GENE TRANSCRIPTION AND RNA MODIFICATION

Adapted from Chapter 12 in Genetics: Analysis and Principles (Robert J. Brooker)

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

Central Dogma
Replication

DNA
REVERSE TRANSCRIPTION

Perpetuation of genetic information from generation to generation

Transcription

RNA
Translation

Control of phenotype though gene expression

Protein

INTRODUCTION
Transcription is the first step in gene expression. It involves two fundamental concepts.
1. DNA sequences provide the underlying information
Signals for the start and end of transcription.

2. Proteins recognize these sequences and carry out the process

Other proteins modify the RNA transcript to make it functionally active.

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-2

OVERVIEW OF TRANSCRIPTION
Transcription literally means the act or process of making a copy In genetics, the term refer to the copying of a DNA sequence into an RNA sequence The structure of DNA is not altered as a result of this process
It can continue to store information 12-3

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

 A gene is a transcriptional unit

it can be transcribed into RNA

The strand that is actually transcribed is termed the template strand The opposite strand is called the coding strand or the sense strand
The base sequence is identical to the RNA transcript
Except for the substitution of uracil in RNA for thymine in DNA

A common organization of sequences within a bacterial gene and its transcript

Start codon: specifies the first amino acid in a protein sequence, usually a formylmethionine (in bacteria) or a methionine (in eukaryotes)

Signals the end of protein synthesis

Bacterial mRNA may be polycistronic, which means it encodes two or more polypeptides

12-5

The Stages of Transcription

Transcription occurs in three stages
Initiation Elongation Termination

These steps involve protein-DNA interactions

Proteins such as RNA polymerase interact with DNA sequences

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-7

Initiation
The promoter functions as a recognition site for transcription factors The transcription factors enable RNA polymerase to bind to the promoter forming a closed promoter complex Following binding, the DNA is denatured into a bubble known as the open promoter complex, or simply an open complex

Elongation
RNA polymerase slides along the DNA in an open complex to synthesize the RNA transcript

Termination
A termination signal is reached that causes RNA polymerase to dissociated from the DNA

Figure 12.2

12-8

RNA Transcripts Have Different Functions

A structural gene is the one that encodes a polypeptide
When such genes are transcribed, the product is an RNA transcript called messenger RNA (mRNA) Well over 90% of all genes are structural genes

The RNA transcripts from nonstructural genes are not translated (e.g. tRNA, rRNA, microRNA)
They do have various important cellular functions In some cases, the RNA transcript becomes part of a complex that contains protein subunits
Ribosomes (rRNA) Spliceosomes Signal recognition particles

microRNAs (miRNAs) are singlestranded RNA molecules (about 21-23 nucleotides in length) miRNAs can recognize their targets- mRNAs and downregulate expression of their targets

12-11

TRANSCRIPTION IN BACTERIA

Promoters
Promoters are DNA sequences that promote gene expression
More precisely, they direct the exact location for the initiation of transcription

Promoters are typically located just upstream of the site where transcription of a gene actually begins
The bases in a promoter sequence are numbered in relation to the transcription start site
Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-13

Sequence elements (cis elements) that play a key role in transcription

Bases preceding this are numbered in a negative direction There is no base numbered 0

Bases to the right are numbered in a positive direction

Sometimes termed the Pribnow box, after its discoverer

Figure 12.3 The conventional numbering system of promoters

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-14

For many bacterial genes, there is a good correlation between the rate of RNA transcription and the degree of agreement with the consensus sequences

The most commonly occurring bases

Figure 12.4 Examples of 35 and 10 sequences within a variety of

bacterial promoters
Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-15

Initiation of Bacterial Transcription

RNA polymerase is the enzyme that catalyzes the synthesis of RNA In E. coli, the RNA polymerase holoenzyme is composed of
Core enzyme
Four subunits = 2

Sigma factor
One subunit =

These subunits play distinct functional roles

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-16

 The RNA polymerase holoenzyme binds loosely to the DNA It then scans along the DNA, until it encounters a promoter region
When it does, the sigma factor recognizes both the 35 and 10 regions (TATA Boxes)
A region within the sigma factor that contains a helix-turn-helix structure is involved in a tighter binding to the DNA

The binding of the RNA polymerase to the promoter forms the closed complex Then, the open complex is formed when the TATA box is unwound

Amino acids within the helices form hydrogen bonds with bases in the promoter sequence elements

Figure 12.5
Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-18

Figure 12.6

The core enzyme now slides down the DNA to synthesize an RNA strand

Elongation in Bacterial Transcription

The RNA transcript is synthesized during the elongation step The DNA strand used as a template for RNA synthesis is termed the template or noncoding strand The opposite DNA strand is called the coding strand
It has the same base sequence as the RNA transcript
Except that T in DNA corresponds to U in RNA

The open complex formed by the action of RNA polymerase is about 17 bases long Behind the open complex, the DNA rewinds back into the double helix

The key points in the synthesis of the RNA transcript:

The differences between RNA pol and DNA pol: RNA primer to initiate DNA synthesis RNA pol does not have proofreading activity

Similar to the synthesis of DNA via DNA polymerase

Figure 12.7

Gr owing RNA strand

DNA template strand 3

O P O H 2C Cytosine O Guanine O

CH O O P O

RNA polymerase adds nucleotides to 3-OH in 5 to 3 direction

O

H O

OH O O Guanine O O H Cytosine CH O P O O

P O H 2C

OH

OH

O O P O O

O P O O CH
2

O Uracil O O H OH OH Adenine

CH O P O

P O

Incoming ribonucleoside triphosphate Guanine

CH O O P O

5 to 3 -direction of chain growth

O Thymine

CH O

5 Copyright 1997, by John Wiley & Sons, Inc. All rights reserved.

Fig 12.8 Snustad & Simmons

Termination of Bacterial Transcription

Termination is the end of RNA synthesis
It occurs when the short RNA-DNA hybrid of the open complex is forced to separate
This releases the newly made RNA as well as the RNA polymerase

E. coli has two different mechanisms for termination

1. rho-dependent termination
Requires a protein known as (rho)

2. rho-independent termination
Does not require

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-24

rho utilization site

Rho protein is a helicase

Figure 12.8

-dependent termination

12-25

U:A A:U U:A C:G U:A U:A A:U A:U

Figure 12.8

-dependent termination

12-26

How do inverted repeats produce a stem-loop structure? 5- GCGAATTCTATTTTTTATAGAATTTTTT -3 DNA 3- CGCTTAAGATAAAAAATATCTTAAAAAA -5

U:A A:U U:A C:G U:A U:A A:U A:U

-independent termination is facilitated by two sequences in the RNA 1. A uracil-rich sequence located at the 3 end of the RNA 2. A stem-loop structure upstream of the Us

NusA Stabilizes the RNA pol pausing

URNA-ADNA hydrogen bonds are very weak

No protein is required to physically remove the RNA from the DNA This type of termination is also called intrinsic

Figure 12.9

-independent termination

12-27

TRANSCRIPTION IN EUKARYOTES
Many of the basic features of gene transcription are very similar in bacteria and eukaryotes However, gene transcription in eukaryotes is more complex
Larger organisms Cellular complexity Multicellularity

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-28

Eukaryotic RNA Polymerases

Nuclear DNA is transcribed by three different RNA polymerases
RNA pol I Transcribes all rRNA genes (except for the 5S rRNA) RNA pol II Transcribes all structural genes Thus, synthesizes all mRNAs Transcribes some snRNA genes RNA pol III Transcribes all tRNA genes And the 5S rRNA gene

All three are very similar structurally and are composed of many subunits There is also a remarkable similarity between the bacterial RNA pol and its eukaryotic counterparts

Eukaryotic Structural Genes

For structural genes, at least three features are found in most promoters Transcriptional start site TATA box Regulatory elements
Figure 12.11
Usually an adenine

The core promoter is relatively short It consists of the TATA box

Important in determining the precise start point for transcription

The core promoter by itself produces a low level of transcription

This is termed basal transcription

Figure 12.11

Usually an adenine

Regulatory elements affect the binding of RNA polymerase to the promoter They are of two types Enhancers
Stimulate transcription

Silencers
Inhibit transcription

They vary in their locations but are often found in the 50 to 100 region
Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-33

Eukaryotic Structural Genes

Factors that control gene expression can be divided into two types, based on their location cis-acting elements
DNA sequences that exert their effect only on nearby genes Example: TATA box, enhancers and silencers

trans-acting elements
Regulatory proteins that bind to such DNA sequences

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-34

RNA Polymerase II and its Transcription Factors

Three categories of proteins involved in transcription initiation
RNA polymerase II Five different proteins called general transcription factors (GTFs) A protein complex called mediator

Figure 12.12 shows the assembly of transcription factors and RNA polymerase II at the TATA box
Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-35

Figure 12.12

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-36

Figure 12.12

A closed complex

TFIIH plays a major role in the formation of the open complex It has several subunits that perform different functions

One subunit hydrolyzes ATP and phosphorylates a domain in RNA pol II known as the carboxyl terminal domain (CTD) This releases the contact between TFIIB and RNA pol II Other subunits act as helicases Promote the formation of the open complex RNA pol II can now proceed to the elongation stage

Released after the open complex is formed

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-37

 Basal transcription apparatus

RNA pol II + the five GTFs

The third component for transcription is a large protein complex termed mediator
It mediates interactions between RNA pol II and various regulatory transcription factors Its subunit composition is complex and variable Mediator appears to regulate the ability of TFIIH to phosphorylate CTD
Therefore it plays a pivotal role in the switch between transcriptional initiation and elongation
Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display

12-38