Osaka Kentaro Yoshika, Toyoake Hitoshi Yoshiji, Nara Katsutoshi Yoshizato, Higashihiroshima Tomoharu Yoshizumi, Fukuoka

Jordan Ismail Matalka, Irbid

WJG|www.wjgnet.com

IV

January 7, 2011

Robert Christiaan Verdonk, Groningen Erwin G Zoetendal, Wageningen Kuwait Islam Khan, Safat New Zealand Andrew S Day, Christchurch Lebanon Bassam N Abboud, Beirut Ala I Sharara, Beirut Rita Slim, Beirut Norway Olav Dalgard, Oslo Trond Peder Flaten, Trondheim Reidar Fossmark, Trondheim Rasmus Goll, Tromso Ole Hie, Arendal Asle W Medhus, Oslo Espen Melum, Oslo Trine Olsen, Tromso Eyvind J Paulssen, Tromso Jon Arne Sreide, Stavanger Kjetil Soreide, Stavanger Singapore Madhav Bhatia, Singapore Kong Weng Eu, Singapore Brian Kim Poh Goh, Singapore Khek-Yu Ho, Singapore Kok Sun Ho, Singapore Fock Kwong Ming, Singapore London Lucien Ooi, Singapore Nagarajan Perumal, Singapore Francis Seow-Choen, Singapore Serbia Tamara M Alempijevic, Belgrade Dusan M Jovanovic, Sremska Kamenica Zoran Krivokapic, Belgrade

Lithuania Giedrius Barauskas, Kaunas Limas Kupcinskas, Kaunas

Malaysia Andrew Seng Boon Chua, Ipoh

South Africa Pakistan Shahab Abid, Karachi Syed MW Jafri, Karachi South Korea Poland Marek Bebenek, Wroclaw Tomasz Brzozowski, Cracow Halina Cicho-Lach, Lublin Andrzej Dabrowski, Bialystok Hanna Gregorek, Warsaw Marek Hartleb, Katowice Beata Jolanta Jabloska, Katowice Stanislaw J Konturek, Krakow Jan Kulig, Krakow Dariusz M Lebensztejn, Bialystok Julian Swierczynski, Gdansk Sang Hoon Ahn, Seoul Sung-Gil Chi, Seoul Myung-Gyu Choi, Seoul Hoon Jai Chun, Seoul Yeun-Jun Chung, Seoul Young-Hwa Chung, Seoul Kim Donghee, Seoul Ki-Baik Hahm, Incheon Sun Pyo Hong, Geonggi-do Seong Gyu Hwang, Seongnam Hong Joo Kim, Seoul Jae J Kim, Seoul Jin-Hong Kim, Suwon Nayoung Kim, Seongnam-si Sang Geon Kim, Seoul Seon Hahn Kim, Seoul Sung Kim, Seoul Won Ho Kim, Seoul Jeong Min Lee, Seoul Kyu Taek Lee, Seoul Sang Kil Lee, Seoul Sang Yeoup Lee, Gyeongsangnam-do Yong Chan Lee, Seoul Eun-Yi Moon, Seoul Hyoung-Chul Oh, Seoul Seung Woon Paik, Seoul Joong-Won Park, Goyang Ji Kon Ryu, Seoul Si Young Song, Seoul Marie Yeo, Suwon Byung Chul Yoo, Seoul Dae-Yeul Yu, Daejeon Rosemary Joyce Burnett, Pretoria Michael Kew, Cape Town

Mexico Richard A Awad, Mexico Aldo Torre Delgadillo, Mexico Diego Garcia-Compean, Monterrey Paulino M Hernndez Magro, Celaya Miguel Angel Mercado, Distrito Federal Arturo Panduro, Jalisco Omar Vergara-Fernandez, Tlalpan Sal Villa-Trevio, Mexico

Moldova Igor Mishin, Kishinev

Netherlands Ulrich Beuers, Amsterdam Lee Bouwman, Leiden Albert J Bredenoord, Nieuwegein Lodewijk AA Brosens, Utrecht J Bart A Crusius, Amsterdam Wouter de Herder, Rotterdam Pieter JF de Jonge, Rotterdam Robert J de Knegt, Rotterdam Wendy W Johanna de Leng, Utrecht Annemarie de Vries, Rotterdam James CH Hardwick, Leiden Frank Hoentjen, Haarlem Misha Luyer, Sittard Jeroen Maljaars, Maastricht Gerrit A Meijer, Amsterdam Servaas Morr, Amsterdam Chris JJ Mulder, Amsterdam John Plukker, Groningen Albert Frederik Pull ter Gunne, Tilburg Paul E Sijens, Groningen BW Marcel Spanier, Arnhem Shiri Sverdlov, Maastricht Maarten Tushuizen, Amsterdam Jantine van Baal, Heidelberglaan Astrid van der Velde, The Hague Karel van Erpecum, Utrecht Loes van Keimpema, Nijmegen

Portugal Raquel Almeida, Porto Ana Isabel Lopes, Lisboa Codex Ricardo Marcos, Porto Guida Portela-Gomes, Estoril

Romania Dan L Dumitrascu, Cluj Adrian Saftoiu, Craiova Andrada Seicean, Cluj-Napoca

Russia Vasiliy I Reshetnyak, Moscow

Spain Saudi Arabia Ibrahim A Al Mofleh, Riyadh Abdul-Wahed Meshikhes, Qatif Faisal Sanai, Riyadh Maria-Angeles Aller, Madrid Raul J Andrade, Mlaga Luis Aparisi, Valencia Gloria Gonzlez Aseguinolaza, Navarra Matias A Avila, Pamplona

WJG|www.wjgnet.com

January 7, 2011

Fernando Azpiroz, Barcelona Ramon Bataller, Barcelona Beln Beltrn, Valencia Adolfo Benages, Valencia Josep M Bordas, Barcelona Lisardo Bosc, Madrid Luis Bujanda, San Sebastin Juli Busquets, Barcelona Matilde Bustos, Pamplona Jos Julin calvo Andrs, Salamanca Andres Cardenas, Barcelona Antoni Castells, Barcelona Fernando J Corrales, Pamplona J E Domnguez-Muoz, Santiago de Compostela Juan Carlos Laguna Egea, Barcelona Isabel Fabregat, Barcelona Antoni Farr, Barcelona Vicente Felipo, Valencia Laureano Fernndez-Cruz, Barcelona Luis Grande, Barcelona Angel Lanas, Zaragoza Juan-Ramn Larrubia, Guadalajara Mara IT Lpez, Jan Juan Macas, Seville Javier Martin, Granada Jos Manuel Martin-Villa, Madrid Julio Mayol, Madrid Mireia Miquel, Sabadell Albert Pars, Barcelona Jess M Prieto, Pamplona Pedro L Majano Rodriguez, Madrid Joan Rosell-Catafau, Barcelona Eva Vaquero, Barcelona

Trinidad and Tobago Shivananda Nayak, Mount Hope

Turkey Sinan Akay, Tekirdag Metin Basaranoglu, Istanbul Yusuf Bayraktar, Ankara A Mithat Bozdayi, Ankara Hayrullah Derici, Balkesir Eren Ersoy, Ankara Mukaddes Esrefoglu, Malatya Can Goen, Kutahya Selin Kapan, Istanbul Aydin Karabacakoglu, Konya Cuneyt Kayaalp, Malatya Kemal Kismet, Ankara Seyfettin Kkl, Ankara Mehmet Refik Mas, Etlik-Ankara Osman C Ozdogan, Istanbul Blent Salman, Ankara Orhan Sezgin, Mersin Ilker Tasci, Ankara Mge Tecder-nal, Ankara Ahmet Tekin, Mersin Mesut Tez, Ankara Ekmel Tezel, Ankara zlem Yilmaz, Izmir

United Arab Emirates Sweden Lars Erik Agrus, Stockholm Mats Andersson, Stockholm Roland Andersson, Lund Mauro DAmato, Huddinge Evangelos Kalaitzakis, Gothenburg Greger Lindberg, Stockholm Annika Lindblom, Stockholm Sara Lindn, Gteborg Hanns-Ulrich Marschall, Stockholm Pr Erik Myrelid, Linkping ke Nilsson, Lund Helena Nordenstedt, Stockholm Kjell berg, Uppsala Lars A Pahlman, Uppsala Stefan G Pierzynowski, Lund Sara Regnr, Malm Bobby Tingstedt, Lund Zongli Zheng, Stockholm Fikri M Abu-Zidan, Al-Ain Sherif M Karam, Al-Ain

United Kingdom Simon Afford, Birmingham Navneet K Ahluwalia, Stockport Mohamed H Ahmed, Southampton Basil Ammori, Salford Lesley A Anderson, Belfast Chin Wee Ang, Liverpool Yeng S Ang, Wigan Anthony TR Axon, Leeds Kathleen B Bamford, London Jim D Bell, London John Beynon, Swansea Chris Briggs, Sheffield Geoffrey Burnstock, London Alastair D Burt, Newcastle Jeff Butterworth, Shrewsbury Jeremy FL Cobbold, London Jean E Crabtree, Leeds Tatjana Crnogorac-Jurcevic, London William Dickey, Londonderry Sunil Dolwani, Cardiff Emad M El-Omar, Aberdeen A M El-Tawil, Birmingham Charles B Ferguson, Belfast Andrew Fowell, Southampton Piers Gatenby, London Daniel R Gaya, Edinburgh Anil George, London Rob Glynne-Jones, Northwood Jason CB Goh, Birmingham Gianpiero Gravante, Leicester

Brian Green, Belfast William Greenhalf, Liverpool Indra N Guha, Nottingham Stefan G Hbscher, Birmingham Robin Hughes, London Pali Hungin, Stockton Nawfal Hussein, Nottingham Clement W Imrie, Glasgow Janusz AZ Jankowski, Oxford Sharad Karandikar, Birmingham Peter Karayiannis, London Shahid A Khan, London Patricia F Lalor, Birmingham John S Leeds, Sheffield Ian Lindsey, Oxford Hong-Xiang Liu, Cambridge Dileep N Lobo, Nottingham Graham MacKay, Glasgow Mark Edward McAlindon, Sheffield Anne McCune, Bristol Donald Campbell McMillan, Glasgow Giorgina Mieli-Vergani, London Jamie Murphy, London Guy Fairbairn Nash, Poole James Neuberger, Birmingham Patrick ODwyer, Glasgow Christos Paraskeva, Bristol Richard Parker, North Staffordshire Thamara Perera, Birmingham Kondragunta Rajendra Prasad, Leeds D Mark Pritchard, Liverpool Alberto Quaglia, London Akhilesh B Reddy, Cambridge Kevin Robertson, Glasgow Sanchoy Sarkar, Liverpool John B Schofield, Kent Marco Senzolo, Padova Venkatesh Shanmugam, Derby Paul Sharp, London Chew Thean Soon, Manchester Aravind Suppiah, East Yorkshire Noriko Suzuki, Middlesex Simon D Taylor-Robinson, London Frank I Tovey, London A McCulloch Veitch, Wolverhampton Vamsi R Velchuru, Lowestoft Sumita Verma, Brighton Catherine Walter, Cheltenham Julian RF Walters, London Roger Williams, London

United States Kareem M Abu-Elmagd, Pittsburgh Sami R Achem, Florida Golo Ahlenstiel, Bethesda Bhupinder S Anand, Houston M Ananthanarayanan, New York Balamurugan N Appakalal, Minneapolis Dimitrios V Avgerinos, New York Shashi Bala, Worcester Anthony J Bauer, Pittsburgh Kevin E Behrns, Gainesville Roberto Bergamaschi, New York Henry J Binder, New Haven Edmund J Bini, New York Wojciech Blonski, Philadelphia Mark Bloomston, Columbus Edward L Bradley III, Sarasota Carla W Brady, Durham

Switzerland Pascal Bucher, Geneva Michelangelo Foti, Geneva Jean L Frossard, Geneva Andreas Geier, Zrich Pascal Gervaz, Geneva Gerd A Kullak-Ublick, Zrich Fabrizio Montecucco, Geneva Paul M Schneider, Zrich Felix Stickel, Berne Bruno Stieger, Zrich Inti Zlobec, Basel

WJG|www.wjgnet.com

VI

January 7, 2011

David A Brenner, San Diego Adeel A Butt, Pittsburgh Shi-Ying Cai, New Haven Justin MM Cates, Nashville Eugene P Ceppa, Durham Jianyuan Chai, Long Beach Ronald S Chamberlain, Livingston Fei Chen, Morgantown Xian-Ming Chen, Omaha Ramsey Chi-man Cheung, Palo Alto Denesh Chitkara, East Brunswick Clifford S Cho, Madison Parimal Chowdhury, Arkansas John David Christein, Birmingham Thomas Clancy, Boston Ana J Coito, Los Angeles Ricardo Alberto Cruciani, New York Joseph J Cullen, Iowa City Mark J Czaja, New York Mariana D Dabeva, Bronx Jessica A Davila, Houston Conor P Delaney, Cleveland Laurie DeLeve, Los Angeles Anthony J Demetris, Pittsburgh Sharon DeMorrow, Temple Bijan Eghtesad, Cleveland Yoram Elitsur, Huntington Mohamad A Eloubeidi, Alabama Wael El-Rifai, Nashville Sukru H Emre, New Haven Giamila Fantuzzi, Chicago Ashkan Farhadi, Irvine Ronnie Fass, Tucson Martn E Fernndez-Zapico, Rochester Alessandro Fichera, Chicago Josef E Fischer, Boston Piero Marco Fisichella, Maywood Fritz Francois, New York Glenn T Furuta, Aurora T Clark Gamblin, Pittsburgh Henning Gerke, Iowa City Jean-Francois Geschwind, Baltimore R Mark Ghobrial, Texas John F Gibbs, Buffalo Shannon S Glaser, Temple Ajay Goel, Dallas Jon C Gould, Madison Eileen F Grady, San Francisco James H Grendell, New York John R Grider, Richmond Anna S Gukovskaya, Los Angeles Chakshu Gupta, St. Joseph Grigoriy E Gurvits, New York Hai-Yong Han, Phoenix Yuan-Ping Han, Los Angeles Imran Hassan, Springfield Charles P Heise, Madison Lisa J Herrinton, Oakland Oscar Joe Hines, Los Angeles Samuel B Ho, San Diego Steven Hochwald, Gainesville Richard Hu, Los Angeles Eric S Hungness, Chicago Jamal A Ibdah, Columbia Atif Iqbal, Omaha Hartmut Jaeschke, Tucson Donald M Jensen, Chicago Robert Jensen, Bethesda Leonard R Johnson, Memphis Andreas M Kaiser, Los Angeles JingXuan Kang, Charlestown John Y Kao, Michigan Randeep Singh Kashyap, New York Rashmi Kaul, Tulsa

Jonathan D Kaunitz, Los Angeles Stephen M Kavic, Baltimore Ali Keshavarzian, Chicago Amir Maqbul Khan, Marshall Kusum K Kharbanda, Omaha Chang Kim, West Lafayette Dean Y Kim, Detroit Miran Kim, Providence Burton I Korelitz, New York Josh Korzenik, Boston Richard A Kozarek, Seattle Alyssa M Krasinskas, Pittsburgh Shiu-Ming Kuo, Buffalo Michelle Lai, Boston Michael Leitman, New York Dong-Hui Li, Houston Ming Li, New Orleans Zhiping Li, Baltimore Gary R Lichtenstein, Philadelphia Chen Liu, Gainesville Zhang-Xu Liu, Los Angeles Craig D Logsdon, Houston Kaye M Reid Lombardo, Rochester Michael R Lucey, Madison Kirk Ludwig, Wisconsin James D Luketich, Pittsburgh Patrick M Lynch, Houston John S Macdonald, New York Willis C Maddrey, Dallas Mercedes Susan Mandell, Aurora Christopher Mantyh, Durham Wendy M Mars, Pittsburgh John Marshall, Columbia Robert CG Martin, Louisville Laura E Matarese, Pittsburgh Craig J McClain, Louisville Lynne V McFarland, Washington David J McGee, Shreveport Valentina Medici, Sacramento Stephan Menne, New York Didier Merlin, Atlanta George Michalopoulos, Pittsburgh James M Millis, Chicago Pramod K Mistry, New Haven Emiko Mizoguchi, Boston Huanbiao Mo, Denton Robert C Moesinger, Ogden Smruti R Mohanty, Chicago John Morton, Stanford Peter L Moses, Burlington Sandeep Mukherjee, Omaha Million Mulugeta, Los Angeles Michel M Murr, Tampa Pete Muscarella, Columbus Ece A Mutlu, Chicago Masaki Nagaya, Boston Laura E Nagy, Cleveland Aejaz Nasir, Tampa Udayakumar Navaneethan, Cincinnati Stephen JD OKeefe, Pittsburgh Robert D Odze, Boston Giuseppe Orlando, Winston Salem Pal Pacher, Rockville Georgios Papachristou, Pittsburgh Jong Park, Tampa William R Parker, Durham Mansour A Parsi, Cleveland Marco Giuseppe Patti, Chicago Zhiheng Pei, New York CS Pitchumoni, New Brunswiuc Parviz M Pour, Omaha Xiaofa Qin, Newark Florencia Georgina Que, Rochester Massimo Raimondo, Jacksonville

Raymund R Razonable, Minnesota Kevin Michael Reavis, Orange Robert V Rege, Dallas Douglas K Rex, Indianapolis Victor E Reyes, Galveston Basil Rigas, New York Richard A Rippe, Chapel Hill Alexander S Rosemurgy, Tampa Philip Rosenthal, San Francisco Raul J Rosenthal, Weston Joel H Rubenstein, Ann Arbor Shawn D Safford, Norfolk Rabih M Salloum, Rochester Bruce E Sands, Boston Tor C Savidge, Galveston Michael L Schilsky, New Haven Beat Schnriger, California Robert E Schoen, Pittsburgh Matthew James Schuchert, Pittsburgh Ekihiro Seki, La Jolla Le Shen, Chicago Perry Shen, Winston-Salem Stuart Sherman, Indianapolis Mitchell L Shiffman, Richmond Shivendra Shukla, Columbia Bronislaw L Slomiany, Newark Scott Steele, Fort Lewis Branko Stefanovic, Tallahassee Lygia Stewart, San Francisco Luca Stocchi, Cleveland Daniel S Straus, Riverside Robert Todd Striker, Madison Jonathan Strosberg, Tampa Christina Surawicz, Seattle Patricia Sylla, Boston Wing-Kin Syn, Durham Yvette Tach, Los Angeles Kazuaki Takabe, Richmond Kam-Meng Tchou-Wong, New York Klaus Thaler, Columbia Charles Thomas, Oregon Natalie J Torok, Sacramento George Triadafilopoulos, Stanford Chung-Jyi Tsai, Lexington Thrse Tuohy, Salt Lake City Andrew Ukleja, Florida Santhi Swaroop Vege, Rochester Aaron Vinik, Norfolk Dinesh Vyas, Washington Arnold Wald, Wisconsin Scott A Waldman, Philadelphia Jack R Wands, Providence Jiping Wang, Boston Irving Waxman, Chicago Wilfred M Weinstein, Los Angeles Steven D Wexner, Weston John W Wiley, Ann Arbor Jackie Wood, Ohio Jian Wu, Sacramento Wen Xie, Pittsburgh Guang-Yin Xu, Galveston Fang Yan, Nashville Radha Krishna Yellapu, New York Anthony T Yeung, Philadelphia Zobair M Younossi, Virginia Liqing Yu, Winston-Salem Run Yu, Los Angeles Ruben Zamora, Pittsburgh Michael E Zenilman, New York Mark A Zern, Sacramento Lin Zhang, Pittsburgh Martin D Zielinski, Rochester Michael A Zimmerman, Colorado

WJG|www.wjgnet.com

VII

January 7, 2011

Contents
EDITORIAL
409

Weekly Volume 17 Number 4 January 28, 2011

Nestin in gastrointestinal and other cancers: Effects on cells and tumor angiogenesis
Ishiwata T, Matsuda Y, Naito Z

419

Peginterferon and ribavirin treatment for hepatitis C virus infection

Tsubota A, Fujise K, Namiki Y, Tada N

TOPIC HIGHLIGHT

433

Differentiation of Crohns disease from intestinal tuberculosis in India in 2010

Pulimood AB, Amarapurkar DN, Ghoshal U, Phillip M, Pai CG, Reddy DN, Nagi B, Ramakrishna BS

REVIEW

444

Is diabetes a causal agent for colorectal cancer? Pathophysiological and molecular mechanisms
Giouleme O, Diamantidis MD, Katsaros MG

ORIGINAL ARTICLE

449

Ghrelin and gastrin in advanced gastric cancer before and after gastrectomy
Zub-Pokrowiecka A, Rembiasz K, Konturek PC, Budzyski A, Konturek SJ, Winiarski M, Bielaski W

459

Bifidobacterium lactis attenuates onset of inflammation in a murine model of

colitis
Philippe D, Favre L, Foata F, Adolfsson O, Perruisseau-Carrier G, Vidal K, Reuteler G, Dayer-Schneider J, Mueller C, Blum S

470

A potential oncogenic role of the commonly observed E2F5 overexpression in hepatocellular carcinoma
Jiang Y, Yim SH, Xu HD, Jung SH, Yang SY, Hu HJ, Jung CK, Chung YJ

478

Blocking NF-kB nuclear translocation leads to p53-related autophagy activation and cell apoptosis
Zhu BS, Xing CG, Lin F, Fan XQ, Zhao K, Qin ZH

BRIEF ARTICLE

488

Association between EGF +61A/G polymorphism and gastric cancer in Caucasians

Arajo AP, Costa BM, Pinto-Correia AL, Fragoso M, Ferreira P, Dinis-Ribeiro M, Costa S, Reis RM, Medeiros R

WJG|www.wjgnet.com

January 28, 2011|Volume 17|ssue 4|

Contents
493

World Journal of Gastroenterology

Volume 17 Number 4 January 28, 2011

Long-term outcome of chronic hepatitis C patients with sustained virological response to peginterferon plus ribavirin
Trapero-Marugn M, Mendoza J, Chaparro M, Gonzlez-Moreno L, Moreno-Monteagudo JA, Borque MJ, Moreno-Otero R

499

EUS-guided drainage is more successful in pancreatic pseudocysts compared with abscesses

Sadik R, Kalaitzakis E, Thune A, Hansen J, Jnson C

506

Evaluation of Cladribine treatment in refractory celiac disease type

Tack GJ, Verbeek WHM, Al-Toma A, Kuik DJ, Schreurs MWJ, Visser O, Mulder CJJ

514

Proximal and distal esophageal sensitivity is decreased in patients with Barretts esophagus
Krarup AL, Olesen SS, Funch-Jensen P, Gregersen H, Drewes AM

522

T2* magnetic resonance imaging of the liver in thalassemic patients in Iran

Zamani F, Razmjou S, Akhlaghpoor S, Eslami SM, Azarkeivan A, Amiri A

526

Silence of HIN-1 expression through methylation of its gene promoter in gastric cancer
Gong Y, Guo MZ, Ye ZJ, Zhang XL, Zhao YL, Yang YS

534

Anorectal malignant melanomas: Retrospective experience with surgical management

Che X, Zhao DB, Wu YK,Wang CF, Cai JQ, Shao YF, Zhao P

CASE REPORT

540

Isolated pancreatic granulocytic sarcoma: A case report and review of the literature
Li XP, Liu WF, Ji SR, Wu SH, Sun JJ, Fan YZ

LETTERS TO THE EDITOR 543

Pernicious anemia: What are the actual diagnosis criteria?

Cattan D

WJG|www.wjgnet.com



January 28, 2011|Volume 17|ssue 4|

Contents
ACKNOWLEDGMENTS APPENDIX
I I I-VI

World Journal of Gastroenterology

Volume 17 Number 4 January 28, 2011

Acknowledgments to reviewers of World Journal of Gastroenterology Meetings Instructions to authors
Zub-Pokrowiecka A, Rembiasz K, Konturek PC, Budzyski A, Konturek SJ, Winiarski M, Bielaski W. Ghrelin and gastrin in advanced gastric cancer before and after gastrectomy. World J Gastroenterol 2011; 17(4): 449-458 http://www.wjgnet.com/1007-9327/full/v17/i4/449.htm World Journal of Gastroenterology (World J Gastroenterol, WJG, print ISSN 1007-9327, DOI: 10.3748) is a weekly, open-access, peer-reviewed journal supported by an editorial board of 1144 experts in gastroenterology and hepatology from 60 countries. The major task of WJG is to report rapidly the most recent results in basic and clinical research on esophageal, gastrointestinal, liver, pancreas and biliary tract diseases, Helicobacter pylori, endoscopy and gastrointestinal surgery, including: gastroesophageal reflux disease, gastrointestinal bleeding, infection and tumors; gastric and duodenal disorders; intestinal inflammation, microflora and immunity; celiac disease, dyspepsia and nutrition; viral hepatitis, portal hypertension, liver fibrosis, liver cirrhosis, liver transplantation, and metabolic liver disease; molecular and cell biology; geriatric and pediatric gastroenterology; diagnosis and screening, imaging and advanced technology.

ABOUT COVER

AIM AND SCOPE

FLYLEAF EDITORS FOR THIS ISSUE

NAME OF JOURNAL World Journal of Gastroenterology LAUNCH DATE October 1, 1995

I-VII

Editorial Board
Responsible Science Editor: Zhong-Fang Shi Proofing Editorial Office Director: Jian-Xia Cheng

Responsible Assistant Editor: Xiao-Fang Liu Responsible Electronic Editor: Wen-Hua Ma Proofing Editor-in-Chief: Lian-Sheng Ma

PRINT SUBSCRIPTION RMB 245 Yuan for each issue, RMB 11760 Yuan for one year. ONLINE SUBSCRIPTION One-Year Price 864.00 USD PUBLICATION DATE January 28, 2011 CSSN ISSN 1007-9327 (print) ISSN 2219-2840 (online) HONORARY EDITORS-IN-CHIEF James L Boyer, New Haven Ke-Ji Chen, Beijing Martin H Floch, New Haven Geng-Tao Liu, Beijing Emmet B Keeffe, Palo Alto Lein-Ray Mo, Tainan Eamonn M Quigley, Cork Rafiq A Sheikh, Sacramento Nicholas J Talley, Rochester Ming-Lung Yu, Kaohsiung PRESIDENT AND EDITOR-IN-CHIEF Lian-Sheng Ma, Beijing ACADEMIC EDITOR-IN-CHIEF Tauseef Ali, Oklahoma Mauro Bortolotti, Bologna Tarkan Karakan, Ankara Weekitt Kittisupamongkol, Bangkok Anastasios Koulaouzidis, Edinburgh Gerd A Kullak-Ublick, Zrich Bo-Rong Pan, Xian Sylvia LF Pender, Southampton Max S Petrov, Auckland George Y Wu, Farmington STRATEGY ASSOCIATE EDITORS-IN-CHIEF Peter Draganov, Florida Hugh J Freeman, Vancouver Maria Concepcin Gutirrez-Ruiz, Mxico Kazuhiro Hanazaki, Kochi

RESPONSIBLE INSTITUTION Department of Science and Technology of Shanxi Province SPONSOR Taiyuan Research and Treatment Center for Digestive Diseases, 77 Shuangta Xijie, Taiyuan 030001, Shanxi Province, China EDITING Editorial Board of World Journal of Gastroenterology, Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing 100025, China Telephone: +86-10-5908-0039 Fax: +86-10-8538-1893 E-mail: wjg@wjgnet.com http://www.wjgnet.com PUBLISHING Baishideng Publishing Group Co., Limited, Room 1701, 17/F, Henan Building, No.90 Jaffe Road, Wanchai, Hong Kong, China Fax: +852-3115-8812 Telephone: +852-5804-2046 E-mail: baishideng@wjgnet.com http://www.wjgnet.com SUBSCRIPTION Beijing Baishideng BioMed Scientific Co., Ltd., Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing 100025, China Telephone: +86-10-8538-1892 Fax: +86-10-8538-1893 E-mail: baishideng@wjgnet.com http://www.wjgnet.com

Akio Inui, Kagoshima Kalpesh Jani, Baroda Javier S Martin, Punta del Este Natalia A Osna, Omaha Wei Tang, Tokyo Alan BR Thomson, Edmonton Harry HX Xia, Hanover ASSOCIATE EDITORS-IN-CHIEF You-Yong Lu, Beijing John M Luk, Pokfulam Hiroshi Shimada, Yokohama EDITORIAL OFFICE Jian-Xia Cheng, Director World Journal of Gastroenterology Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing 100025, China Telephone: +86-10-5908-0039 Fax: +86-10-8538-1893 E-mail: wjg@wjgnet.com http://www.wjgnet.com COPYRIGHT 2011 Baishideng. All rights reserved; no part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise without the prior permission of Baishideng. Authors are required to grant World Journal of Gastroenterology an exclusive license to publish. SPECIAL STATEMENT All articles published in this journal represent the viewpoints of the authors except where indicated otherwise. INSTRUCTIONS TO AUTHORS Full instructions are available online at http://www. wjgnet.com/1007-9327/g_info_20100315215714.htm. If you do not have web access please contact the editorial office. ONLINE SUBMISSION http://www.wjgnet.com/1007-9327office

WJG|www.wjgnet.com



January 28, 2011|Volume 17|ssue 4|

Online Submissions: http://www.wjgnet.com/1007-9327office wjg@wjgnet.com doi:10.3748/wjg.v17.i4.526

World J Gastroenterol 2011 January 28; 17(4): 526-533 ISSN 1007-9327 (print) ISSN 2219-2840 (online)

2011 Baishideng. All rights reserved.

BRIEF ARTICLE

Silence of HIN-1 expression through methylation of its gene promoter in gastric cancer
Yan Gong, Ming-Zhou Guo, Zhi-Jia Ye, Xiu-Li Zhang, Yong-Liang Zhao, Yun-Sheng Yang
Yan Gong, Ming-Zhou Guo, Xiu-Li Zhang, Yun-Sheng Yang, Department of Gastroenterology and Hepatology, Chinese PLA General Hospital, Beijing 100853, China Zhi-Jia Ye, Department of Genetics, Yale Medical School TAC, S320 1 Gilbert Street, New Haven, CT 06520, United States Yong-Liang Zhao, Department of General Surgery, Southwest Hospital, Third Military Medical University, Chongqing 400038, China Author contributions: Gong Y and Yang YS performed the majority of experiments; Guo MZ and Ye ZJ provided vital reagents and analytical tools and edited the manuscript; Zhao YL and Zhang XL collected all the specimens for this work; Gong Y and Guo MZ designed the study and wrote the manuscript. Supported by National Basic Research Program (973 Program No. 2010CB912802) and the Postdoctoral Fund of China, No. 20080441314 Correspondence to: Yun-Sheng Yang, MD, PhD, Department of Gastroenterology and Hepatology, Chinese PLA General Hospital, No. 28 Fuxing Road, Beijing 100853, China. sunny888@medmail.com.cn Telephone: +86-10-68182255 Fax: +86-10-68212267 Received: September 2, 2010 Revised: November 2, 2010 Accepted: November 9, 2010 Published online: January 28, 2011

of gastric cancer cells with or without 5-aza-2-deoxycytidine treatment. RESULTS: HIN-1 was not expressed in 4 of 5 gastric cancer cell lines. The demethylation reagent 5-aza-2deoxycytidine was able to induce or upregulate HIN-1 expression in gastric cancer cell lines, which is associated with reduction of tumor cell viability. Furthermore, methylation of the HIN-1 gene promoter was shown in 57.8% (26/45) of the primary gastric cancer and 42.1% (17/38) of adjacent tissue samples, but was not shown in normal gastric mucosa (0/10). From the clinicopathological data of the patients, methylation of the HIN-1 gene promoter was found to be associated with tumor differentiation (P = 0.000). CONCLUSION: High methylation of HIN-1 gene promoter results in silence of HIN-1 expression in gastric cancer. 5-aza-2-deoxycytidine reverses HIN-1 methylation and reduces viability of gastric cancer cells.
2011 Baishideng. All rights reserved.

Key words: High in normal-1; Gene methylation; 5-aza2-deoxycytidine; Tumor differentiation; Gastric cancer

Abstract
AIM: To clarify the role of high in normal-1 (HIN-1 ) gene promoter methylation during gastric cancer development. METHODS: Gastric cancer cell lines and tissue specimens were analyzed for expression of HIN-1 mRNA and protein using the semi-quantitative reverse transcription polymerase chain reaction and immunohistochemistry. The methylation of the HIN-1 gene promoter was detected in gastric carcinoma cells and tissues using methylation-specific polymerase chain reaction. The 3-(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4sulfophenyl)-2H-tetrazolium cell viability assay and flow cytometry were used to assess the changes in behaviors

Peer reviewer: Huanbiao Mo, PhD, Associate Professor, Department of Nutrition and Food Sciences, Texas Womans University, PO Box 425888, Denton, TX 76204, United States Gong Y, Guo MZ, Ye ZJ, Zhang XL, Zhao YL, Yang YS. Silence of HIN-1 expression through methylation of its gene promoter in gastric cancer. World J Gastroenterol 2011; 17(4): 526-533 Available from: URL: http://www.wjgnet.com/1007-9327/full/ v17/i4/526.htm DOI: http://dx.doi.org/10.3748/wjg.v17.i4.526

INTRODUCTION
Gastric cancer is the second most common cause of can

WJG|www.wjgnet.com

526

January 28, 2011|Volume 17|Issue 4|

Gong Y et al . HIN-1 methylation in gastric carcinoma

cer death worldwide after lung cancer[1,2]. Gastric carcino genesis, like all other cancers, is a multistep process, in volving numerous genetic and epigenetic alterations, such as abnormalities in growth factors/receptors, angiogenic factors, cell cycle regulators, and DNA mismatch repair genes. These abnormalities also define biological character istics of gastric cancer cells, which can serve as therapeutic targets for gastric cancer[3,4]. Although genetic abnormali ties including gene mutation and deletion are prominent in causing oncogene activation and tumor suppressor gene inactivation, epigenetic silence of tumor suppressor genes via aberrant promoter hypermethylation have also been shown to be frequent events in gastric carcinoma[5,6]. DNA high methylation of tumor suppressor genes frequently occurs in the early stage of human carcinogenesis, and investigating the methylation of these gene promoters may contribute to the diagnosis, prognosis and target therapy in gastric carcinoma[7,8]. High in normal1 (HIN-1) gene was originally isolated through a serial analysis of gene expression from normal and ductal carcinoma in situ luminal mammary epithelial cells. The latter is believed to be the precursor of invasive ductal carcinoma[9]. HIN1 is highly expressed in normal luminal mammary epithelial cells but lost in the majority of breast cancers. Restoration of HIN1 expression sup pressed growth of breast cancer cells[10]. HIN1 can also regulate cellcycle reentry, suppresses tumor cell migration and invasion, and induces apoptosis in breast cancer cell lines[10]. Although HIN1 processes the putative tumor suppressor function, no somatically genetic changes of HIN-1 gene were found in breast cancer[9]. Previous stud ies demonstrated frequent methylation of HIN-1 gene promoter in breast cancer, prostate cancer, malignant me sotheliomas, nonsmall cell lung cancer, lymphoma, reti noblastoma, Wilms tumor, and rhabdomyosarcoma[1114]. However, expression of this putative tumor suppressor gene in gastric cancer has not been fully studied. Therefore, in this study, we first confirmed the methylation of HIN-1 gene promoter in human gastric cancer cell lines and de termined the role of 5aza2deoxycytidine [5azadc, a drug that inhibits the DNA methyltransferase (DNMT) mediated hypermethylation of promoter region CpG is lands] in regulation of HIN-1 expression in gastric cancer cells. We also detected the methylation of HIN-1 gene promoter in tissue specimens and found the association between HIN-1 gene promoter methylation and clinico pathologic characteristics of gastric cancer.

saged at a ratio of 1:3 with trypsin once they reached confluence (approximately 106 cells) into 75 cm2 culture flasks (Sarstedt, Newton, NC). For treatment with 5-aza2deoxycytidine, these cell lines were split and cultured at a low density (30% confluence) overnight and then treated with 5aza2deoxycytidine (Sigma, St. Louis, MO) at a concentration of 1 mol/L for up to 96 h. The growth medium was refreshed every 24 h, and at the end of the treatment, DNA and RNA from these cells were isolated as described below. Human tissue samples In the current study, 45 surgically resected and pathologi cally confirmed gastric tumors and 38 adjacent non-tumor tissues were obtained from the PLA General Hospital, Beijing, China between January 2009 and January 2010 and stored in liquid nitrogen until use. Ten cases of nor mal gastric mucosa were also obtained from the gastric endoscopic biopsies of tumorfree patients. This study was approved by our hospitals Institutional Review Board. DNA extraction and methylation-specific polymerase chain reaction Genomic DNA from these cell lines and tissue specimens were extracted using a proteinaseK method described previously[15]. The extracted DNA was then dissolved in TrisEDTA (TE) buffer and stored at 20. To assess the methylation levels of the HIN-1 gene promoter, genomic DNA from gastric cancer cell lines and tissue specimens were first subjected to bisulfite treatment and then methyla tion-specific polymerase chain reaction (MSP) as described previously[16]. The MSP primers for HIN1 were designed and synthesized according to genomic sequences skirt ing the presumed transcription start sites for HIN1. The HIN1 MSP primers spanned a region of 92 base pairs for unmethylation (location is from +128 to +41) and 88 base pairs for methylation (location is from +131 to +40). The primer sequences were: HIN-1UN 5'GAAGTTTT GTGGTTTTGTTTGGGTAGTT3', HIN-1UNAS 5'CACACAAAACCCCAAAAAAACAACA3', HIN-1 MES 5'GTTTCGTGGTTTTGTTCGGGTAGTC3' and HIN-1MEAS 5'GCAAAACCCCAAAAAAACGACG3'. Each MSP reaction incorporated approximately 100 ng of bisulfite-treated DNA, 25 picomoles of each primer, 100 pmoles dNTPs, 2.5 L 10 PCR buffer, and 1 unit of JumpStart Red Taq Polymerase (Sigma) in a final reaction volume of 25 L. The PCR amplification conditions were an initial 95 for 5 min and then 35 cycles of 95 for 30 s, 60 for 30 s, and 72 for 30 s and a final extension at 72 for 5 min and then stored at 4. The MSP products were separated on 2% agarose gel electrophoresis and vi sualized under the ultraviolet (UV) light. RNA isolation and semi-quantitative reverse transcription PCR Total cellular RNA from the cell lines was isolated using the TRIzol reagent (Invitrogen) according to the manu

MATERIALS AND METHODS

Cell lines and culture Gastric carcinoma cell lines KATOIII, AGS, PHM82, NUGC3, and BCG823 were obtained from American Type Culture Collection (Manassas, VA) and cultured in either RPMI 1640 medium or RPMI 1640/Hams F12 medium (all from Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum in a humidified incubator with 5% CO2 and 95% air at 37. These cells were pas

WJG|www.wjgnet.com

527

January 28, 2011|Volume 17|Issue 4|

Gong Y et al . HIN-1 methylation in gastric carcinoma

facturers instructions. RNA quality and quantity were assessed using agarose gel electrophoresis (1%) and spec trophotometric analysis of 260/280 ratios. The RNA was stored at 70 prior to use. The first strand cDNA was synthesized with oligo(dT) primer using a reverse tran scriptase kit from Invitrogen. Two micrograms RNA was subjected to the first strand cDNA synthesis, and 1 L cDNA from RT reac tion was subjected to PCR amplification of gene expres sion in a total 25 L reaction volume. The PCR ampli fication was carried out using primer sets derived from the published HIN-1 gene sequences: HIN-1 primers were 5'TCTGCGTGGCCCTGTCCTG3' (sense) and 5'GCTCAGCCAAACACTGTCAG3' (antisense) [14]. This primer set, designed to cross the intronic sequenc es, can prevent from amplification of genomic DNA for control of genomic DNA contamination during RNA isolation. A total of 32 cycles of PCR amplifica tion were performed based on our preexperiment for semiquantitative measurement of HIN-1 gene expres sion levels. Glyceraldehyde3phosphate dehydrogenase (GAPDH) was amplified for 25 cycles as an internal control of equal loading and cDNA quality and quantity. The sequence of GAPDH primers: 5'GACCACAGTC CATGCCATCAC3' (sense) and 5'GTCCACCACCCT GTTGCTGTA3' (antisense). The PCR products were then electrophoresed in 1.5% agarose gels containing ethidium bromide and reviewed under the UV light. Protein extraction and Western blotting The cells were grown and treated with or without 5aza 2deoxycytidine for 6 d and total cellular protein was then extracted from these cells in 200 L icecold mild lysis buffer containing 10 L nonidet P40, 0.15 mol/L NaCl, 0.01 mol/L sodium phosphate (pH 7.2), 2 mmol/L EDTA, 50 mmol/L sodium fluoride, 0.2 mmol/L sodium vanadate, and 1 g/mL aprotinin. The cell mixture was centrifuged at 20 000 r/min for 15 min and supernatants were then collected. The concentration of protein was quantified by the BCA protein assay from Pierce (Rock ford, IL, USA) and an equal amount of protein was separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDSPAGE) and then transferred onto PDVF membranes (Millipore, Billerica, USA). Western blotting analyses were then carried out using an anti HIN1 (Novus Biologicals, Littleton, USA) or an anti actin antibody (Boster, Wuhan, China). The blots were de veloped with chemiluminescence substrate solution from Pierce and exposed to X-ray film. 3-(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)2-(4-sulfophenyl)-2H-tetrazolium assay Gastric cancer cells were grown in 96well plates and treat ed with or without 5aza2deoxycytidine for up to 6 d, and then cell proliferation was determined using CCK8 solution (Beyotime, China) according to the manufacturers instructions. The optical density was measured at 492 nm using an ELISA plate reader (TECAN, Switzerland). The

experiments were performed in triplicate and repeated three times. Detection of apoptosis Gastric cancer cells were treated with or without 5aza 2-deoxycytidine for up to 6 d. Both attached and floating cells were harvested and fixed with 70% ethanol for at least 48 h. After resuspension in 50 g/mL, the cells were treated with 100 g/mL RNase for 30 min and stained with propidium iodide and then analyzed by flow cytom etry (FACscalibur; Becton Dickinson, Franklin Lakes, NJ). Immunohistochemistry Sections 5 m thick were formalinfixed and paraffin embedded in xylene and rehydrated through an ethanol series. Antigen retrieval was carried out at this stage in a microwave oven. Sections were then blocked with 3% hydrogen peroxidase followed by incubation with a 50% protein blocking agent. Fetal bovine serum (10%), with or without HIN1 antibody (1:60), was applied to each slide, and the slides were incubated for 30 min, and counter stained with hematoxylin. Tissues without the specific an tibody were used as negative controls. AntiHIN1 (Novus Biologicals, Littleton, USA) and PV6000G Kit (Beijing Zhongshan Jinqiao Biotechnology, Beijing, China) were used for the immunohistochemical (IHC) staining. HIN1 expression was regarded as positive when 10% or more cancer cells exhibited HIN1 expression. Statistical analysis The statistical analyses of the experimental data were carried out using SPSS 13.0 software for Windows (Chi cago, IL). P values for dichotomous variables were two tailed and based on the Pearson 2 test or the Pearson 2 test with continuity correction. Continuous variables were analyzed with Students t test. A value of P < 0.05 was considered statistically significant.

RESULTS
Silence of HIN-1 expression through methylation of HIN-1 gene promoter and 5-aza-2-deoxycytidine induction of HIN-1 gene expression in gastric cancer cell lines To find out whether the silence of HIN-1 gene expression is caused by methylation of the HIN-1 gene promoter, we first detected the methylation status of HIN-1 in 5 gastric cancer cell lines. The MSP analysis showed that HIN-1 gene promoter was highly methylated in AGS, PHM82, and BCG823 cells, but not methylated or partially methyl ated in NUGC 3 and KATOIII cell lines (Figure 1A). We detected HIN-1 expression in five gastric cancer cell lines and found that HIN1 mRNA was not expressed in AGS, PHM82, and BCG 823 cells, but expressed in NUGC 3 and weakly expressed in KATOIII cells. HIN1 expres sion was induced or upregulated in these cell lines after we treated them with 5aza2deoxycytidine (Figure 1B).

WJG|www.wjgnet.com

528

January 28, 2011|Volume 17|Issue 4|

Gong Y et al . HIN-1 methylation in gastric carcinoma

BCG823 KATOIII U M U M

AGS U M

PHM82 U M

NUGC3 U M

IVD U M

NL U M

H2O Mw U M

Table 1 Association of high in normal-1 methylation with clinicopathologic characteristics in gastric cancer
Variable Sex Male Female Age (yr) 50 > 50 Tumor size (cm) <5 5 Tumor differentiation Moderate/poor Well Stage - - Nodal status +
a

5-aza HIN-1 GAPDH

BCG823 +

KATOIII +

AGS +

PHM82 +

NUGC3 +

Mw

Patients

methylation 17 9

HIN-1

P value
0.161

32 13 14 31 25 19 21 23 13 29 9 35

Figure 1 Silence of high in normal-1 gene expression due to methylation of high in normal-1 gene promoter in gastric carcinoma cell lines. A: Methylation-specific polymerase chain reaction analysis of high in normal-1 (HIN-1) gene promoter methylation in five gastric carcinoma cell lines. U: Unmethylated alleles; M: Methylated alleles. In vitro methylated DNA (IVD) and DNA from normal human peripheral lymphocytes were used as methylated and unmethylated controls; B: Gastric cancer cell lines were treated with or without 5-aza-CdR (-AZ) for up to 96 h. HIN-1 mRNA levels were measured by semi-quantitative reverse transcription polymerase chain reaction analysis, and glyceraldehyde3-phosphate dehydrogenase (GAPDH) served as control. The 1-kb marker indicated an appropriate size for the amplified products. HIN-1 expression varied among cell lines. The presence of methylation of HIN-1 corresponds directly to the loss of expression of the genes in each cell line.

0.401 9 17 0.283 16 10 17 8 0.683 7 17 0.903 5 20

0.000a

Suppression of gastric cancer cell viability with 5-aza-2 -deoxycytidine treatment We determined the ability of 5aza2deoxycytidine to reg ulate gastric cancer cell viability using BCG823 cells treat ed with 5aza2deoxycytidine. The results showed that treatment with 1 mol/L of 5aza2deoxycytidine for up to 6 d significantly upregulated expression of HIN-1 but reduced the number of the viable cells (Figure 2A) and induced them to undergo apoptosis compared with the untreated tumor cells (20.46% 1.24% vs 11.28% 1.01%, P = 0.001, Figure 2B). These data were associated with HIN-1 expression induced by 5aza2deoxycytidine (Figure 1B and Figure 2A). Aberrant hypermethylation of HIN-1 gene promoter in primary gastric carcinomas To translate this in vitro finding into ex vivo tissue speci mens, MSP analysis of HIN-1 gene promoter methyla tion was conducted in 45 patients with human gastric carcinoma (32 male and 13 female). The patients average age was 55 13 years and other clinicopatho logical data are listed in Table 1. MSP analysis showed that methylation of the HIN-1 gene promoter was fre quently detected in gastric cancer (57.78%, 26/45) and adjacent nontumor tissues (42.1%, 17/38), but not in normal gastric mucosa. Statistically, there was no dif ference in methylation of the HIN-1 gene promoter between gastric cancer and adjacent nontumor tissues. However, there were statistically significant differences between gastric cancer and normal gastric mucosa, and between adjacent nontumor tissues and normal mucosa (Figure 3A and B, P = 0.002 and P = 0.005, respectively). To correlate HIN-1 gene promoter methylation with HIN1 expression, 29 gastric cancer tissues (GCs) were subjected to immunohistochemistry analysis. Represen tative immunostaining is shown in Figure 4A and B. GC cases with low HIN1 immunostaining had more fre quent DNA methylation than GCs with high immunos

Pearsons 2 test using SPSS 13.0 software for Windows. The methylation frequency of well-differentiated tumor vs moderately/poorly tumor. TNM was staged according to the guidelines of the International Union against Cancer. HIN-1: High in normal-1.

taining (53.33% vs 14.29%, P = 0.027, Figure 4C). These data demonstrate that DNA methylation contributes to the decreased expression of HIN1 in GCs. Association of HIN-1 gene promoter methylation with clinicopathological data in gastric cancer patients Methylation status of HIN-1 gene promoter was associat ed with tumor differentiation. The methylation frequency in welldifferentiated and moderately/poorlydifferentiated tumors was 34.78% (8/23) and 80.95% (17/21), respec tively, indicating that HIN-1 was more frequently methyl ated in poorlydifferentiated gastric cancer than that in welldifferentiated gastric cancer (P = 0.000, Table 1). However, there was no correlation between HIN-1 meth ylation and other parameters (such as age, tumor size, and lymph node metastasis) (Table 1).

DISCUSSION
In the current study, we determined HIN1 gene expres sion and the methylation status of the HIN-1 gene pro moter in gastric cancer cells. We found that the expression of HIN1 mRNA was lost in gastric cancer cells. MSP analysis revealed high methylation of the HIN-1 gene pro moter in these tumor cells. 5aza2deoxycytidine treat ment induced HIN1 expression, but reduced viability of gastric cancer cells. Furthermore, ex vivo data demonstrat ed that the HIN-1 gene promoter is frequently methylated in gastric cancer and the adjacent nontumor tissues, but not in normal gastric mucosae. HIN-1 gene promoter methylation was associated with differentiation of gastric cancer. This study demonstrated frequent methylation of the HIN-1 gene promoter in gastric cancer. Therefore, the

WJG|www.wjgnet.com

529

January 28, 2011|Volume 17|Issue 4|

Gong Y et al . HIN-1 methylation in gastric carcinoma

A
1.8 1.6 Absorbance at 492 nm 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 1 2

BCG 823 Without 5aza treatment With 5aza treatment

+ HIN-1 -actin

t /d

10

Without 5aza treatment

10

With 5aza treatment

25 a % of apoptotic cells 20 15 10 5 0

10

10

10

PI

10

PI
0 1 2 3 4

10

10

10

10

10

10 10 Annexin Y FITC

10

10

10

10

10 10 Annexin Y FITC

10

Without 5aza treatment

With 5aza treatment

Figure 2 5-aza-2-deoxycytidine inhibition of gastric cancer cell BCG823 viability through induction of high in normal-1 expression. A: Gastric cancer BCG823 cells were treated with or without 5-Aza-CdR (AZ) for up to 6 d and then subjected to 3-(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4sulfophenyl)-2H-tetrazolium analysis of cell viability before and after 5-Aza-CdR treatment. The high in normal-1 (HIN-1) protein levels were measured by immunoblotting. -: Without 5aza treatment; +: With 5aza treatment; B: BCG-823 cells were subjected to FACs for apoptosis analysis. 5-aza-2-deoxycytidine treatment inhibits BCG-823 cell proliferation (A) and induces them to undergo apoptosis (B) vs the controls (aP < 0.05).

A
U N

IVD M U

NL M

NG1 U M

NG2 U M

NG3 U M

NG4 U M

NG5 U M

Mw

B
Percent methylation

70 60 50 40 30 20 10 0
N NT T a b

GC1 U M NT

GC2 U M

GC3 U M

GC4 U M

GC5 U M

GC6 U M

GC7 U M

GC1 U T M

GC2 U M

GC3 U M

GC4 U M

GC5 U M

GC6 U M

GC7 U M

Figure 3 Methylation-specific polymerase chain reaction analysis of high in normal-1 gene promoter methylation in gastric cancer, adjacent non-tumor tissues, and normal gastric mucosa. A: Representative data of MS-PCR analysis of high in normal-1 (HIN-1) genes in tumor tissues (T), paired adjacent non-tumor tissues (NT) and normal gastric mucosa(N). U: Unmethylated alleles; M: Methylated alleles. In vitro methylated DNA and DNA from normal human peripheral lymphocytes were used as methylated and unmethylated controls; B: Comparison of HIN-1 gene methylation among gastric cancer (T) , adjacent non-tumor tissue (NT) and normal gastric mucosa (N). aStudents t test by SPSS 13.0 software, NT vs N, P = 0.005; bT vs N, P = 0.002.

HIN-1 gene promoter methylation may be further evalu ated as a biomarker for early detection of gastric cancer. Inactivation of tumor suppressor genes contributes to cancer development. Such inactivation may be caused by genetic or epigenetic alterations, including gene mutation, deletion, promoter methylation, abnormal splicing, de regulation of imprinting and haploinsufficiency[4]. Among these abnormalities, loss of heterozygosity (LOH) was

shown to cause inactivation of most candidate tumor suppressor genes in the critical regions of chromosomes 3p, 5q, 8p and 9p[1720]. However, changes in methylation status of these genes also frequently occur. The HIN-1 gene is located at 5q35 and plays a role in epithelial cell differentiation. HIN1 can also regulate cellcycle reentry, suppresses tumor cell migration and invasion, and induces apoptosis in breast cancer cell lines[10]. The HIN-1 gene is

WJG|www.wjgnet.com

530

January 28, 2011|Volume 17|Issue 4|

Gong Y et al . HIN-1 methylation in gastric carcinoma

14 12 10

P = 0.027

12

Methylated Unmethylated

No. of cases

8 6 4 2 0

8 7

Low expression

High expression

Figure 4 Immunohistochemical analysis of high in normal-1 protein expression in gastric cancer tissue samples. A: Tumor cells with methylated alleles of high in normal-1 (HIN-1) gene promoter exhibited negative staining; B: Cancer cells without HIN-1 gene promoter methylation exhibited positive staining. HIN-1 expression in gastric cancer (membrane staining, arrow); C: The association of HIN-1 methylation with HIN-1 expression level was analyzed in 29 gastric cancers. High expression: +-+++ staining intensity with 10% or more cancer cells positively stained, otherwise it is considered as low expression. The staining intensity and percentage of staining were compared with a non-cancerous area of the same section. aPearson 2 test or Pearson 2 test with continuity correction by SPSS 13.0 software. A, B: IHC, 200.

frequently methylated in different cancers, but not by mu tation[11]. For example, HIN-1 gene promoter hypermeth ylation was found in the majority (70%) of breast cancer and preinvasive lesions. Hypermethylation of the HIN-1 promoter region also occurs in cancer and the adjacent tissues of the lung, prostate, pancreas, and esophagus, but not in normal tissues[21]. Methylation of the HIN-1 gene promoter was associated with esophageal squamous carci noma progression[14]. Our current data demonstrated ab errant methylation of HIN-1 gene promoter regions and subsequent loss of HIN1 expression in gastric cancer cell lines and tumor tissue specimens. These results are con sistent with previous studies on other cancers[9,12]. HIN-1 methylation existed in 57.78% (26/45) of gastric cancer and 42.1% (17/38) of adjacent nontumor tissues, which indicated that it is a common feature of gastric cancer and may be the early stage accident in gastric carcinogenesis. The pathogenesis of intestinaltype gastric cancer is usually initiated or caused by Helicobacter pylori (H. pylori) infection[22]. However, the underlying mechanism remains to be defined, and a better understanding of pathogenesis of gastric cancer could help develop molecular diagnostic and patienttailored therapeutic targets[23]. In the previ ous studies, we reported that field defect, an area of abnormal tissue that precedes and is predisposed to the development of cancer, could be predicted by detection of gene promoter methylation[24]. Such abnormal fields are of interest because they give insight into the early

stages of carcinogenesis and may provide biomarkers of cancer risk[25,26]. Aberrant promoter hypermethylation has been shown to be a common event in human cancer mainly due to the loss of function of tumor suppressor. This neoplasiarelated event is thought to occur early in carcinogenesis, and hence, promoter hypermethylation is being widely studied as a biomarker for the diagnosis and detection of early lesions. In this context, HIN-1 was frequently methylated in gastric carcinoma adjacent tis sues but not in normal gastric mucosa. It suggests that HIN-1 methylation may represent the field defect of gas tric carcinoma. HIN-1 gene promoter methylation may be an early event in gastric cancer. However, further studies are required to determine whether H. pylori infection is responsible for this. Our current data showed a statistical difference be tween methylation of the HIN-1 gene promoter and gastric cancer differentiation, HIN-1 was more frequently methylated in poorlydifferentiated gastric carcinomas than in welldifferentiated ones, which may suggest the role of HIN-1 in regulation of cell differentiation. We also found that methylation of HIN-1 gene pro moter only occurred in gastric cancer but not in normal gastric mucosa. 5aza2deoxycytidine induced expres sion of HIN1, which is associated with reduced viability of gastric cells, indicating that HIN1 plays an important role in suppressing gastric carcinogenesis. However, we cannot rule out whether other tumor suppressor genes

WJG|www.wjgnet.com

531

January 28, 2011|Volume 17|Issue 4|

Gong Y et al . HIN-1 methylation in gastric carcinoma

are also induced and restored by 5aza2deoxycytidine, which plays a role in regulation of tumor cell viability. The latter warrants further studies because some other stud ies showed that epigenetic modification of pro-apoptotic genes is one of the mechanisms by which the tumor cells are resistant to chemotherapy[27,28]. Therefore, treatment with a demethylating agent like 5aza2deoxycytidine prior to chemotherapy may help improve the therapeutic efficacy for gastric cancer. In summary, silence of HIN1 expression is achieved through the gene methylation in gastric cancer. Methyla tion of HIN-1 is correlated with tumor differentiation. Future studies will evaluate whether HIN-1 gene promot er methylation can be used as a biomarker for the early detection of gastric cancer.

7 8

10

COMMENTS COMMENTS
Background
Gastric cancer is the second most common cause of cancer death worldwide. However, the cause of gastric cancer development remains to be determined. Lost expression of tumor suppressor genes, such as high in normal-1 (HIN-1), may contribute to the development of gastric cancer. This study determined the cause of HIN-1 gene inactivation: epigenetic silence through methylation of the gene promoter.

11

12

Research frontiers

Silence of HIN-1 gene through hypermethylation of the gene promoter is a common event in different cancers including breast, prostate, and non-small cell lung cancers and malignant mesotheliomas, lymphoma, retinoblastoma, Wilms tumor, and rhabdomyosarcoma. This study investigated the role of HIN-1 in gastric cancer and showed for the first time that the hypermethylation of HIN-1 gene promoter was the mechanism for HIN-1 gene silence in gastric cancer.

13

14 15 16

Innovations and breakthroughs

The authors confirmed the methylation of HIN-1 gene promoter in human gastric cancer cell lines and determined the role of 5-aza-2-deoxycytidine in regulation of HIN-1 expression in gastric cancer cells.

Applications Terminology

The HIN-1 gene promoter methylation may be further evaluated as a biomarker for early detection of gastric cancer. HIN-1 gene was originally isolated through a serial analysis of gene expression from normal and ductal carcinoma in situ luminal mammary epithelial cells. HIN-1 gene promoter is frequently methylated in gastric cancer and the adjacent non-tumor tissues, but not in normal gastric mucosa.

17

Peer review

This manuscript demonstrated promising data illustrating the methylation status of H1N-1 gene promoter and its potential role in suppression of gastric carcinoma development.

18

REFERENCES
1 2 3 4 5 6 Hersznyi L, Tulassay Z. Epidemiology of gastrointestinal and liver tumors. Eur Rev Med Pharmacol Sci 2010; 14: 249-258 Brenner H, Rothenbacher D, Arndt V. Epidemiology of stomach cancer. Methods Mol Biol 2009; 472: 467-477 Arkenau HT. Gastric cancer in the era of molecularly targeted agents: current drug development strategies. J Cancer Res Clin Oncol 2009; 135: 855-866 Yasui W, Sentani K, Motoshita J, Nakayama H. Molecular pathobiology of gastric cancer. Scand J Surg 2006; 95: 225-231 Herman JG, Baylin SB. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 2003; 349: 2042-2054 Wang JF, Dai DQ. Metastatic suppressor genes inactivated

19

20

21

by aberrant methylation in gastric cancer. World J Gastroenterol 2007; 13: 5692-5698 Tokugawa T, Sugihara H, Tani T, Hattori T. Modes of silencing of p16 in development of esophageal squamous cell carcinoma. Cancer Res 2002; 62: 4938-4944 Huang KH, Huang SF, Chen IH, Liao CT, Wang HM, Hsieh LL. Methylation of RASSF1A, RASSF2A, and HIN-1 is associated with poor outcome after radiotherapy, but not surgery, in oral squamous cell carcinoma. Clin Cancer Res 2009; 15: 4174-4180 Krop IE, Sgroi D, Porter DA, Lunetta KL, LeVangie R, Seth P, Kaelin CM, Rhei E, Bosenberg M, Schnitt S, Marks JR, Pagon Z, Belina D, Razumovic J, Polyak K. HIN-1, a putative cytokine highly expressed in normal but not cancerous mammary epithelial cells. Proc Natl Acad Sci USA 2001; 98: 9796-9801 Krop I, Parker MT, Bloushtain-Qimron N, Porter D, Gelman R, Sasaki H, Maurer M, Terry MB, Parsons R, Polyak K. HIN-1, an inhibitor of cell growth, invasion, and AKT activation. Cancer Res 2005; 65: 9659-9669 Krop I, Player A, Tablante A, Taylor-Parker M, LahtiDomenici J, Fukuoka J, Batra SK, Papadopoulos N, Richards WG, Sugarbaker DJ, Wright RL, Shim J, Stamey TA, Sellers WR, Loda M, Meyerson M, Hruban R, Jen J, Polyak K. Frequent HIN-1 promoter methylation and lack of expression in multiple human tumor types. Mol Cancer Res 2004; 2: 489-494 Wong TS, Kwong DL, Sham JS, Tsao SW, Wei WI, Kwong YL, Yuen AP. Promoter hypermethylation of high-in-normal 1 gene in primary nasopharyngeal carcinoma. Clin Cancer Res 2003; 9: 3042-3046 Lehmann U, Berg-Ribbe I, Wingen LU, Brakensiek K, Becker T, Klempnauer J, Schlegelberger B, Kreipe H, Flemming P. Distinct methylation patterns of benign and malignant liver tumors revealed by quantitative methylation profiling. Clin Cancer Res 2005; 11: 3654-3660 Guo M, Ren J, Brock MV, Herman JG, Carraway HE. Promoter methylation of HIN-1 in the progression to esophageal squamous cancer. Epigenetics 2008; 3: 336-341 Blin N, Stafford DW. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res 1976; 3: 2303-2308 Herman JG, Graff JR, Myhnen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA 1996; 93: 9821-9826 Gorringe KL, Ramakrishna M, Williams LH, Sridhar A, Boyle SE, Bearfoot JL, Li J, Anglesio MS, Campbell IG. Are there any more ovarian tumor suppressor genes? A new perspective using ultra high-resolution copy number and loss of heterozygosity analysis. Genes Chromosomes Cancer 2009; 48: 931-942 Franko J, Krasinskas AM, Nikiforova MN, Zarnescu NO, Lee KK, Hughes SJ, Bartlett DL, Zeh HJ 3rd, Moser AJ. Loss of heterozygosity predicts poor survival after resection of pancreatic adenocarcinoma. J Gastrointest Surg 2008; 12: 1664-1672; discussion 1672-1673 Chang YC, Yeh KT, Liu TC, Chang JG. Molecular cytogenetic characterization of esophageal cancer detected by comparative genomic hybridization. J Clin Lab Anal 2010; 24: 167-174 Ye Y, McDevitt MA, Guo M, Zhang W, Galm O, Gore SD, Karp JE, Maciejewski JP, Kowalski J, Tsai HL, Gondek LP, Tsai HC, Wang X, Hooker C, Smith BD, Carraway HE, Herman JG. Progressive chromatin repression and promoter methylation of CTNNA1 associated with advanced myeloid malignancies. Cancer Res 2009; 69: 8482-8490 Shigematsu H, Suzuki M, Takahashi T, Miyajima K, Toyooka S, Shivapurkar N, Tomlinson GE, Mastrangelo D, Pass HI, Brambilla E, Sathyanarayana UG, Czerniak B, Fujisawa T, Shimizu N, Gazdar AF. Aberrant methylation of HIN-1 (high

WJG|www.wjgnet.com

532

January 28, 2011|Volume 17|Issue 4|

Gong Y et al . HIN-1 methylation in gastric carcinoma

in normal-1) is a frequent event in many human malignancies. Int J Cancer 2005; 113: 600-604 Hamilton JP, Meltzer SJ. A review of the genomics of gastric cancer. Clin Gastroenterol Hepatol 2006; 4: 416-425 Chen J, Rcken C, Malfertheiner P, Ebert MP. Recent advances in molecular diagnosis and therapy of gastric cancer. Dig Dis 2004; 22: 380-385 Guo M, House MG, Hooker C, Han Y, Heath E, Gabrielson E, Yang SC, Baylin SB, Herman JG, Brock MV. Promoter hypermethylation of resected bronchial margins: a field defect of changes? Clin Cancer Res 2004; 10: 5131-5136 Bernstein C, Bernstein H, Payne CM, Dvorak K, Garewal H. Field defects in progression to gastrointestinal tract cancers. Cancer Lett 2008; 260: 1-10 Belshaw NJ, Pal N, Tapp HS, Dainty JR, Lewis MP, Williams MR, Lund EK, Johnson IT. Patterns of DNA methylation in individual colonic crypts reveal aging and cancer-related field defects in the morphologically normal mucosa. Carcinogenesis 2010; 31: 1158-1163 Nyce J, Leonard S, Canupp D, Schulz S, Wong S. Epigenetic mechanisms of drug resistance: drug-induced DNA hypermethylation and drug resistance. Proc Natl Acad Sci USA 1993; 90: 2960-2964 Tian K, Jurukovski V, Wang XP, Kaplan MH, Xu H. Epigenetic regulation of WTH3 in primary and cultured drugresistant breast cancer cells. Cancer Res 2005; 65: 10024-10031 S- Editor Sun H L- Editor Ma JY E- Editor Zheng XM

22 23 24

26

27

25

28

WJG|www.wjgnet.com

533

January 28, 2011|Volume 17|Issue 4|