Sei sulla pagina 1di 60

La Fibrosi Cistica

La più frequente malattia ereditaria cronica che


colpisce indifferentemente i maschi e le femmine
appartenenti prevalentemente alla razza bianca

Etnia Incidenza Freq.


eterozigosi
Caucasici 1/2500 1/25 (4%)

Ebrei Ashkenazi 1/3300 1/29

Ispanici 1/8000 1/46


(America latina)
Africani Americani 1/15000 1/65

Asiatici Americani 1/30000 1/150


Cenni storici
• 1936: per la prima volta vengono messi in relazione disfunzioni
pancreatiche e respiratorie
• 1938: le prime osservazioni anatomo-patologiche in autopsia forniscono
una prima descrizione della malattia

• 1953: rilevazione di eccessi di cloruro di sodio nel sudore


• 1983: osservazione dettagliata degli epiteli respiratori FC mediante
microscopia

• 1989: individuazione della molecola che, se difettata, causa FC: CFTR


Proteina CFTR
“Cystic Fibrosis Transmembrane Regulator”

• Superfamiglia dei trasportatori ABC


(ATP Binding Cassette) trasporto attivo
primario
•Proteina trans membrana
• 1480 Aminoacidi
• Canale per il passaggio di ioni Cloro
• Presente negli epiteli secretori:
ghiandole sudoripare, naso, bronchi,
pancreas, intestino e dotti deferenti.
CFTR: struttura
“Cystic Fibrosis Transmembrane Regulator”

• MSD-1 e MSD2: porzioni trans membrana (alfa-eliche idrofobiche)


• NBD-1 e NBD-2: domini ATPasici
• R: dominio regolatore
CFTR: regolazione
“Cystic Fibrosis Transmembrane Regulator”

1) Quando la proteina non lega i cofattori il canale è chiuso da R


2) Quando l’ATP si lega ai domini NBD e la PKA fosforila R il canale è aperto

Passaggio di ioni cloro dal lato citosolico a quello extracellulare del


plasmalemma
CFTR e Fibrosi Cistica

L’aumento della concentrazione di ioni sodio e


cloro all’interno della cellula compromette
l’attività secretoria epiteliale
Principali sintomi FC
•Tosse frequente
Apparato respiratorio
•Catarro
(epitelio polmonare)
•Stanchezza
•Infezioni respiratorie

•Insufficienza pancreatica
Apparato digerente •Maldigestione
(epitelio intestinale) •Malnutrizione
•Occlusioni intestinali
CFTR: mutazioni
1200 mutazioni diverse, con incidenza variabile
La mutazione più diffusa nella popolazione caucasica è la ∆F508:
Popolaz. anglosassoni: 70%

Popolaz. mediterranea: 50%


Wild type
DNA GAA AAT ATC ATC TTT GGT GTT TCC
Proteina Glu Asn Ile Ile Phe Gly Val Ser
Posizione 504 505 506 507 508 509 510 511

Fibrosi cistica ∆F508


DNA GAA AAT ATC AT- --T GGT GTT TCC
Proteina Glu Asn Ile Ile Gly Val Ser
Posizione 504 505 506 507 508 509 510
CFTR: classi di mutazioni

Classe I: sintesi assente della


proteina

Classe II: compromissione del


trasporto intracellulare

Classe III: difetti della


regolazione (∆F508)

Classe IV: alterazioni a livello dei tratti transmembrana che riducono


la conduttanza del canale

Classe V: mutazioni che non alterano la funzione della proteina ma ne


riducono i livelli di sintesi
Gene CFTR
“Cystic Fibrosis Transmembrane Regulator”

• 250.000 paia di basi


• localizzato sul cromosoma 7

Segue il modello dell’eredità mendeliana


Eredità autosomica recessiva

Allele CFTR wild type: dominante

Allele CFTR “mutato”: recessivo

Chi eredita due copie mutate (Omozigoti)


manifesta i sintomi

Chi eredita una sola copia mutata


(Eterozigoti) non ha nessun sintomo
(Portatore sano)
Diagnosi
valutazione di [Na+] e
Test del sudore [Cl-] nel sudore

Determinazione della
Screening neonatale tripsina nel sangue
lattasi nel meconio
Diagnosi: test del sudore

Stimolazione della
sudorazione mediante
inoforesi

Condizioni normali [Na+] e [Cl-] < 40 mEq/l


Fibrosi cistica [Na+] e [Cl-] > 70 mEq/l
Diagnosi: screening neonatale

Saggio immunologico per


rilevare la quantità di tripsina

I livelli di entrambi questi enzimi


Goccia di sangue prelevata risultano aumentati nei pazienti
in terza giornata
FC per la ridotta funzionalità
pancreatica

Determinazione dei livelli di


Meconio lattasi
CFTR e Fibrosi Cistica

L’aumento della concentrazione di ioni sodio e


cloro all’interno della cellula compromette
l’attività secretoria epiteliale

Infezioni delle vie respiratorie causate da


patogeni opportunisti
Principali responsabili delle infezioni croniche
a carico dei pazienti FC:

Pseudomonas aeruginosa
Staphylococcus aureus
Burkholderia cepacia complex
Haemophilus influenzae
Ralstonia pickettii
Burkholderia gladioli
Alcaligenes xylosoxidans

Coenye et al, 2001


Principali responsabili delle infezioni croniche
a carico dei pazienti FC:

Pseudomonas aeruginosa
Staphylococcus aureus
Burkholderia cepacia complex
Haemophilus influenzae
Ralstonia pickettii
Burkholderia gladioli
Alcaligenes xylosoxidans
Burkholderia: origine

Ambientale: Clinica:
Suolo polmone dei
Rizosfera pazienti FC
Acqua
B. cepacia complex: tassonomia
A causa dell’alto grado di omologia genomica
l’identificazione di questi patogeni risulta molto difficoltosa

Genomovar Specie
I B. cepacia
II B. multivorans III-A
III B. cenocepacia III-B
III-C
IV B. stabilis
III-D
V B. vietnamiensis
VI B. dolosa
VII B. ambifaria
VIII B. anthina
IX B. pyrrocinia
Burkholderia cepacia complex (Bcc)
La colonizzazione delle vie aeree da B. cepacia
e la conseguente infezione polmonare
“sindrome da cepacia ” sono la più importante
causa di malattia tra i pazienti affetti da
Fibrosi Cistica
Coenye et al, 2001

Cura: Terapia antibiotica mirata

Identificazione tempestiva del


patogeno
Scopo
Sviluppo di un test diagnostico
rapido per la discriminazione di
specie e genomovars di
Burkholderia cepacia complex
nella routine clinica
Entrambi questi ospedali
pediatrici ospitano un Centro
Fibrosi Cistica

Biologia
Microbiologia molecolare
del Bcc applicata ai
microrganismi
AFLP RAPD
PCR specifiche 16S rDNA

16S rDNA RFLP

Identificazione e/o
Identificazione e/o
tipizzazione
tipizzazione RFLP del gene recA

Analisi del proteoma


Analisi del contenuto SDS-PAGE
in acidi grassi Test
fenotipici
Analisi di restrizione di recA:
•amplificazione via PCR di un tratto del gene recA:
si ottiene un frammento di circa 1000 pb dai soli
batteri del complex utilizzando i primer BCR1 e BCR2
Mahenthiralingam et al, 2000

Prodotto di
amplificazione
Elettroforesi su gel
di agarosio
Taglio con l’enzima di restrizione HaeIII ed
elettroforesi su gel per visualizzare i profili ottenuti:
Mahenthiralingam et al, 2000

Gvr x Gvr y Gvr z

Si ottengono profili di restrizione diversi per la


presenza di polimorfismi puntiformi all’interno della
sequenza riconosciuta dall’enzima di restrizione.
LIMITI DELLA TECNICA
9 L’uso del solo HaeIII non consente di distinguere ogni
genomovar, ma solo di creare dei pattern di profili di
restrizione
Mahenthiralingam et al, 2000

9 Necessità di confrontare un profilo con tutti i profili


possibili
9 Disponibilità di una banca di ceppi aggiornata

9 Tempi considerevoli per l’ottenimento dei risultati

9 Necessità che il polimorfismo puntiforme genomovar


specifico generi o faccia scomparire un sito di
restrizione
SNuPE
Single Nucleotide Primer Extension

1. Amplificazione via-PCR di un frammento genico


2. Purificazione del templato di PCR
3. Reazione di estensione del primer specifico con
dideossinucleotidi marcati con fluorocromi di
colore e peso molecolare diversi
4. Purificazione del prodotto di reazione
5. Elettroforesi capillare con identificazione di colore
e posizione del fluorocromo incorporato
STEP PRELIMINARI

Analisi delle sequenze del gene scelto alla ricerca di


polimorfismi puntiformi (SNP):

CGCACTGAAGTTCTACTCGTCGGTGCGTCTCGATATCCGCCGGATCGGCTCGAT Specie x
CGCACTGAAGTTCTACTCGTCGGTGCGTCTCGATATCCGCCGGATTGGCTCGAT Specie y
CGCACTGAAGTTCTACTCGTCGGTGCGTCTCGATATCCGCCGGATAGGCTCGAT Specie z

Disegno di primer specifici sulla base degli SNP


individuati
Amplificazione per
PCR della regione contenente
il polimorfismo

T
5’ 3’
A 5’
3’

Il polimorfismo puntiforme precedentemente


individuato, se genomovar-specifico, permette di
discriminare tra loro i vari genomovar in base al
diverso fluorocromo incorporato
Denaturazione

T
5’ 3’

A 5’
3’
Il polimorfismo puntiforme precedentemente
individuato, se genomovar-specifico, permette di
discriminare tra loro i vari genomovar in base al
diverso fluorocromo incorporato
Annealing

T
5’ 3’

A 5’
3’
Il polimorfismo puntiforme precedentemente
individuato, se genomovar-specifico, permette di
discriminare tra loro i vari genomovar in base al
diverso fluorocromo incorporato
Primer extension effettuata
sul prodotto di amplificazione

5’ 3’
T

T
A
3’ 5’

Il polimorfismo puntiforme precedentemente


individuato, se genomovar-specifico, permette di
discriminare tra loro i vari genomovar in base al
diverso fluorocromo incorporato
Elettroforesi capillare
Si visualizza così un picco di colore diverso a seconda del
dideossinucleotide incorporato, di posizione nota in quanto è nota
la lunghezza del frammento (primer specifico + 1 ddNTP)

I
GATATCCGCCGGATCGGCTCGATCGCACTG Specie x

posizione
I
GATATCCGCCGGATTGGCTCGATCGCACTG Specie y

posizione
I
GATATCCGCCGGATAGGCTCGATCGCACTG Specie z

posizione
Individuazione di più polimorfismi

0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2.0 2.2 2.4 Kbp

Specie 1 A C T G C
Specie 2 A G A C T
Specie 3 C A G T A
Specie 4 G T C A G
Specie 5 T A C G T
Progettazione di un set di primer

0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2.0 2.2 2.4 Kbp

Specie 1 A C T G C
Specie 2 A G A C T
Specie 3 C A G T A
Specie 4 G T C A G
Specie 5 T A C G T
Reazione SNuPE in Multiplex

A C T G C
0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2.0 2.2 2.4 Kbp

Specie 1

G T C A G
0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2.0 2.2 2.4 Kbp

Specie 4
Elettroforesi capillare
I
A C T G C
Specie A C T G C
1

Specie A G A C T
2
posizione
Specie C A G T A
3

I
Specie G T C A G
GT C A G 4

Specie T A C G T
5

posizione
Gene gyrB come marcatore
molecolare
Ricerca delle sequenze disponibili
nelle banche dati

Disponibilità di una sola sequenza dell’intero gene


gyrB di B. cenocepacia, ceppo J2315

Score E
Allineamento significativo prodotto dalla sequenza: (bits) Value

gi|52208053|emb|BX571965.1| Burkholderia pseudomallei strai... 2252 0.0


gi|52426793|gb|CP000010.1| Burkholderia mallei ATCC 23344 c... 2228 0.0
gi|19909532|dbj|AB014891.1| Burkholderia cepacia gyrB gene ... 1848 0.0
gi|19909684|dbj|AB014967.1| Burkholderia cepacia gyrB gene ... 1509 0.0
gi|19909686|dbj|AB014968.1| Burkholderia cepacia gyrB gene ... 1495 0.0
Progettazione dei primer per l’amplificazione
del gene gyrB

3 sequenze di B. cepacia prese da banche dati


+
25 sequenze di altri Proteobatteri quali Bordetella, E.coli,
Neisseria, Nitrosomonas, Ralstonia, Salmonella, Xanthomonas

Dall’analisi del multiallineamento di queste sequenze


sono state individuate le regioni conservate del gene
gyrB
Primer per l’amplificazione del gene gyrB

E’ STATO COSI’ POSSIBILE


DISEGNARE UN SET DI 10 PRIMER.

FORWARD REVERSE
• gyr1 • PC5r

• PC2 • PC6r

• PC3 • PC7r

• PC4 • PC8r
• PC9r
• PC10r
TEST DEI PRIMER
10r
9r
8r
7r
5r 6r
1 2 3 4

0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2.0 2.2 2.4 Kbp

gyrB
TEST DEI PRIMER
Ceppo LMG 16654, B. cenocepacia III-B
PC5r PC6r PC8r PC9r

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
M = Marker
1,5,9,13 = gyr1
2,6,10,14 = PC2
3,7,11,15 = PC3
4,8,12,16 = PC4
TEST DEI PRIMER
10r
9r
8r
7r
5r 6r
1 2 3 4

0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2.0 2.2 2.4 Kbp

1-5 +
1-6 +
3-9 +
+
1-9
4-9 +
2-9 +
_
1-10
Coppia di primer gyr1-PC9r

1 2 3 4 5 6 7 8 9 10 11 12

1) LMG 1222 gvr I 7) Mi 5 gvr IV

2) LMG 18822 gvr II 8) TVV75 gvr V

3) LMG 16656 gvr III-A 9) LMG 18941 gvr VI

4) LMG 16654 gvr III-B 10) MCI 7 gvr VII

5) LMG 19230 gvr III-C 11) LMG 16670 gvr VIII

6) So1 gvr III-D 12) ATCC15958 gvr IX


OTTENIMENTO SEQUENZE

Abbiamo ottenuto 69 SEQUENZE del


gene gyrB, della lunghezza di circa
1850bp
Genomovar Sequenze Origine
prodotte
B. cepacia 6 4 FC + 2 A
B. multivorans 11 10 FC +1 A
B. cenocepacia III-A 6 6 FC

B. cenocepacia III-B 17 15 FC +2 A LEGENDA:

B. cenocepacia III-C FC = fibrosi


2 2A
cistica
B. cenocepacia III-D 8 8 FC
B. stabilis A = ambientale
3 3 FC
B. vietnamiensis 3 1 FC + 2 A
B. dolosa 2 2 FC
B. ambifaria 2 1 FC +1 A
B. anthina 2 2A
B. pyrrocinia 6 4FC + 2A
Analisi delle sequenze
nucleotidiche del gene gyrB
gvrI 757 TTGGAAGAGTTCCTGCTTGAAACGCCGATCGACGCGAAGATTATTTGCGGGAAGATTGTT 816
gvrII 668 CTCGAGGAGTTCCTCCTCGAAACGCCGAACGACGCGAAGATCATCTGCGGGAAGATCGTC 727
gvrIII-A 767 CTCGAAGAGTTCCTGCTCGAAACGCCGATCGACGCGAAGATCATCTGCGGGAAGATCGTT 826
gvrIII-B 658 CTGGAAGAGTTCCTGCTCGAAACGCCGATCGACGCGAAGATCATCTGCGGGAAGATCGTC 717
gvrIII-C 751 CTGGAAGAGTTCCTGCTCGAGACGCCTATCGACGCAAAGATCATTTGCGGGAAGATCGTC 810
gvrIII-D 676 CTGGAAGAGTTCCTGCTGGAGACGCCGATCGACGCGAAGATCATCTGCGGGAAGATCGTT 735
gvrIV 650 CTGGAAGAGTTCCTGCTCGAAACGCCGATCGACGCGAAGATCATCTGCGGGAAGATTGTT 709
gvrV 760 CTCGAAGAATTCCTGCTCGAAACGCCGACCGACGCGAAGATCATCTGCGGGAAGATCGTC 819
gvrVI 748 CTCGAGGAGTTCCTGCTGGAAACGCCGATCGACGCGAAGATCATCTGCGGGAAGATCGTC 807
gvrVII 763 CTGGAAGAGTTCCTGCTCGAAACGCCGCTCGATGCGAAGATCATCTGCGGGAAGATCGTC 822
gvrVIII 788 CTGGAAGAGTTCCTTTTGGAAACGCCGATCGACGCGAAGATCATCTGCGGGAAGATCGTT 847
gvrIX 761 CTGGAAGAGTTCCTGCTGGAAACGCCGCTCGACGCGAAGATCATCTGCGGGAAGATCGTC 820

Polimorfismo puntiforme
genomovar specifico

Sono stati individuati più di 400 SNPs e di questi ne


sono stati selezionati sei
Localizzazione dei SNPs scelti nella
sequenza del gene gyrB
Nome
gyr1 PC6r PC9r

Posizione 508 900 989 1028 1068 1168 gyrB


Profili SNuPE attesi

Nome
gyr1 PC6r PC9r

Posizione 508 900 989 1028 1068 1168 gyrB


GvrI G C G A C G
GrvII G A A T C G
GvrIIIa G A G A C G
GvrIIIb G C G A C G
GvrIIIc G T G A C G
GvrIIId G A A A C G
GvrIV A C G A C G
GvrV G C G G C G
GvrVI G C A T C G
GvrVII G C A A C G
GvrVIII G C G A T G
GvrIX G C A A C C
Set di primer per SNuPE

Nome Sequenza 5’-3’ Taglia


(basi)
LF 1 TTGTCCTT(G/C)GT(T/C)TGCGAGCT 20
LF2 TTTTA(C/T)CGCGGCGTCGCGCAGGATCGCGTG 30
LF2(gvr6) TTTTATCGCGGCGTCGCGCAGAATCGGATT 30
LF 3 (11T)ACCTTCACGGA(G/C)AGCACGCACGACA 36
LF 4 (6T)CGACGATCTTCCCGCA(A/G)ATGATCTTCGCGTCG 38
LF 5 (12T)CGTGCTGTGCTTCACGAACAACATTCCGCAGCG 45
LF 6 (13T)ACAAGTACATC(A/G)CCGA(T/C)AACGAAATCGCGAA 50
GAAGGC
SNuPE (simplex) primer LF2

Ceppo TVV75, gvr V Ceppo LMG16654, gvr III-B

Nucleotide Risultato Risultato Nucleotide Risultato Risultato


incorporato atteso ottenuto incorporato atteso ottenuto

C Nero Nero C Nero Nero


SNuPE (simplex) primer LF4

Ceppo TVV75, gvr V Ceppo LMG16654, gvr III-B

Nucleotide Risultato Risultato Nucleotide Risultato Risultato


incorporato atteso ottenuto incorporato atteso ottenuto

G Blu Blu A Verde Verde


SNuPE (Multiplex)

Ceppo gvr Primer Nucleotide incorporato Risultato atteso Risultato ottenuto

LMG 1222 I Multiplex G-C-G-A-C-G B-N-B-V-N-B B-N-B-V-N-B


SNuPE (Multiplex)

Ceppo gvr Primer Nucleotide incorporato Risultato atteso Risultato ottenuto

LMG16656 III-A Multiplex G-A-G-A-C-G B-V-B-V-N-B B-V-B-V-N-B


SNuPE (Multiplex)

Ceppo gvr Primer Nucleotide incorporato Risultato atteso Risultato ottenuto

LMG16654 III-B Multiplex G-C-G-A-C-G B-N-B-V-N-B B-N-B-V-N-B


SNuPE (Multiplex)

Ceppo gvr Primer Nucleotide incorporato Risultato atteso Risultato ottenuto

So1 III-D Multiplex G-A-A-A-C-G B-V-V-V-N-B B-V-V-V-N-B


SNuPE (Multiplex)

Ceppo gvr Primer Nucleotide incorporato Risultato atteso Risultato ottenuto

LMG18942 VI Multiplex G-C-A-T-C-G B-N-V-R-N-B B-N-V-R-N-B


SNuPE (Multiplex)

Ceppo gvr Primer Nucleotide incorporato Risultato atteso Risultato ottenuto

LMG19467 VII Multiplex G-C-A-A-C-G B-N-V-V-N-B B-N-V-V-N-B


Conclusioni

I risultati ottenuti
corrispondono a quelli attesi

Picchi inequivocabili, assenza


di rumore di fondo

Applicabilità alla routine


clinica
Ceppo LMG18942, gvr VI