Sei sulla pagina 1di 87

PROGETTO TRIADE

UNIVERSITA’ SCUOLA LAVORO

"Elementare Watson: questo è DNA.

Utilizzazione del DNA a scopi forensi"


"Icondannatia m orte hanno diritto altestdelD na" Arrestatipresuntirapinatorigrazie alD na
REGGIO EMILIA, 19 APRILE - I carabinieri di
WASHINGTON, 30 SETTEMBRE - Troppo tardi per Barnabei ma Reggio Emilia e di Gioia Tauro hanno arrestato
apre uno spiraglio per i condannati che proclamano la propria
innocenza: un giudice federale della Virginia ha compiuto il primo
due presunti rapinatori di Rosarno (Reggio
passo per garantire ai detenuti il diritto alla prova del Dna. Calabria) dopo essere risaliti alla loro identita'
attraverso l'esame del Dna.

I nuovi test del Dna, eseguiti secondo la difesa su prove


secondarie, hanno confermato la colpevolezza
Gilmore: "Barnabei ARGENTINA: 120 DESAPARECIDOS SI
SOTTOPONGONO ALLA PROVA DEL DNA
sarà giustiziato"
L'italoamericano, avuta la notizia, ha parlato BUENOS AIRES, 22 AGOSTO - Da un mese le
di "complotto" e di "prove inquinate" "Nonne di Plaza de Mayò" hanno lanciato
una campagna pubblicitaria su radio e
televisioni per spingere chiunque abbia il
sospetto di essere figlio di desaparecidos, di
Libero dal braccio della morte grazie al test del Dna chiedere la prove del Dna.
Ingiustamente accusato di violenza e omicidio di una giovane
di colore, afro-americano di Chicago si salva dal patibolo: il suo
incubo raccontato alla tv italiana. Pronto anche un libro, in
memoria di Rocco Barnabei

ROMA, 27 NOVEMBRE - Otto anni nel braccio della morte prima Incriminato stupratore di cui si conosce solo il Dna
di essere scagionato grazie all'avvocato di O.J. Simpson e a un
test del Dna. È la storia di Roland Jones, afro-americano di Il 'violentatore dell'East Side' è accusato di aver
Chicago, rimasto stritolato dalla macchina della giustizia aggredito sedici donne dal '94 in poi.
americana che lo aveva ingiustamente accusato di violenza e
omicidio di una giovane donna di colore.
WASHINGTON, 16 MARZO - E' una prima assoluta:
il procuratore distrettuale di Manhattan, Robert
Sul corpo della vittima nessuna traccia Morgenthau ha incriminato uno stupratore di cui
dell'ex fidanzato non si conosce identita' ne' aspetto, ma solo la
Delitto di Maria Pia, sequenza Dna.
il Dna scagiona Pupillo

di DOMENICO CASTELLANETA
Le richieste di paternità,
da Michael Jackson a Maradona
"Sono il figlio di..."
i precedenti illustri
Non è la prima volta che celebri personaggi vengano sottoposti all'analisi del Dna per la verifica di presunte paternità. Ecco alcuni precedenti
famosi:

Michael Jackson: nell'agosto del 1987 un'americana di 39 anni, Lavon Powlis, che si fa chiamare "Billie Jean" Jackson, reclama 150 milioni
di dollari alla popstar. La donna accusa Michael Jackson di essere il padre dei suoi tre figli, un bambino di 11 anni e due gemelli di cinque.

Herbert von Karajan: nel giugno dell'89 la corte suprema d'Austria considera negativo il test di paternità subito dal direttore d'orchestra von
Karajan. La corte era intervenuta sulla richiesta di un cittadino tedesco, Ute de Doncker, di 45 anni, che affermava di essere nato da una
realazione, avvenuta nel marzo del '43, tra sua madre, Erika Peschke e il musicista.

Diego Maradona: nel 1991 una giovane italiana, Cristina Sinagra, afferma che il calciatore argentino è il padre di suo figlio, Diego Armando,
di 4 anni. Il 6 maggio 1992 Maradona, che ha sempre negato di essere il padre del bambino, è stato condannato a versare alla donna una
pensione di 3.920 dollari al mese.

Julio Iglesias: nell'ottobre del 1992 un tribunale di Valencia ha attribuito al cantante spagnolo la paternità di un'adolescente di 16 anni, al
termine di un'azione legale portata avanti dalla madre, Maria Edite Santos, una cantante portoghese.

Juan Domingo Peron: nell'agosto del '96 la giustizia argentina ha deciso di sottoporre all'esame del Dna il corpo dell'anziano presidente
argentino Peron su richiesta di una donna di 62 anni, Martha Susana Holgado, che riteneva di essere sua figlia. Il test non è mai stato
effettuato.

El Cordobes: da diversi anni il matador spagnolo Manuel Diaz, di 29 anni, afferma di essere il figlio del celebre El Cordobes, ma quest'ultimo
nega la paternità.

Thomas Jefferson: alcuni scienziati britannici hanno analizzato nel 1997 alcuni estratti di Dna per determinare se Thomas Jefferson, autore
della Dichiarazione d'Indipendenza nel 1776 e terzo presidente degli Stati Uniti, ha avuto dei figli dalla schiava Sally Hemings. Non potendo
effettuare le necessarie analisi sui resti di Jefferson, i test vengono fatti dal sangue dei suoi possibili discendenti.

(Repubblica 11 marzo 1998)


E Virginia
Blair scheda
pioneersidevelopment
criminali col Dna.
of DNA Rivoluzione
database per la privacy inglese
to solve crimes
October 24, 2000
LONDRA — Un tempo in Inghilterra i criminali venivano schedati. Ma si trattava di informazioni
By Raju Chebium
utilizzabili soltanto da Scotland Yard. Adesso Tony Blair nella sua crociata contro i fuorilegge ha
CNN.com Correspondent
ordinato che ogni persona arrestata o semplicemente fermata per sospetto di qualsiasi attività
(CNN) -- Virginia became one of the first states in the nation to pass a DNA database law, according to Paul
delinquenziale fornisca qualche goccia del proprio sangue, in maniera che si possa registrare il
Ferrara, director of the Virginia Division of Forensic Science.
suo Dna. E' una vera e propria rivoluzione non soltanto tecnologica ma anche della tradizione
Passed in 1989, the law stipulated that state authorities must collect DNA samples only from people convicted of
britannica di rispettare a tutti i costi la privacy. Anche quella dei criminali. Per esempio ai giudici
violent felonies such as homicide, said Ferrara, who also belongs to the Justice Department's National Commission
e alle intere giurie veniva chiesto di non considerare i precedenti degli imputati che venivano
on the Future of DNA Evidence.
portati dinnanzi al loro cospetto e si faceva di tutto perché non ne fossero a conoscenza. Ma il
In 1990, the law was expanded to include those convicted of nonviolent felonies such as manslaughter. In 1996,
premier laburista è preoccupato dell'offensiva dei conservatori secondo i quali il governo del New
the law was beefed up further to include minors as young as 14 convicted of felony crimes in adult courts, Ferrara
Labour non sarebbe sufficientemente duro nei confronti dei ladri, degli assassini, dei pedofili e
said.
degli stupratori. L'iniziativa di Blair, che per l'occasione ha scavalcato il suo ministro degli Interni,
ha fatto molta impressione in tutto il paese.
Pedofili: in ci
Attualmente Francia
sono tre schedato
milioniildiDna
persone schedate, molte delle quali per reati minori. Sarà loro
chiesto di collaborare
Da qualche a registrare
mese è stato attivatooltre al loro nome,
il "Fnaeg", indirizzo
che riunisce e impronte
tutte le tracce digitali,
genetiche anche il Dna.
rilevate
Lesulle
organizzazioni
vittime e neiper i diritti
luoghi dovecivili hanno ifatto
avvengono reati,conoscere la riprovazione
e le impronte per l'iniziativa che
genetiche (quasi
considerano demagogica
indistruttibili) delle persone e trovano,
condannate in questa loro riprovazione, l'appoggio di parlamentari
liberali e della sinistra radicale del Labour. Ma al paese piace. Blair andrà avanti. La legislazione
per l'uso di24tutte
PARIGI, AGOSTOle possibili tecnologie
- Nell'ambito dellaper la contro
lotta lotta allacrimine sarà
pedofilia, presentatadei
la corruzione a Westminster
minori, i e
non ci sono
reati dubbi
a sfondo sulla suae approvazione.
sessuale, il traffico di immagini pornografiche, la Francia si è dotata da
qualche mese di uno Schedario nazionale automatizzato delle impronte genetiche (Fnaeg),
di che
Paolo Filo della
consente la Torre
centralizzazione dei dati sul Dna delle persone che si rendono colpevoli di tali
reati.
GENETICA FORENSE

Di che cosa si occupa

Identificazione genetica
CONCETTO DI IDENTIFICAZIONE

IDENTIFICARE ⇒ attribuire esatte generalità

METODI DI IDENTIFICAZIONE

Documenti di identità -
Caratteri antropometrici
(altezza, caratteristiche somatiche, ecc.) -
Impronte digitali -
Caratteri emogenetici -
Documenti di identità

Carta d’identità
Passaporto
Patente di guida

Caratteri antropometrici

Altezza, peso, carnagione, colore dei capelli, colore degli


occhi, segni particolari, ecc.
Impronte digitali

Disegni lasciati dalle creste papillari delle dita


Carattere fenotipico invariabile (fattori genetici ed ambientali)
Gemelli monozigoti hanno diverse impronte digitali
Caratteri emogenetici
Definizione

Caratteri geneticamente determinati (nessuna influenza ambientale)

Carattere invariabile

Gemelli monozigoti hanno identiche caratteristiche emogenetiche


VARIE TECNICHE POSSONO
CONTRIBUIRE AD UNA IDENTIFICAZIONE
IDENTIFICAZIONE DI UN CORPO DOPO UN DISASTRO AEREO

PROVE DIRETTE

Passaporto all’interno del vestito;


Comparazione delle arcate dentarie con quelle acquisite dal dentista curante;
Confronto dell’impronta di un pollice con quella del distretto militare;
Confronto del profilo del DNA con quello di capelli trovati su un pettine.

PROVE INDIRETTE

Confronto del profilo del DNA con quello di parenti.


IDENTITA’

Ú
DIVERSITA’
CONCETTO DI POLIMORFISMO

Il termine deriva dal greco e significa “molte forme”

Definizione

un sistema si definisce polimorfico quanto ammette


almeno due forme alternative possibili, di cui la piú rara risulti
frequente almeno per l’1%.
I sistemi emogenetici sono polimorfici

SISTEMA AB0

45
40
35
30
GRUPPO 0 25
20
GRUPPO A
15
GRUPPO B 10
5
GRUPPO AB 0
A B AB 0
EMOGENETICA FORENSE
Cronologia della scoperta dei principali polimorfismi emogenetici

Polimorfismi immunologici Polimorfismi elettroforetici


1900 AB0
1927 MN
1940 Rh
1945 Lutheran
1951 Kidd
1955 Hp
1959 Gc
1963 Pi
1976 PGM1
1979 F XIII A
IL DNA E’ POLIMORFICO

In certi tratti vi sono differenze nella lunghezza e/o nella


sequenza delle quattro basi A,C, G, T.
Il polimorfismo è una caratteristica molto comune del
DNA, non necessariamente legata a patologie.

TIPI DI POLIMORFISMO

Polimorfismi da enzimi di restrizione

Polimorfismi di sequenza

Polimorfismi di lunghezza
Polimorfismi da enzimi di restrizione
Polimorfismi di sequenza

mutazione allele a ATTTCGCCTAA


allele b ATTTCTCCTAA

delezione allele a ATTTCGCCTAA


allele c ATTTCCCTAA

inserzione allele a ATTTCGCCTAA


allele d ATTTCGACCTAA
Polimorfismi di lunghezza

satelliti - da 1 a diverse migliaia di basi


minisatelliti o VNTR (variable number of tandem repeat) - da 9 a 100 basi
microsatelliti o STR (short tandem repeat) - da 1 a 6 basi

allele A AT GACT GACT GACT TTCG (3 ripetizioni)


1 2 3

allele B AT GACT GACT GACT GACT TTCG (4 ripetizioni)


1 2 3 4

allele C AT GACT GACT GACT GACT GACT TTCG (5 ripetizioni)


1 2 3 4 5
Polimorfismo D12S391

Allele 13

CAGGGAAGATGAAAAAAGAGACTGTATTAGTAAGGCTTCTCCA
GAGAGAAAGAATCAACAGGATCAATGGATGCATAGGTA GATA
GATA GATA GATA GATA GATA GATA GATA GATA GATA GATA
GATA GATAGACAGACAGACAGACAGACAGACAGATGAGAGGG
Frequenze polimorfismo D12S391
Combinazione Individui Combinazione Individui
allelica osservati allelica osservati
14 - 21 1 18 - 21 5
15 - 16 2 18 - 22 5
15 - 17 2 18 - 23 6
15 - 18 2 18 - 25 1
15 - 19 3 19 - 19 2
15 - 20 1 19 - 20 2
15 - 21 2 19 - 21 6
15 - 23 2 19 - 22 3
15 - 24 2 19 - 23 4
16 - 18 1 19 - 24 1
16 - 20 2 20 - 20 2
16 - 21 2 20 - 21 5
16 - 22 3 20 - 22 3
16 - 24 1 20 - 23 2
16 - 26 1 20 - 24 1
17 - 17 4 20 - 25 1
17 - 18 11 21 - 21 1
17 - 19 1 21 - 22 3
17 - 20 1 21 - 23 2
17 - 21 9 21 - 25 1
17 - 22 5 22 - 23 5
17 - 23 7 22 - 24 4
17 - 25 1 22 - 25 2
18 - 18 7 23 - 23 1
18 - 19 3 23 - 24 1
18 - 20 6 23 - 25 1
LOCUS VWA
esame dell’individuo Rossi Carlo
L’OMOZIGOTE

LOCUS vWA
cromosoma 12 paterno allele AT GACT GACT GACT GACT TTCG

cromosoma 12 materno allele AT GACT GACT GACT GACT TTCG

NOMENCLATURA

ROSSI CARLO: locus vWA 4 - 4


L’ETEROZIGOTE

LOCUS vWA
cromosoma 12 paterno allele AT GACT GACT GACT TTCG

cromosoma 12 materno allele AT GACT GACT GACT GACT TTCG

NOMENCLATURA

ROSSI CARLO: locus vWA 3 - 4


DALL’EMOGENETICA FORENSE
ALLA GENETICA FORENSE

Polimorfismi del DNA

1980 Polimorfismi di restrizione


1985 Analisi fingerprint (Jeffreys)
1987 Ideazione della Reazione a Catena della Polimerasi (Mullis)
ANALISI FINGERPRINT

Svantaggi

. Necessità di molto materiale di partenza


. Impiego di sostanze radioattive
. Tempi di analisi lunghi
. Possibilità di errori interpretativi
L’AVVENTO DELLA PCR
(REAZIONE A CATENA DELLA POLIMERASI)
TIPI DI MATERIALI ANALIZZABILI
DOVE TROVARE IL DNA?
COME POSSIAMO VEDERE IL DNA?
Elettroforesi su gel di agarosio
Elettroforesi capillare

Y STR Multiplex Assays


Capillary electrophoresis used for rapid separation and quantitation
to adjust balance between loci and achieve robust multiplexes
Unlabeled amplicons with intercalating dyes (single-color)

6 I
43 9 89
Y S S1 S 3
D 4
- H 7 .2 DY DY
primers A A
G AT T A- 89 II
Y- -G A 1 Y S3
Y
S 39 D
D Y

4.5 5 5.5 6 6.5 7 8 8.5 9 9.5 10 10.5


Time (minutes) Time (minutes)

Rapid CE Separation
Elettroforesi su gel di poliacrilamide

Il sequenziatore IR2 LICOR® 4200


Raccolta dati di laboratorio
N° Amelog. D3S1358 vWA FGA D8S1179 D21S11 D18S51 CSF1PO TH01 TPOX

A7/1 X-Y 14-15 16-17 19-20 8-9 28-28 9-10 9-9 8-9 6-6
A7/2 X-Y 15-16 18-20 21-23 10-10 30-31 11-11 9-10 7-10 8-11
A7/3 X-Y 15-16 18-20 21-23 10-10 30-31 11-11 9-10 7-10 8-11
A7/4 X-Y 14-17 16-17 19-20 8-11 29-29 11-11 11-12 6-7 6-11
A7/5 X-X 15-18 15-16 24-25 11-12 29-32 12-13 12-13 9-11 6-11
ANALISI DELLA DIVERSITA’
INDAGINI DI PATERNITA’
PRINCIPIO DEL METODO

Poiché ognuno di noi eredita metà corredo genetico


dalla madre e metà dal padre è possibile risalire
all’esatto legame di filiazione analizzando il DNA di
questi tre individui.
ANALISI DELLA DIVERSITA’
INDAGINI CRIMINALISTICHE
PRINCIPIO DEL METODO

Poiché ognuno di noi è costituito da un insieme di


cellule che contengono nel nucleo lo stesso DNA,
almeno potenzialmente è possibile stabilire
l’appartenenza di una sola cellula ad un individuo
confrontando i codici genetici.
GLI STRUMENTI ANALITICI DI BASE

. Caratterizzazione del sesso

. Caratterizzazione di autosomi

. Caratterizzazione di Y - STR

. Caratterizzazione del DNA mitocondriale


Caratterizzazione del sesso

Analisi molecolare con PCR di zone particolari


presenti sui cromosomi X e/o Y

Associazione genotipo - fenotipo

Apertura per analisi finalizzate ulteriori


Caratterizzazione del sesso

Maschio Femmina
X-Y X-X

Strategie analitiche

Ricerca della presenza del cromosoma Y


Studio delle regioni pseudoautosomali
Caratterizzazione di autosomi
Caratterizzazione di autosomi

Current Forensic STR Multiplexes


Profiler Plus™
100 bp 200 bp 300 bp 400 bp

D3 vWA FGA

A D8 D21 D18

D5 D13 D7
Caratterizzazione di autosomi

Current Forensic STR Multiplexes


PowerPlex™ 16
100 bp 200 bp 300 bp 400 bp

D3 TH01 D21 D18 Penta E

D5 D13 D7 D16 CSF Penta D

A vWA D8 TPOX FGA


Caratterizzazione cromosoma Y
Struttura del cromosoma Y

q
Variazioni
Variazioni genetiche
genetiche inin
diversi
diversiloci
locilungo
lungo ilil
eterocromatina
cromosoma
cromosoma YY sonosono
combinate
combinate in in un
un Y-aplotipo
Y-aplotipo
per
per un
un dato
dato campione
campione

Nucleic Acids Res. 28(2), e8 (2000)


Perché lo studio del cromosoma Y

Applicazioni
investigazioni forensi in casi di violenze sessuali
indagini di paternità in casi di incesto

Vantaggi dello studio del cromosoma Y


DNA maschile isolato senza necessità di estrazioni differenziali
possibilità di seguire la linea paterna

Supporti
studi di popolazione per valutare la frequenza degli aplotipi
metodo robusto per la caratterizzazione
Caratteristiche dei marcatori dell’Y

STR (microsatelliti)
DYS19, DYS385, etc.
quasi tutti tetranucleotidi

Marker bi-allelici (unique event polymorphisms--UEP)


SNPs (single nucleotide polymorphisms)
polimorfismi Y Alu (YAP) o altri insertioni/deletioni

Minisatelliti
MSY1 (DYF155S1) composti di 48-114 copie di sequenze
ripetute lunghe 25 bp con 5 tipi di varianti
tipizzati mediante MVR-PCR (minisatellite variant repeat)
J.M. Butler, Forensic DN A
Typing, Table 8.1
Y Chromosome STR Markers
Marker Name GenBank Repeat Motif Allele PCR Product Reference
Accession Range Sizes
DYS19 X77751 TAGA 8-16 178-210 bp Roewer 1992
DYS385 Z93950 GAAA 10-22 252-300 bp Schneider 1998
DYS388 G09695 ATT 12-17 128-143 bp Kayser 1997
DYS389 I G09600 (TCTG) (TCTA) I: 7-13 239-263 bp Marker
Marker
Kayser 1997
DYS389 II G09600 (TCTG) (TCTA) II:23-31 353-385 bp comunement
Kayser 1997
comunement
DYS390 G09611 (TCTA) (TCTG) 18-27 191-227 bp Kayser 1997
eeusati
DYS391 G09613 TCTA 8-13 275-295 bp
usati
Kayser 1997
DYS392 G09867 TAT 7-16 236-263 bp Kayser 1997
DYS393 G09601 AGAT 9-15 108-132 bp Kayser 1997
YCAIII AC006370 CA 19-25 192-204 bp Kayser 1997
DYS434 AC002992 ATCT 8-11 110-122 bp Ayub 2000
DYS435 AC002992 TGGA 9-13 210-228 bp Ayub 2000
DYS436 AC005820 GTT 10-15 128-143 bp Ayub 2000
DYS437 AC002992 TCTA 8-11 186-202 bp Ayub 2000
DYS438 AC002531 TTTTC 6-12 203-233 bp Ayub 2000
DYS439 AC002992 AGAT 9-14 238-258 bp Ayub 2000
Y-GATA-A4 G42670 AGAT 11-14 242-254 bp White 1999
Y-GATA-A7.1 G42675 ATAG 7-12 161-181 bp White 1999
Y-GATA-A7.2 G42671 TAGA 8-12 174-190 bp White 1999
Y-GATA-A8 G42672 TCTA 8-14 219-244 bp White 1999
Y-GATA-A10 G42674 TATC 11-14 160-172 bp White 1999
Y-GATA-C4 G42673 TATC 11-16 251-271 bp White 1999
Y-GATA-H4 G42676 TAGA 10-13 362-370 bp White 1999
Mappa dei marker STR sul Cromosoma Y

Nucleic Acids Res. 28(2) , e8 (2000)


Y STR Multiplex
Prinz et al. 1997
(Forensic Sci Int, vol. 85, pp. 209-218)

100 bp 200 bp 300 bp 400 bp

DYS19 389I 389II

390
Primer
Primer Amounts
Amounts Dye
Dye
Y19
Y19 0.25µM
0.25 µM JOE
JOE
“Quadruplex I” Y389
Y389 0.125µM
0.125 µM FAM
FAM
Y390
Y390 0.25µM
0.25 µM JOE
JOE
Aplotipi di una popolazione Italiana
216 Maschi non correlati
Università Cattolica di Roma
Y385
200 200
Y393
No. Unique Haplotypes

150
Y392 156
Y391 135
100
Y390 111
Y389II 87
50
Y389I
44
Y19
19
0 6
0 1 2 3 4 5 6 7 8
No. Y STRs Typed
Male-Specific Multiplex PCR
at 17 Y SNP Loci
200 bp
300 bp 400 bp
20 bp
ladder

Male sample
(AM209)

Remaining 17
primers 17 plex
plex PCR
PCR
Female sample
(K562)

CE Separation Time (min)


ANALISI DI Y-STR

• Analisi dei sistemi Y-STR del


protocollo minimo (DYS385,
DYS389I/II, DYS390, DYS391,
DYS392, DYS393, DY19) con
sistemi monoplex;
• Ampliamento a protocollo
esteso con l’uso di una nuova
multiplex per YCAII e
DXYS156-Y.
Aplotipi e maschi esaminati
Population Examined # Males DNA # Observed Discrimination Reference
Tested Markers Haplotypes Capacity (author, year)
Used
Norwegian 300 9 STRs + Tat 225 0.75 Dupuy 2000
Italian 100 9 STRs 99 0.99 Ricci 2000
German 154 8 STRs 124 0.81 Henke 2000
Polish 107 9 STRs 88 0.82 Kupiec 2000
Japanese 154 5 STRs 95 0.62 Mukoyama
2000
SE China 51 7 STRs 48 0.94 Gusmao 2000
Portuguese, Central 162 8 STRs 142 0.88 Carvalho 2000
Portuguese, Azores 63 8 STRs 51 0.81 Carvalho 2000
Valencia (East Spain) 140 8 STRs 94 0.67 Aler 2000
Dupuy, B.M., et al. (2000) Progre ss in Forensic Genetics 8, pp. 260-262
Ricci, U., et al. (2000) Progr ess in Forensic Genetic s 8, pp. 275-277 18th Congress of the
Henke, L., et al. (2000) P rogress in Fore nsic Genetics 8, pp. 296- 298 International Society of
Kupiec, T., e t a l. (2000) Progress in Forensic Ge netics 8, pp. 312-314
Mukoyama , R ., et al. (2000) Progress in Forensic Gene tics 8, pp. 318-320 Forensic Haemogenetics
Gusma o, L., et al. (2000) Progress in Forensic Gene tics 8, pp. 324-326 (ISFH), San Francisco 1999
Car valho, M., et a l. (2000) Progress in Forensic Genetic s 8, pp. 302-304
Ale r, M ., et al. (2000) Pr ogress in F orensic Gene tics 8, pp. 305-308
Caratterizzazione del DNA mitocondriale

Il DNA nucleare è ereditato da entrambi i genitori

Il DNA mitocondriale viene ereditato solo per via


materna

Ne consegue che tutti i soggetti correlati per via


materna avranno lo stesso mtDNA
Sensibilità del DNA mitocondriale

Per ogni cellula ci sono due copie di DNA nucleare

A seconda dei tipi cellulari ci possono essere fino a


diverse migliaia di copie di DNA mitocondriale

E’ possibile la tipizzazione del mtDNA su tessuti


molto degradati o che contengono anche poche
cellule
LE REGIONI HVI E HVII DEL mtDNA

• Sequenziazione delle regioni HVI


ed HVII, con sequenziatore IR2

• Lettura dalla base 15970 alla base


440, per circa 900 paia di basi.
I RISULTATI NELLE INDAGINI DI PATERNITA’

LA COMPATIBILITA’ GENETICA

LA INCOMPATIBILITA’GENETICA
Indagini di paternità
Schema del gel

La compatibilità
1 2 3 4 5 6

11 

10 
9.3  9.3  9.3 
9 

8 

7  7 

6  6  6 

5 

Dove:
1 - Controllo negativo (tutti i reagenti, senza DNA)
2 - Madre
3 - Figlio
4 – Padre presunto
5 - Miscela di alleli di riferimento
6 - Controllo positivo (DNA noto: alleli 9.3 - 9.3)
Schema del gel
Indagini
1 2
di3 paternità
4 5

La incompatibilità
16  16 
15  15 
14  14  14 
13  13  13 
12  12  12  12 
11  11  11 
10  10 
9  9 
8  8 

Dove:
1, 5 - Miscela di alleli di riferimento
2 - Madre
3 – Figlio
4 – Padre presunto
LE MUTAZIONI

Eventi relativamente frequenti negli STR


(1,8 x 10-3)

Variazioni in genere di un repeat


per espansioni o contrazioni
L’ESCLUSIONE DI PATERNITA’

Le esclusioni devono essere confermate almeno


per tre marcatori

L’esclusione è un dato certo, al di là di ogni


ragionevole dubbio (errore < 10-9)
L’ATTRIBUZIONE DI PATERNITA’

Assenza di limite normativo in Italia

Legislazione della Germania (>99,75%)

Legislazione dei Paesi Bassi (>99,9%)


I RISULTATI NELLE INDAGINI
PER L’ IDENTIFICAZIONE INDIVIDUALE

LA COMPATIBILITA’ GENETICA

L’INCOMPATIBILITA’ GENETICA
Schema del gel
Indagini criminalistiche
1 2
Compatibilità ed3 incompatibilità
4 5





 

ANALISI DYS393
Dove:
1 - DNA ricavato da un capello trovato sulla scena del crimine
2 – Sospetto 1
3 – Sospetto 2
4 – Sospetto 3
5 - Controllo negativo (tutti i reagenti, senza DNA)
Indagini Criminalistiche
L’ESCLUSIONE

L’esclusione anche di un solo marcatore è


sufficiente a confermare che un campione
biologico è diverso da un donatore .

L’esclusione è un dato certo, al di là di ogni


ragionevole dubbio
(errore = affidabilità del laboratorio)
Indagini Criminalistiche
L’ATTRIBUZIONE

Quanti “punti” identici devono essere rilevati


sulla molecola del DNA per poter attribuire con
certezza una traccia biologica ad una persona?
LE IMPRONTE DIGITALI
Nella legislazione italiana, grazie a tre sentenze della
Cassazione, solo le impronte digitali assumono il valore di
prova per l’identificazione di un individuo.

In particolare se su un frammento d’impronta vengono


rinvenuti almeno 14 punti caratteristici e gli stessi punti
vengono trovati sull’impronta assunta ad una persona,
possiamo legittimamente asserire che si tratta della stessa
identica persona.

PER IL DNA NON ESISTE UN LIMITE SUPERATO IL


QUALE L’IDENTITA’ PUO’ RITENERSI ACCERTATA
LA BIOSTATISTICA
Necessità di ottenere dati di frequenza delle
popolazioni per i vari polimorfismi per calcolare la
frequenza di un dato profilo genetico

L’esame di 13 STR su una traccia fornisce dei


valori di probabilità inferiori a 10 -12

La probabilità di trovare due profili genetici


identici per solo effetto del caso è talmente bassa,
da farla ritenere praticamente zero.

L’unica eccezione sono i gemelli monozigoti.


La procedura analitica per
l’identificazione genetica
SOPRALLUOGO GIUDIZIARIO REPERTAZIONE

LABORATORIO CATALOGAZIONE,
RILIEVI FOTOGRAFICI,
RICEZIONE REPERTI
PRELIEVI

ANALISI BIOLOGICA:
ALTRE INDAGINI DIAGNOSI GENERICA E
DI CRIMINALISTICA DI SPECIE

ANALISI BIOLOGICA :
DIAGNOSI INDIVIDUALE

SESSO POLIMORFISMI POLIMORFISMI DNA


GENETICO AUTOSOMICI CROMOSOMA Y MITOCONDRIALE

RACCOLTA DATI
DATABASE
PROFILO DNA

INTERPRETAZIONE PROFILO

L’ESCLUSIONE L’ATTRIBUZIONE

DATABASE

INDAGINI
INDIRETTE
Caratterizzazione del sesso
Studio del gene dell’amelogenina
Schema del gel

1 2 3 4 5 6 7 8 9 10 11 12 13 14

   
         

Dove:
1 – Controllo positivo (DNA maschile di confronto)
2 – Controllo positivo (DNA femminile di confronto)
3, 6, 9, 11– Controllo negativo (tutti i reagenti, senza DNA)
4, 5, 7, 8, 10, 12, 13, 14 – Tracce in esame
Caratterizzazione di autosomi
Schema del gel

1 2 3 4 5 6 7 8

13 

12  12  12 

11  11  11 

10  10  10  10  10 

9 

Dove:
1 - DNA del proprietario dell’autovettura
2 – DNA della moglie del proprietario
3 – Controllo positivo (DNA noto: alleli 10 - 12)
4 – Miscela di alleli di riferimento
5 – Mozzicone n° 1
6 – Mozzicone n° 2
7 – Mozzicone n° 3
8 – Controllo negativo (tutti i reagenti, senza DNA)
Caratterizzazione di Y - STR
Schema del gel

1 2 3 4 5 6 7 8 9 10

12


11 11 11
  

10 10 10 10 10
    

Dove:
1 - controllo positivo (DNA noto: allele 11)
2 - campione di pelle prelevato dalle unghie della vittima
3, 4, 5, 6, 8, 9 e 10 – sospettati del delitto
7 - campione di DNA prelevato dalla donna
Caratterizzazione del DNA
mitocondriale

Regione HVI
16069

16093

16126

16129

16145

16189

16192

16205

16231

16256

16261

16270

16304

16309

16316
Riferimento C T T G G T C C T C C C T A A
Anderson et. al 1981
Vittima C T T T G T C C T C C A T A A
Madre C T T T G T C C T C C A T A A
IL GENETISTA FORENSE

Colui che fornisce alla giustizia gli elementi


obiettivi per decidere su fatti importanti, come
l’attribuzione o l’esclusione di una paternità,
oppure per stabilire la precisa identità di una
persona.
LE INDAGINI INDIRETTE

Traccia ematica in una rapina

Sospettato il Signor Verdi Marco (II3), latitante

Collaboratori di giustizia la sorella Verdi Elisa (II1)


ed il fratello Verdi Carlo (II2)
LA DECISIONE
E’ LUI O NON E’ LUI ?
ANALISI DEL DNA
SVILUPPI FUTURI

INDIVIDUAZIONE DELL’ORIGINE ETNICA

Utilizzando un determinato pannello di marcatori genetici


potrebbe essere possibile risalire all’origine della
provenienza geografica di colui che ha lasciato una certa
traccia biologica.
SVILUPPI FUTURI

DALLA MACCHIA AL COGNOME

Nella società occidentale il cognome viene ereditato quasi


esclusivamente dal padre; è possibile associare ad un certo
profilo del cromosoma Y un determinato cognome
(Graziosi 1998, Sykes et al. 2000).

In casi particolarmente fortunati, potrebbe quindi essere


possibile risalire da una traccia biologica maschile, al
cognome dell’individuo dalla quale essa si è originata.
SVILUPPI FUTURI

LA GENETICA DELL’APPARENZA

Studiando opportune regioni del DNA sarà


probabilmente possibile stabilire alcune caratteristiche
somatiche di colui che ha lasciato una traccia biologica.
Sarà forse possibile costruire dei veri e propri identikit
genetici.
PROGETTO TRIADE
UNIVERSITA’ SCUOLA LAVORO
"Elementare Watson: questo è DNA.
Utilizzazione del DNA a scopi forensi"