Class Name

Candidate Number

ANGLO-CHINESE JUNIOR COLLEGE Preliminary Examination 2009 BIOLOGY

HIGHER 1 Paper 1 Multiple Choice 1 hour Additional Materials: Multiple Choice Answer Sheet

8875 / 01
02 SEPT 2009

INSTRUCTIONS TO CANDIDATES Write your name, Centre number and candidate number on the multiple choice answer sheet provided. There are thirty questions in this paper. Answer all questions. For each question there are four possible answers, A, B, C and D. Choose the one you consider correct and record your choice in soft pencil on the separate answer sheet. Read very carefully the instructions on the answer sheet.

INFORMATION FOR CANDIDATES Each correct answer will score one mark. A mark will not be deducted for a wrong answer. Any rough working should be done in this booklet. Calculators may be used.

This document consists of 11 printed pages and 1 blank page.

Anglo-Chinese Junior College 8875/01/Prelim 09 [Turn over

2
1 What is the role of cholesterol in the cell surface membrane? A B C D To allow active transport of sodium ions into cell. To allow facilitated diffusion of chloride ions across membrane. To provide hydrophilic channels. To regulate fluidity of the membrane.

The diagram shows a cell found in an organ in the human body.

From its structure, what are the functions of this cell? A B C D Intracellular digestion and storage of granules of product. Phagocytosis, pinocytosis and secretion. Secretion and transport of protective mucus. Uptake and transport of ions and molecules.

The diagram represents a cell membrane.

Which structure allows the diffusion of Cl ions between the outside and inside of the cell? A B C D A only B only A and B C and D
8875/01/Prelim 09 [Turn over

Anglo-Chinese Junior College

3
4 An enzyme is a globular protein held together by several different types of bonds, giving the enzyme primary, secondary and tertiary levels of structure. Which combination correctly summarises the types of bond involved in each level of structure? Disulphide bonds A B C D Primary Primary, tertiary Secondary Tertiary Hydrogen bonds Tertiary Primary Secondary Secondary, tertiary Ionic bonds Secondary Secondary, tertiary Tertiary Tertiary Peptide bonds Tertiary Secondary Primary Primary

The diagram below shows a molecule.

Which substance below will contain this molecule? A B C D Amylase Amylose Glycogen Starch

Which molecule is found in glycogen?

Anglo-Chinese Junior College

8875/01/Prelim 09

[Turn over

4
7 In an experiment using starch and amylase, the concentrations of starch and maltose present in the reacting mixture are measured every minute for 20 minutes. 1% hydrochloric acid is added after 10 minutes and the mixture is heated to 60C at 14 minutes. Which graph represents the results of this experiment?

The figure below shows a hypothetical diploid cell with six chromosomes.

Which of the following statements are true? I II III A B C D I only I and II only I and III only I, II, and III
8875/01/Prelim 09 [Turn over

This cell is at prophase of mitosis as the chromosomes are distinct and nuclear membrane is disintegrating. R and T have the same genes and same number of genes. R and S have the same alleles and same number of genes.

Anglo-Chinese Junior College

5
9 Which of the following enzymes synthesises DNA from an RNA template? A B C D DNA ligase DNA polymerase Restriction enzyme Reverse transcriptase

10

A molecule of tRNA has an anticodon sequence of AUC. What is the DNA sequence that would code for the amino acid carried by this tRNA molecule? A B C D ATC AUC TAG UAG

11

Five different amino acids (numbered 1 to 5 below) form the following sequence in part of a polypeptide chain: 2------3------4------1------3------5------2 Messenger RNA (mRNA) codons which correspond to these amino acids are: amino acid 1 amino acid 2 amino acid 3 amino acid 4 amino acid 5 UGU GAU CAC CAA AAG

Which one of the following DNA base sequences could provide the code for the given section of polypeptide? A B C D CTAGTGGTTACAGTGTTCCTA CTAGTGGTTACAGTGTTGCTA CTAGTGGTTTCTGTGTTGCTA CTAGTGGTTACAGTGTTCCTT

Anglo-Chinese Junior College

8875/01/Prelim 09

[Turn over

6
12 Analysis of DNA produced the following ratios of nitrogenous bases. Source of DNA bean seeds cow heart human liver rat bone marrow Ratio of purines to pyrimidines 0.99 1.01 1.02 1.00

Which of the following statements is true? A B C D Animal DNA contains more purines than pyrimidines. Different parts of organisms contain different proportions of purines and pyrimidines. DNA contains thymine instead of uracil. There are variations in the accuracy of analytical techniques.

13

The table shows a comparison between the genomes of a prokaryote and eukaryote.

Which feature of eukaryotes accounts for the differences in the number of proteins with roles in protein synthesis? A B C D The DNA of a eukaryote has histones. The DNA of a eukaryote has introns. The DNA of a eukaryote has more base pairs. The DNA of a eukaryote is separated from the ribosomes by membranes.

14

Which of the following is not a requirement for the mechanism of RNA splicing? A B C D Introns Small nuclear ribonucleoproteins 5 and 3 splice sites 5 modified guanosine cap

Anglo-Chinese Junior College

8875/01/Prelim 09

[Turn over

7
15 An investigator wanted to determine the function of protein X. He cloned gene X into plasmid 1. He then set up another plasmid (plasmid 2) with a binding site for the product of gene X plus a reporter gene. A reporter gene codes for the synthesis of a product that is easily measured. The two plasmids (shown below) were then introduced into the nucleus of a host cell.

He noted that there was an increase in the number of reporter gene transcripts. Which of the following statements is a valid conclusion regarding gene X or product X? A B C D Gene X is an enhancer sequence. Gene X is the promoter sequence. Product X is RNA polymerase. Product X is a transcription factor.

16

Acetylation of histones promotes loose chromatin structure. Recent evidence has shown that such chemical modifications of histones play a direct role in regulation of gene transcription. Suggest how this works. A B C D Acetylation of histone tails neutralises their negative charges and encourage binding of DNA polymerase I. Helicase action is enhanced with acetylation of the histones. RNA polymerase work better by binding to acetyl groups. When nucleosomes are highly acetylated, the chromatin becomes less compact and DNA is more accessible for transcription.

17

A girl has blood group A and her brother has blood group B. Which combination of genotypes cannot belong to their parents? Mother IA IA I A IB IO IO IB IO Father I B IO IA IB IA IB IA IO
8875/01/Prelim 09 [Turn over

A B C D

Anglo-Chinese Junior College

8
18 Fruit flies homozygous for long wings were crossed with flies homozygous for vestigial wings. The F1 generation was raised at 3 different temperatures. The F1 flies were then crossed with each other to produce the F2 generation. The results of the F1 and F2 generation are shown below. Temperature F1 result 21C 26C 31C All long wings All long wings All long wings F2 result 3/4 long wings, 1/4 vestigial wings 3/4 long wings, 1/4 intermediate wings All long wings

Which of the following statements is correct? A B C D Heterozygous flies have vestigial wings only at 21C and below, but have long wings at 31C and above. Long wing and vestigial wing alleles show codominance at 26C. Long wing allele is dominant at higher temperatures, but vestigial wing allele is dominant at lower temperature. Vestigial wing allele is recessive, but causes a vestigial wing phenotype only at lower temperatures.

19

Below is the pedigree for the hereditary disease agammaglobulinemia, a disease in which the patients demonstrate a lack of immunity to pathogenic bacteria and viruses. What is the most likely mode of inheritance of this disease?
normal female normal male affected female affected male

A B C D

Autosomal dominant Autosomal recessive Sex-linked dominant Sex-linked recessive

Anglo-Chinese Junior College

8875/01/Prelim 09

[Turn over

9
20 In many breeds of cattle, the polled condition (the absence of horns) is dominant over the presence of horns, and the true breeding red cattle crossed with true breeding white cattle produce roan offspring. Which one of the following crosses will be likely to produce only horned roan offspring? A B C D horned red x horned white horned roan x horned roan polled red x horned white polled white x horned white

21

Which of the following statements is true? A Continuous variation shows a normal distribution and is only influenced by genetic factors. Continuous variation is controlled by two or more genes and the traits are qualitative. Discontinuous variation shows traits that follow discrete distribution and is mostly influenced by environmental factors. Discontinuous variation shows traits that are controlled by one or two genes and is not influenced by environmental factors.

B C D

22

C-labelled carbon dioxide was supplied to photosynthesising algae. The relative amounts of three organic compounds were measured. The diagram shows the results.

14

Which of the following compounds corresponds to the respective graphs 1, 2 and 3? 1 A B C D GP GP RuBP RuBP 2 RuBP Sugar GP Sugar 3 Sugar RuBP Sugar GP

Anglo-Chinese Junior College

8875/01/Prelim 09

[Turn over

10
23 Which of the following statements regarding events in the functioning of Photosystem II is false? A B C D The electron vacancies in P680 are filled by electrons derived from water. The P680 chlorophyll donates a pair of protons to NADP+, which is thus converted to NADPH + H+. The energy absorbed by accessory pigments is passed to a molecule of P680 in the photosynthetic unit. Excited electrons from P680 are passed down the electron transport chain before being taken up by P700.

24

When cyanide is bound to cytochrome oxidase, the cell can no longer produce ATP aerobically. Which statement below best explains this? A B C D It prevents NADPH from being oxidised to NADP+, hence preventing electron flow down the electron transport chain. It prevents oxygen from accepting electrons and protons to form water, hence preventing electron flow down the electron transport chain. It prevents photolysis from occurring to produce oxygen. It prevents pyruvate from being synthesised in glycolysis, hence stopping the Krebs cycle.

25

In which of the following scenarios would allopatric speciation occur most quickly? A B C D A population of cheetahs undergoing little or no evolutionary change. A population of fishes undergoing directional selection due to the introduction of a new predator. A population of giraffes free to roam the entire nature reserve after the artificial removal of all predators. A population of snails separated by a new fast-flowing river.

26

The table below shows the number of amino acid differences in the alpha haemoglobin chains between the crocodile and various organisms. Lungfish Crocodile 85 Coelacanth 78 Shark 77 Goldfish 70

Which organism is most closely related to the crocodile? A B C D Coelacanth Goldfish Lungfish Shark
8875/01/Prelim 09 [Turn over

Anglo-Chinese Junior College

11
27 Which of the following techniques does not involve complementary base pairing? A B C D DNA fingerprinting Gel electrophoresis Polymerase Chain Reaction Use of gene probe

28

Which of the following characteristics is undesirable in cloning vectors used in genetic engineering? A B C D Ability to replicate in the host cell. Have at least two gene markers. Have at least two restriction sites of a particular restriction enzyme. Small in size.

29

Which of the following is not an example of genetically modified organisms? A B C D AquaAdvantage Salmon that grow to adult size quickly. Bt corn plants that are insect-resistant. Golden Rice that produce high levels of beta-carotene. Milk-producing cows injected with bovine somatotrophin (BST).

30

Which of the following statements about hematopoietic stem cells is false? A B C D They are able to reproduce continually. They are easy to isolate and propagate. They are present in minute quantities in the human body. They can be induced to differentiate under appropriate conditions.

-End of Paper-

Anglo-Chinese Junior College

8875/01/Prelim 09

[Turn over