Sei sulla pagina 1di 45

I GENI REPORTER

-Sono geni che codificano un prodotto la cui attività è facilmente rilevabile e quantificabile,
privi della regione del promotore.

-Vengono posti a valle di una regione del promotore che normalmente controlla geni diversi

-L’attività della proteina codificata da gene reporter indica l’avvenuta attivazione del
promotore
lacZ

Spettrofotometro
La LUCIFERASI

luciferasi
luciferina

Luciferasi
ATP + D-luciferina + O2---------> oxyluciferina + AMP + PPi + CO2 + luce

LUMINOMETRO
La GREEN FLUORESCENT PROTEIN (GFP) e i suoi derivati

Aequorea victorea
Prof. Osamu Shimomura

Centro attivo della gfp


Mutando la proteina o il centro attivo si sono prodotte gfp che
emettono diverse bioluminescenze
La PEROSSIDASI

luminometro

luminolo
I geni reporter possono anche essere anche usati per produrre proteine di fusione per seguire la
localizzazione di una proteina nei tessuti o a livello subcellulare
ALCUNE APPLICAZIONI DEI GENI REPORTER

-isolamento di NUOVE REGIONI DI REGOLAZIONE DELLA TRASCRIZIONE da library genomiche

-valutazione dell’ATTIVITA’ DI UN TRANSATTIVATORE TRASCRIZIONALE

-individuazione di proteine che interagiscono tra di loro in vivo: IL DOPPIO IBRIDO NEL LIEVITO
Uso dei geni reporter per
L’ISOLAMENTO DI NUOVE REGIONI DI REGOLAZIONE DELLA TRASCRIZIONE DA UNA
LIBRARY GENOMICA

Scannerizzazione di una regione del promotore alla


ricerca di sequenze regolatrici, attracerso mutagenesi
DAL GENE ALLA PROTEINA………………………E RITORNO
I TRANSATTIVATORI TRASCRIZIONALI

Proteine che controllano la trascrizione agendo in TRANS, legandosi


alle sequenze regolatrici di un gene, che agiscono invece in CIS, reclutando sulla TATA box
l’apparato trascrizionale basale

Per svolgere questa funzione sono essenziali due domini

1) DOMINIO DI LEGAME SPECIFICO AL DNA

2) DOMINIO DI ATTIVAZIONE
1) IL DOMINIO CHE LEGA IL DNA (DBD)

La selettività del transattivatore risiede nel riconoscimento di sequenze nucleotidiche


specifiche (elementi regolatori):

a) Riconoscimento di distorsioni dell’elica dipendenti dalla sequenza nucleotidica

Elica ideale: 36°° di giro d’elica tra due coppie di basi adiacenti
(10 coppie di basi per giro completo)

Es: AAAANNN

La geometria della doppia elica dipende dalla sequenza nucleotidica


b) Riconoscimento delle informazioni chimiche offerte dal bordo della
doppia elica (solco maggiore)
Interazioni tipiche tra aa del DBD e gruppi chimici delle basi del DNA esposti
Lungo il solco maggiore del sito riconosciuto dal transattivatore

Arg-G Asn-A

Il DBD interagisce con circa 20 nucleotidi, in modo da intraprendere una interazione estremamente
FORTE e SPECIFICA
NAME DNA SEQUENCE RECOGNIZED*

Bacteria
lac repressor 5′′AATTGTGAGCGGATAACAATT
3′′TTAACACTCGCCTATTGTTAA
CAP TGTGAGTTAGCTCACT
ACACTCAATCGAGTGA
lambda repressor TATCACCGCCAGAGGTA
ATAGTGGCGGTCTCCAT
Yeast
Gal4 CGGAGGACTGTCCTCCG
GCCTCCTGACAGGAGGC
α2
Matα CATGTAATT
GTACATTAA
Gcn4 ATGACTCAT
TACTGAGTA
Drosophila
Kruppel AACGGGTTAA
TTGCCCAATT
Bicoid GGGATTAGA
CCCTAATCT
Mammals
Sp1 GGGCGG
CCCGCC
Oct-1 Pou domain ATGCAAAT
TACGTTTA
GATA-1 TGATAG
ACTATC
MyoD CAAATG
GTTTAC
p53 GGGCAAGTCT
CCCGTTCAGA
•Each protein in this table can recognize a set of closely related DNA sequences; for convenience, only one recognition
•sequence, rather than a consensus sequence, is given for each protein.
Sebbene ciascun esempio di riconoscimento proteina-DNA sia unico nei dettagli
esistono delle serie di motivi strutturali che legano il DNA

-ELICA-GIRO-ELICA
Es: i GENI OMEOTICI
DITA DI ZINCO
CERNIERA DI LEUCINE

ELICA-ANSA-ELICA
L’ETERODIMERIZZAZIONE ESPANDE IL REPERTORIO DI SEQUENZE DI DNA RICONOSCIUTE
DA PROTEINE CHE REGOLANO I GENI

repressore
2) IL DOMINIO DI ATTIVAZIONE

-La sua funzione è quella di attrarre, modificare e posizionare l’apparato trascrizionale


basale (TFII + RNApol II)

-può avere una configurazione non strutturata finchè non entra in contatto con una proteina
co-attivatrice
I transattivatori trascrizionali modificano la struttura locale della cromatina

A) Dirigendo l’iperacetilazione degli istoni a livello delle sequenze che


regolano la trascrizione

B) Reclutando complessi proteici di rimodellamento della cromatina


A) La iperacetilazione degli istoni attenua la carica positiva delle code istoniche
B) I complessi di rimodellamento della cromatina permettono lo scorrimento
del nucleosoma
L’effetto dell’interazionetra attivatori
sulla trascrizione è cooperativo
Più transattivatori possono cooperare per stimolare l’assemblaggio dei complessi
di inizio, combinandosi in modo da determinare espressione cellulo-specifica

epatocita
QuickTime™ and a
Cinepak decompressor
are needed to see this picture.
Regolazione dell’attività dei transattivatori trascrizionali negli
eucarioti superiori

Segnali provenienti dall’esterno/interno della cellula modificano l’espressione genica nodulando


l’attività dei transattivatori trascrizionali
Un unico transattivatore trascrizionale può tenere sotto controllo molti geni, in modo da poter coordinare
risposte integrate e complesse agli stimoli esterni

L’adattamento all’ipossia

EFFETTI A BREVE TERMINE *EFFETTI A LUNGO TERMINE


-Incremento della frequenza respiratoria -Incremento del numero degli eritrociti
-Aumento del flusso circolatorio -Proliferazione dei capillari
-Aumento della glicolisi
HIF1α
α (Fattore Inducibile dall’Ipossia 1α
α)

HIF1α
α

Tirosina idrossilasi *Epo Enzimi glicolisi *VEGF Enzimi trasporto glucosio


(sintesi catecolamine) eritropioesi angiogenesi
vasocostrizione periferica
frequenza cardiaca
broncodilatazione
glicogenolisi IPOSSIA
(Sensore dell’O2)

Trascrizione e traduzione

ub
degradazione HIF1α
α
HIF1α
α HIF1β
β NORMOSSIA
HIF1β
β
NF-KB: il grande integratore della risposta allo stress

STRESS
Degradazione di IkB
p53

Il dominio caldo per le mutazioni


è il DBD: alterazioni, sia della
struttura del DBD, sia degli aa
che legano direttamente il DBD
Regolazione dell’attività di p53

1) MDM2: segnala p53 per l’ubiquitinazione degradazione

Cinasi attivate dal


danno al DNA

reclutamento del macchinario


replicativo

Sensori del danno al DNA: attivano specifiche cinasi che modificano


la regione di legame a MDM2: stabilizzazione dell’emivita e accumulo
di p53
2) La localizzazione subcellulare

NES: Sequenza di Esportazione dal Nucleo (compresa nel dominio di tetramerizzazione)


NLS: Sequenza di Localizzazione Nucleare

La tetramerizzazione maschera l’NES p53 entra nel nucleo

3) Le modificazioni covalenti

Fosforilazioni e acetilazioni del carbossiterminale


VALUTAZIONE DELL’ATTIVITA’ DI UN TRANSATTIVATORE TRASCRIZIONALE (es: p53)

Si clona a monte del gene reporter


pMDM2 la sequenza regolatrice prelevata
da un gene attivato dal transat-
tivatore oggetto di studio

1) Trasfezione delle cellule col vettore

2) Applicazione dello stimolo


(es: irradiazione = danno al DNA)
p53
3) Misurazione dell’attività del gene reporter

Es: stimolo infiammatorio


Molte vie di trasduzione del segnale avvengono per interazione di proteine,
senza necessità di modificazioni covalenti

Esempio: le vie che conducono all’APOPTOSI


I RECETTORI DELLA MORTE
DEPRIVAZIONE DI GF
DEPRIVAZIONE DI CITOCHINE

LA VIA DEL MITOCONDRIO


La via dei RECETTORI DELLA MORTE

Il ligando induce trimerizzazione del


recettore

DD= dominio di morte


/MORT1

DED= dominio effettore della


morte

APOPTOSI
La VIA DEL MITOCONDRIO

p53 Danno genotossico


Come si scoprono le interazioni tra proteine?

IL DOPPIO IBRIDO NEL LIEVITO

Ct
GAL4 di S.cerevisiae: transattivatore necessario
per l’espressione di geni codificanti
Nt
enzimi per l’utilizzo del lattosio,
indotti dalla presenza del substrato

Dominio Nt Corrisponde al DBD. Si lega alle UASG


del lievito

Dominio Ct Corrisponde al dominio di attivazione

GAL1-lacz: gene di fusione di tipo reporter.

GAL1: contiene le UASG di lievito


LacZ: gene di E. coli. Permette l’utilizzo di X-gal
Contiene la parte del Contiene la parte del
gene di GAL4 (Nt) per gene di GAL4 (Ct) per il
il DBD di GAL1 (UASG) DA di GAL1 (UASG)

A valle di esso si clona


A valle di esso si clona
il gene codificante la
una genoteca di cDNA
proteina di cui si vuole
prodotta da cellule in cui
determinare un partner
la proteina è attiva, per
di interazione, detto
individuare il partner di
ESCA (es. bcl-2)
interazione (PESCE)

Leu+ Trp+

Si usano lieviti del ceppo GGY1::171 GAL4-, Leu-, Trp-


GAL1-lacZ
Si usano lieviti del ceppo GGY1::171 GAL4-, Leu-, Trp-

GAL1-lacZ

Devono crescere in terreno contenente Leu e Trp

bcl2

Trasformazione del lievito con


Il plasmide contenente l’esca e
Selezione dei lieviti contenenti il plasmide
Crescita in terreno Leu-/Trp+

y
x
Ulteriore trasformazione dei lieviti
con la genoteca di fusione e crescita
in terreno Leu-/Trp-
z

Selezione dei doppi ibridi

………….
Le cellule vengono incubate in piastre in presenza di X-gal per la ricerca di colonie blu =ricostituzione
della attività beta-galattosidasica = riavvicinamento di GAL4 Nt e GAL4 Ct. Interazione tra ESCA
e PESCE: quel clone contiene il gene codificante la proteina che interagisce con l’esca (es. per Bcl-2, BAX)

STUDIO DELL’ESCA PER CLONAGGIO, SEQUENZIAMENTO, ECC.

QuickTime™ and a
Cinepak decompressor
are needed to see this picture.