INTRODUCTION

Tumor necrosis factor (TNF superfamily, member 2)

Tumor necrosis factor (TNF, cachexin or cachectin and formerly known as tumor necrosis factor-alpha) is a cytokine involved in systemic inflammation and is a member of a group of cytokines that stimulate the acute phase reaction. The primary role of TNF is in the regulation of immune cells. TNF is able to induce apoptotic cell death, to induce inflammation, and to inhibit tumorigenesis and viral replication. Dysregulation of TNF production has been implicated in a variety of human diseases, including major depression, Alzheimer's disease and cancer. Recombinant TNF is used as an immunostimulant under the INNtasonermin. Tumour necrosis factor- can be produced ectopically in the setting of malgnancy and parallels parathyroid i hormone both in causing secondary hypercalcemia and in the cancers with which excessive production is associated [Dr. Lloyd J.et al 1975]
Discovery The theory of an anti-tumoral response of the immune system in vivo was recognized by the physician William B. Coley. In 1968, Dr. Gale A Granger from the University of California, Irvine, reported a cytotoxic factor produced bylymphocytes and named it lymphotoxin (LT). Credit for this discovery is shared by Dr. Nancy H. Ruddle from
1

Yal

it

ame acti it i a series of back -to-back articles

published i the same month and year .Subsequently in 1975 Dr. Lloyd J. Old from Memorial Sloan-Kettering Cancer Center, New York, reported another cytotoxic factor produced by macrophages, and named it tumor necrosis factor (TNF). Both factors were described based on their ability to kill mouse fibrosarcoma L-929 cells. When the cDNAs encoding LT and TNF were cloned in 1984, they were revealed to be similar. The binding of TNF to its receptor and its displacement by LT confirmed the functional homology between the two factors. The sequential and functional homology of TNF and LT led to the renaming of TNF as TNF and LT asTNF . In 1985, Bruce A. Beutler and Anthony Cerami discovered that a hormone that induces cachexia and previously-named cachectin was actually TNF. These investigators then identified TNF as the key mediator of septic shock in response to infection. Subsequently, it was recogni ed that TNF is the prototypic member of a large cytokine family, the TNF family. Gene The human TNF gene (TNFA) was cloned in 1985. It maps to chromosome 6p21.3, spans about 3 kilobases and contains 4 exons. The last exon codes for more than 80% of the secreted protein. The 3' UTR of TNF alpha contains an AU-rich element (ARE). Structure TNF is primarily produced as a 212-amino acid-long type II Tran membrane protein arranged in stable homotrimers. From this membrane-integrated form the soluble homotrimeric cytokine (sTNF) is released via proteolytic cleavage by the metalloprotease TNF alpha converting enzyme (TACE, also called ADAM17).] The soluble 51 kDatrimericsTNF tends to dissociate at concentrations below the Nano molar range, thereby losing its bioactivity. The 17-kilodalton (kDa) TNF promoters (185-amino acid-long) are composed of two antiparallel -pleated sheets with antiparallel -strands, forming a 'jelly roll' -

structure, typical for the TNF family, but also found in viral capsid proteins. Cell signaling
2

Two receptors, TNF-R1 (TNF receptor type 1; CD120a; p55/60) and TNF-R2 (TNF receptor type 2; CD120b; p75/80), can be bound to by TNF. TNF-R1 is expressed in most tissues, and can be fully activated by both the membrane-bound and soluble trimeric forms of TNF, whereas TNF-R2 is found only in cells of the immune system, and respond to the membrane-bound form of the TNF homotrimer. As most information regarding TNF signaling is derived from TNF-R1, the role of TNF-R2 is likely underestimated.

Signalingpathway of TNF-R1. Dashed grey lines represent multiple steps.

Upon contact with their ligand, TNF receptors also form trimers, their tips fitting into the grooves formed between TNF monomers. This binding causes a conformational change to occur in the receptor, leading to the dissociation of the inhibitory protein SODD from the intracellular death domain. This dissociation enables the adaptor protein TRADD to bind to the death domain, serving as a platform for subsequent protein binding. Following TRADD binding, three pathways can be initiated. Activation of NF- B: TRADD recruits TRAF2 and RIP.TRAF2 in turn recruits the multicomponent protein kinaseIKK, enabling the serine-threonine kinase RIP to activate it. An inhibitory protein,I B , that normally binds to NF- B and inhibits its translocation, is phosphorylated by IKK and subsequently degraded, releasing NF- B. NF- B is a heterodimeric transcription factor that translocate to thenucleus and

mediates the transcription of a vast array of proteins involved in cell survival and proliferation, inflammatory response, and anti-apoptotic factors. Activation of the MAPK pathways: Of the three major MAPK cascades, TNF induces a strong activation of the stress-related JNKgroup, evokes moderate response of the p38-MAPK, and is responsible for minimal activation of the classical ERKs. TRAF2 activates the JNK-inducing upstream kinases of MEKK1 and ASK1 (either directly or through GCKs and Trx, respectively), and these two kinases phosphorylate MKK7, which then activates JNK. JNK translocates to the nucleus and activates transcription factorssuch as c-Jun and ATF2. The JNK pathway is involved in cell differentiation, proliferation, and is generally pro-apoptotic. Induction of death signaling: Like all death-domain-containing members of the TNFR superfamily, TNF-R1 is involved in death signaling. TNF-induced cell death plays only a minor role compared to its overwhelming functions in the inflammatory process. Its death-inducing capability is weak compared to other family members (such as Fas), and often masked by the anti-apoptotic effects of NF- B. Nevertheless, TRADD binds FADD, which then recruits the cysteine protease caspase-8. A high concentration of caspase-8 induces its autoproteolytic activation and subsequent cleaving of effector caspases, leading to cellapoptosis. The myriad and often-conflicting effects mediated by the above pathways indicate the existence of extensive cross-talk. For instance, NF- B enhances the transcription of C-FLIP, Bcl-2, and cIAP1 / cIAP2, inhibitory proteins that interfere with death signaling. On the other hand, activated caspases cleave several components of the NFB pathway, including RIP, IKK, and the subunits of NF- B itself. Other factors, such as cell type, concurrent stimulation of other cytokines, or the amount of reactive oxygen species (ROS) can shift the balance in favor of one pathway or another. Such complicated signaling ensures that, whenever TNF is released, various cells with vastly diverse functions and conditions can all respond appropriately to inflammation.

Physi logy TNF was thought to be produced primarily by macrophages, but it is produced also by a broad variety of cell types including lymphoidcells, mast cells, endothelial cells, cardiac myocytes, adipose tissue, fibroblasts, and neuronal tissue. Large amounts of TNF are released in response to lipopolysaccharide, other bacterial products, and Interleukin-1 (IL-1). In the skin, mast cells appear to be the predominant source of pre-formed TNF, which can be released upon inflammatory stimulus (e.g., LPS) (Walsh, L.J. et al 1991, ProcNatlAcadSci 88(10):p. 4220-4).

It has a number of actions on various organ systems, generally together with IL-1 and Interleukin-6 (IL-6):

1.On the hypothalamus:

Stimulation of the hypothalamic-pituitary-adrenal axis by stimulating the release of corticotropin releasing hormone (CR ) Suppressing appetite Fever 2.On the liver: stimulating the acute phase response, leading to an increase in Creactive protein and a number of other mediators. It also induces insulin resistance by promoting serine-phosphorylation of insulin receptor substrate-1 (IRS-1), which impairs insulin signaling It is a potent chemoattractant for neutrophils, and promotes the expression of adhesion molecules on endothelial cells, helpingneutrophils migrate. 3.On macrophages: stimulates phagocytosis, and production of IL-1 oxidants and the inflammatory lipid prostaglandin E2 PGE2 4.On other tissues: increasing insulin resistance. A local increase in concentration of TNF will cause the cardinal signs of Inflammation to occur: heat, swelling, redness, pain and loss of function.

Whereas high concentrations of TNF induce shock-like symptoms, the prolonged exposure to low conce++ntrations of TNF can result incachexia, a wasting syndrome. This can be found, for example, in cancer patients. Said et al. showed that TNF-alpha causes an IL-10-dependent inhibition of CD4 Tcell expansion and function by up-regulating PD-1 levels on monocytes which leads to IL-10 production by monocytes after binding of PD-1 by PD-L .Pharmacology: TNF inhibition

Tumor necrosis factor promotes the inflammatory response, which, in turn, causes many of the clinical problems associated with autoimmune disorders such as rheumatoid arthritis, ankylosing spondylitis, inflammatory bowel disease, psoriasis, hidradenitissuppurativa and refractory asthma. These disorders are sometimes treated by using a TNF inhibitor. This inhibition can be achieved with a monoclonal antibody such as infliximab (Remicade),adalimumab(Humira) or certolizumabpegol (Cimzia), or with a circulating receptor fusion protein such as etanercept (Enbrel). Interactions Tumor necrosis factor-alpha has been shown to interact with TNFRSF1A

Role of T F-alpha
1. TNF plays a major role in the regulation of immune cells. 2. TNF is also able to induce apoptotic cell death, to induce inflammation, and to Inhibittumour genesis and viral replication. 3. Irregulation of TNF production has been resulted in a variety of human diseases such as major depression, Alzheimer's disease and as well as cancer. 4. TNF also induces insulin-resistance by promoting serine-phosphorylation of insulin receptor which impairs insulin signalling.

5. TNF also increases insulin-resistance on the other tissues. 6. TNF-Alpha also exhibits anti-tumour activity; therefore it is also effective against certain types of cancers. 7. In addition to the transmembrane, TNF- Alpha can penetrate cell membranes and form ion-channels across the membrane.
6

VECT RS USED:Here two different vectors are used for both cloning and expression purpose i.e ptz57r/t and pcDNA3.1 respectively. Cloning vector ptz57r/t: This is a TA cloning vector. It shows the compatibility with Taq, Tth, Tfl and other non-proofreading DNA polymerases, as well as with Long PCR Enzyme Mix. Commercially obtained from Fermentas, this plasmid is informally known as pFERM. The vector is of 2.8 kb, and contains f1 replication origin. The MCS is flanked by peptide coding region and T7 promoter. -Lactamase gene (bla) confers the

ampicillin resistance. The linear vector contains two 3 thymidine at the open ends for insert binding. Multiple restriction sites are available within MCS for insert release. Blue-white screening was used for preliminary clone identification.

Expression vector pcDNA3.1:

The pcDNA3.1 vectors are designed for high -level, constitutive expression in a variety of mammalian cell lines.The vector offer the following features:
y y y

Cytomegalovirus (CMV) enhancer-promoter for high-level expression. Large multiple cloning site in forward (+) and reverse (-) orientations. Bovine Growth Hormone (BGH) polyadenylation signal and transcription termination sequence for enhanced mRNA stability.

SV

origin for episomal replication and simple vector rescue in cell lines

expressing the large T antigen (i.e., COS-1 and COS-7).

y

Ampicillin resistance gene and pUC origin for selection and maintenance in . coli.

REVIEW OF LITERATURES:Tumor necrosis factor (TNF) is a multifunctional proinflammatory cytokine secreted predominantly by monocytes/macrophages that has effects on lipid metabolism, coagulation, insulin resistance, and endothelial function. TNF was originally identified in mouse serum after injection with Mycobacterium bovis strain bacillus Calmette-Guerin (BCG) and endotoxin. Serum from such animals was cytotoxic or cytostatic to a number of mouse and humantransformed cell lines and produced hemorrhagic necrosis and in some instances complete regression of certain transplanted tumors in mice (; Pennica et al., 1984 ) TNFA and LTA genes have similar structures; each spans about 3 kb and contains 4 exons. Only the last exons of these genes, which code more than 80% of the secreted protein, are significantly homologous (56%)(Nedwin et al.1985).By analysis of human-mouse somatic cell hybrids, TNFA and chromosome 6 showed that both TNFA and TNFB map to the 6p23-q12 segment. (Nedwin et al.1985). .TNF-alpha and TNF-beta share a common receptor on tumor cells and that the receptors are upregulated by gamma-interferon. arious interferons have been known

to be synergistic with TNF in antitumor effects in vitro (Aggarwal et al. (1985) In the mouse, TNFA and TNFB are likewise tandemly arranged and situated on chromosome 17, which bears much homology of synteny with chromosome 6 of man (Nedospasov et al.1986). TNFA stimulates prolonged activation of the oncogene JUN expression; the JUN gene encodes transcription factor AP-1, which stimulates collagenase gene transcription. Thus, activation of JUN and collagenase gene expression may be one mechanism for mediating some of the biologic effects of TNFA (Brenner et al. (1989) . Ingle-nucleotide polymorphisms (SNPs) in regulatory regions of cytokine genes have been associated with susceptibility to a number of complex disorders. TNF is a proinflammatory cytokine that provides a rapid form of host defense against infection but is fatal in excess. Because TNF is employed against a variety of pathogens, each involving a different pattern of risks and benefits, it might be expected that this would favor diversity in the genetic elements that control TNF production.(Herrmann et al.

(1998) used PCR-SSCP and sequencing to screen the entire coding region and 1,053 bp upstream of the transcription start site of the TNFA gene for polymorphisms. Five polymorphisms were identified: 4 were located in the upstream region at positions 857, -851, -308, and 238 from the first transcribed nucleotide and 1 was found in a nontranslated region at position +691. TNF is synthesized as a 26-kD membrane-bound protein (pro-TNF) that is cleaved by processing enzymes to release a soluble 17-kD TNF molecule The soluble molecule can then bind to its main receptors TNFR1 and TNFR2 (Skoog et al., 1999). Overproduction of TNF have been implicated in a variety of human diseases, including sepsis, cerebral malaria , and autoimmune diseases such as multiple sclerosis , rheumatoid arthritis, systemic lupus erythematosus , and Crohn disease , as well as cancer. Susceptibility to many of these diseases is thought to have a genetic basis, and the TNF gene is considered a candidate predisposing gene. However, unraveling the importance of genetic variation in the TNF gene to disease susceptibility or severity is complicated by its location within the MHC, a highly polymorphic region that encodes numerous genes involved in immunologic response Studies in mice and observations in patients receiving infliximab (remicade) for treatment of rheumatoid arthritis or Crohn disease have shown that antibody-mediated neutralization of TNF increases susceptibility to tuberculosis (Ruuls and Sedgwick 1999) Three SNPs located at nucleotides -238, -308, and -376 with respect to the TNF transcriptional start site are all substitutions of adenine for guanine.( Knight et al. (1999) referred to the allelic types as -238G/-238A, -308G/-308A, and -376G/-376A. They stated that variation in the TNFA promoter region had been found to be associated with susceptibility to cerebral malaria. TNF-alpha may play a part in the pathogenesis of ankylosing spondylitis and rheumatoid arthritis.The efficacy of inhibition of TNF-alpha in treatment of ankylosingspondylitis,adimeric fusion protein of the human 75-kD (p75) TNFR2 linked to the Fc portion of human IgG1 . Treatment in 40 patients with active, inflammatory disease for 4 months resulted in rapid, significant, and sustained improvement. ( Gorman et al.2001)
10

By sequencing the promoter regions 500 bp upstream from the transcriptional start sites of members of the TNF and TNFR superfamilys, Kim et al. (2005) identified 23 novel regulatory Analysis of SNP databases suggested that the SNP allele frequencies were similar to those for Japanese subjects but distinct from those of Caucasian or African populations Using the RACE technique clonedand sequenced the turbot TNF cDNA. The analysis of its sequence showed several conserved motifs characteristic of members of the TNFalpha family.A phylogenetic tree constructed with different TNFs of fish and mammals grouped this sequence within the fish TNFalpha cluster. Therefore, the turbot TNF was identified as TNFalpha, completegene presentedthree introns and four exons. The turbot recombinant TNFalpha (rTNFalpha) was obtained by IPTG induction of bacteria transformed with the pET15b-TNFalpha construct, and it was purified in native conditions. The recombinant protein was approximately 20 kDa in sizeand its biological activity was assessed invitro. Finally, turbot rTNFalpha was able to recruit and activate inflammatory cells when injected in gilthead seabream, although to a lesser extent than gilthead seabream rTNFalpha.(ordas MC et al.2006) The transgenic mice overexpressing human TNF exhibit reduced long bone volume, decreased mineralized bone nodule formation, and arthritis. TNF overexpression induced bone loss by increasing expression of Smurf1, resulting in ubiquitination and proteasomal degradation of Smad1 and Runx2. Deletion of Smurf1 in TNF-

transgenic mice prevented systemic bone loss and improved bone strength.(Guo et al. (2008). The cloning and sequencing ofstriped trumpeter and expression (Latris lineata Forster)

proinflamatory cytokineTNF

inresponse to an infection by transcript

ectoparasite, chondracanthus goldusmidi.

The striped trumpeter TNF

consisted of1093 bp, including 759 bp ORF which translated into amino acid trans membrane peptide .the sequence contained a TACE cut site, that would produce a 167 amino acid soluble peptide containing the TNF ligand family signature. The expression of TNF in parasitized fish was investigated via quantitative real time PCR. A significant up-regulation ofTNF found in gills (site of parasite attachment) andHead kidney cells.(Covello JM et al.2009)
11

The cDNA proinflamatorycytokine TNF from Indian dromedaries camel (camdus dromedaries ) was amplified by PCR using Bactrian camel sequences and sub seqently cloned for sequence analysis.Relationship revealed that dromedarian camel TNF shared 99.4% and 99.1% identity both at nucleotide and amino acid level with Bactrian camel TNF . Phylogenetic analysis based on their amino acid sequences indicated the close relationship in TNF genes between dromedarian camel and other members of camelids. (nagarajan et al.2011) TNF increase angiopoietin-like protein 2 gene expressions by activating Foxo1 in 3T3-l1 adipocytes. The cloning sequence analysis of Angpt2 gene promoter revealed the presence of several potative- binding site for transcriptional factor,including two IREs .interaction within Angpt2 promoter and forkhead transcription factor were identified by EMSA and chip assay. Lentivirus- mediated knockdown of Foxo1 expression inhibited transcriptional activity of Angpt2 promoter and decreased mRNA expression. Finally TNF Inhibited Foxo1 phosphorylation and enhanced its transcriptional activity, through which TNF increased the expression of Angpt2 in adipocytes that suggest TNF up-regulates Angpt2 mRNA expression via P13K/foxo pathway in 3T3-l1 adipocytes. Which may be involved in obesity-induced inflammation and insulin resistance. (zheng. jy et al.2011) Tumour necrosis factor- (TNF- ) is a cytokine essential for regulation of normal cellular processes while its overproduction can be implicated in the pathology of many inflammatory disorders. Consequently, stemming the deleterious actions of TNFvia any of several routes is an attractive and highly competitive area of

research. Small molecule inhibitors have been developed either to inhibit the production of TNF- by cAMP potentiation and blocking TNF- gene expression (phosphodiesterase 4 inhibitors) or to inhibit TNFprocessing (matrix

metalloproteinase inhibitors). The development of monoclonal antibody technology is a rapidly expanding field. This has improved to such an extent that many clinical trials are underway and have shown promising results.(Christopher L et al.2011) T F- is a principalmediator in pro-inflammatory processes that involve necrosis, apoptosis and proliferation .peripheral nerve injury results in activation and morphological changes of microglial cells in the spinal cord. These adjustments occur
12

in order to initiate an inflammatory cascade in response to the damage. Between the agents involved in this reaction, TNF- is recognized as a key player in this process as it not only modulates lesion formation, but also because it is suggested to induce nociceptive signals. the function of TNF- in inflammation and pain production seems to be generally accepted, systematically Peripheral nervous injury TNFAndrade P et al 2011 May) A patient with crohns disease who lose response to anti TNF therapy. Optimization of therapies, or switch to other anti-TNF- , are currently in case of loss of response, and can be successful in 40-60% of patients who lose response. Anti-infliximab antibodies formation and autoantibodies (ANA, anti-DNA and other autoantibodies) have been associated with loss of response. Individual differences in drug metabolism may contribute to loss of response. Smoking may be a risk factor for loss of response. Reductionof infusion intervals and switch to other anti-TNF- agents are effective as rescue strategie. The addition of antitumor necrosis factor- (TNF- ) agents to the therapeuticarmamentarium against Crohn's disease has been a revolution in its management. Approximately 25 to 40% of patients who initially benefit from antiTNF- treatment develop intolerable adverse events or loose their response during maintenance therapy. (DANESE S et al may 2011) expressed in neural tissue and pain behavior(

13

MATERIALS AND METHODS:-

Work flow for Dry lab (in- silico lab):-

Sequences of TNF

Primer designing

Sequences of PTZ57R/T

Restriction mapping of PTZ57R/T

Sequences of pcDNA 3.1

Restriction mapping of pcDNA 3.1

Sequences of TNF from Gallus gallus:-

Gallus gallus tissue necrosis factor-alpha (TNF-alpha) mRNA, partial cds Gene Bank: HQ739087.1

>gi|325515283|gb|HQ739087.1| Gallus gallus tissue necrosis factor -alpha (TNF-alpha) mRNA, partial cds
AGACCAGATGGGAAGGGAATGAACCCTCCGCAGTACTCAGGACAGCCTA TGCCAACAAGTACACCTGTTACAGTTCAGACTGTGTATGTGCAGCAACCC GTAGTGCTGTTCTATGACCGCCCAGTTCAGATGAGTTGCCCTTCCTGTAAC CAGATGATCGTGACACGTCTCTGCTATGAGTCAGGAGCGTTGACTTGGCT GTCGTGTGGTGGCCTCTTC

14

PRIMER DESIGNING:The forward and reverse primer was designed with the help of primer designing tools: Primer3 and Primer - BLAST.

Forward Primer: The forward primer designed was exactly similar to the first 20 bases of the target cDNA sequence. To designed the forward primer, first 20 bases of cDNA sequence have been taken. Thereafter, added the restriction site of NdeI (CATATG) to that 20bp sequence so that the PCR product can be cut out. And at last, to bind the restriction enzyme (NdeI) perfectly to its sequence, added two cytosine residues.

Reverse Primer: The reverse primer designed was the reverse complement of the last 20 bases of the soluble cDNA sequence. To designed the reverse primer, first 20 bases of cDNA sequence have been taken. Thereafter added the restriction site of XhoI (CTCGAG) to that 20 base pair sequence so that the PCR product can

Be cut out. And lastly, to bind the restriction enzyme (XhoI) perfectly to its sequence, added two cytosine residues.

15

PRIMER DESIGNING PARAMETER:1. Primer length : The perfect length of PCR primers should be 18-24 bp. This
length of PCR primers are extremely sequence specific and short for the primers so that the primers can bind easily to the template at the optimal annealing temperature. Primer length was also proportional to annealing efficiency; in general, the longer the primer, the more inefficient was the annealing.

2. 2. GC Content: The base composition of primers should be between 4555%GC. The GC content of both the forward and reverse primer was 50%. 3.

3 Melting temperature (Tm) of primers: Melting temperature (T m)

was the temperature at
which one half of the DNA duplex dissociates to become single stranded. And thus it indicates the duplex stability .

It was known that there are two primers added to a PCR reaction. The primers should be designed in such a way that they have almost similar or similar melting temperature (TM. If the primers are mismatched in the terms of Tm then the amplification will be less efficient.

T m = (A + T) +4 (G +C) Forward primer = :- AGATGGGAAGGGAATGAACC T m = 2 (8 + 2) + 4(8 + 2) = 20 + 40 = 60 C Reverse primer = GACGTGTCACGATCATCTGG T m = 2 (4 + 5) + 4(6 + 5) = 18 + 44 = 62 C

16

Forward primer sequence:- AGATGGGAAGGGAATGAACC Reverse primer sequence:-GACGTGTCACGATCATCTGG

Sequences of pTZ57R/T

>pTZ57R/T Aatcggatcccgggcccgtcgactgcagaggcctgcatgcaagctttccctatagtgagtcgtattag agcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacata cgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttg cgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgc ggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgtt cggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggata acgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttg ctggcgtttttccataggctccg

17

cccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactata aagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccgg atacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttc ggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgcct tatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactg gtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactac ggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttg gtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattac gcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacga aaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaa atgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgag gcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacg atacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctc cagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatcc gcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaa cgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttc ccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctcc gatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttac tgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtat gcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaa aagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccag ttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagc aaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcat actcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatt tagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgcgccctgtag cggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgcccta gcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatc gggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtga tggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaa tagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattt tgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatatt
18

aacgcttacaatttccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctct tcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggtt ttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacctcgcgaatgcatctaga tT

19

20

SEQUENCES OF PCDNA 3.1:-

21

RESTRICTION MAPPING:-

22

WORK FLOW FOR WET LAB:y y y y

mRNA isolation from chick liver. load it onto formaldehyde agarose gel. Convert it into cDNA by reverse transcription. Amplification of the gene by gene specific primer with the help of Real time PCR.

y y y

Agarose gel electrophoresis of the gene. Competence cell preparation of the DH5 strain by CaCl2 method. Transformation of the PTZ57R/T cloning vector inside the competence cell for propagation of the vector.

y y y y y y y y y y y y

Spreading onto ampicillin agar plate. Overnight growth. Pick the colonies and inoculate into the LB Broth for overnight. Propagated Plasmid (PTZ57R/T) isolation. Check its concentration on Nano drop. Run on Agarose gel. Restriction mapping of the gene. Restriction mapping of the PTZ57R/T vector. Restriction digestion by restriction enzymes. Gel purification. Ligation of the gene and the PTZ57R/T vector by T4 ligase. Transformation of the PTZ57R/T vector along with TNF gene into the DH5 competence cells.

y y y y y y y

Spreading onto ampicillin agar plates. Overnight growth. Pick the colonies and inoculate into LB Broth for overnight. Plasmid (PTZ57R/T along with TNF alpha gene) isolation. Check its concentration onNano drop. Restriction digestion of the PTZ57R/T vector along with gene. Gel purification of the gene.

23

y y y y y

Restriction mapping of the expression vector pcDNA 3.1 vector. Restriction digestion of the pcDNA 3.1. Gel purification of the digested vector. Ligate the TNF gene into the pcDNA 3.1 vector. Transformation of the pcDNA 3.1 vector along with TNF DH5 . gene into the

y y y y y y y y

Spreading onto the ampicillin agar plate. Overnight growth. Pick the colonies and inoculate into broth for overnight. Plasmid (pcDNA3.1 along with TNF gene) isolation. Check its concentration on Nano drop. Restriction digestion. Gel purification of the gene. Transfection of the recombinant plasmid onto the mammalian cell lines.

Preparation of solid and liquid nutrient media.:The growth of an organism occurs on a medium which is commonly called culture.the food base that supports the growth of an organisms iscalled culture medium. the microbial(i.e.bacteria,fungi,yeast,algae,and protozoa) and plant and animal cells can be grown in pure cultures for experiment. .the culture media are devised in such a way that the organism should get the nutritional requirements i.e.carbon source, nitrogen sources, trace elements, hormones, vitamins, amino acids,nucleotides,etc. Reagents required:0.5% Peptone 0.3% Beef extract- (Composition of nutrient agar medium) 1.5% Agar Distilled water (Milli Q)

24

Procedure:Taken 5.6gm nutrient agar in conical flask and then added 200ml water to it, and thereafter put it in the oven till the solution boils, and then autoclaved it. Autoclaving of tips, beakers, inoculation loop has also been done to make it sterile (free from microbes). Then autoclaving of media is done at 121 C for 15 minutes in an autoclave chamber as this temperature of 121 C can kill all the endospores. After autoclaving of media has been done then media is poured from the conical flask into the petridishes in the presence of laminar air flow.

25

PREPARATION OF REAGENTS AND ADJUSTMENT OF PH OF THESE REAGENTS USING PH METER:Material required:Spatula, conical flask, aluminium foil, tissue paper, pH meter (EUTECH INSTRUMENT) and reagents.

Reagent used:1. Ethanol 2. Sodium acetate 3. Potassium acetate 4. TRIS 5. Boric acid 6. EDTA 7. Glucose 8. Sodium hydroxide 9. Sodium Dodecyl Sulphate 10. Calcium chloride 11. Distilled water Procedure for reagent preparation:I. 70% Ethanol is prepared by adding 70ml of ethanol with 30ml of Milli Q water. II. III. 0.1M Calcium chloride prepared in 200ml 3M sodium acetate prepared in 100ml. (pH is adjusted to 5.2 by adding glacial acetic acid). I . 3M potassium acetate prepared in 100ml. (pH is adjusted to 5.5 by adding glacial acetic acid). . 10X TBE prepared in 1000ml. (pH is adjusted to 8 by adding base/alkali 1N NAOH solution).

26

Composition of TBE:o TRIS 890mM o Boric acid 890mM o EDTA -20mM

100ml lysis buffer Components of lysis buffer:1. 50mM tris pH 8.0 2. 100mM EDTA pH 8.0 3. 100mM NaCl 4. 1% SDS 5. 2.5% beta mercaptoethanol G) Resuspension buffer (GTE solution) prepared in 100ml. (pH is adjusted to 8 by adding 1N NAOH solution).

Composition of GTE Buffer:1. Glucose 50mM 2. TRIS 25mM 3. EDTA 10mM H) Neutralization buffer (100 ml) 1. 5 M Potassium acetate 2. Glacial acetic acid 3. Autoclaved water I) TE buffer 1. 10mM Tris HCL, pH 8 2. 1 mM EDTA, pH 8 Media:LB Agar prepared in 100ml distilled water (MILLI Q). LB (Luria Barteni) Broth prepared in 100ml distilled water (MILLI Q).

27

RNA ISOLATION FROM CHICK LIVER USING TRIZOL METHOD:Trizol reagent is a chemical solution used in RNA/DNA/Protein extraction. Trizol is light sensitive and is stored in a dark coloured, glass container covered in foil. It is kept below room temperature. Trizol works by maintaining RNA integrity during tissue homogenization, while at the same time disrupting and breaking down cells and cell components. It reacts strongly with chloroform and is thus used in RNA extraction. Trizol reagent (homogeneous solution) is used for the isolation of total RNA. The phenol based reagent consists of a supreme combination of denaturants and RNase inhibitors. Tissue or cell sample is homogenized or disrupted in the presence of Trizol reagent, then the chloroform is mixed with the lysate and the mixture is further separated in three phases by the process of centrifugation. The RNA is then precipitated from the aqueous phase with isopropanol. REAGENTS:y y y y y

RNase, DNase free water Ice cold PBS (Phosphate Buffer Saline) RBC lysis buffer Diethyl pyrocarbonate (DEPC) treated water Trizol reagent 1. 75% Ethanol 2. Isopropyl alcohol 3. Chloroform (AMRESCO),

METHOD:y

All the tubes, solutions and tips are treated with DEPC-treated water and thereafter autoclaved overnight as DEPC-treated water degrade ever present RNases.

Ammonium chloride and Potassium bicarbonate was dissolved in 50ml distilled water. (pH is adjusted to 7.4)
28

y y y y y y y y y y y y y y y y y y y y y y y

Take 100mg of sample from chick liver. Add 3ml of Trizol in mortar for 3 appendorf. Crush well the sample. Take 1 ml of crushed sample in each appendorf. Spin at 14000 rpm for 15 min at 4 C. Take the 600l supernatant in the fresh tube. Add 900l i.e. 1.5 times more P:C:I and mix well. Spin at 14000 rpm for 15 min at 4 C. Take out the supernatant (400 l) as much as we can. Add equal amount (i.e. 400L) of isopropanol. Gently mix and put it on ice. Add 3-4l of proteiase k. Put the sample in thermobloak at 37 C temperature for 15 minutes. Give a short spin. Spin at 15000 rpm for 30 minutes at 4 C. Decent the supernatant. Add 1ml of 100% ethanol in each appendorf Spin it on 5000 rpm for 15 minutes at 4 C. Discard supernatant. Air dry it for 10-15 min in laminar air flow. Add 20l milli Q water. Incubate at 60 C for 10 minutes.
Store at -80 C

29

AGAROSE GEL ELECTROPHORESIS OF RNA SAMPLE:Agarose gel electrophoresis (AGE) was a simple technique in which movement of molecule occurs in the presence of an applied electric field. AGE was a simple and highly effective method for separating, identifying and purifying 0.5 to 2.5kb DNA fragments. This is achieved by moving negatively charged nucleic acid molecules through an agarose matrix with an electric field. Shorter molecules tends to move faster and migrate farther than the longer ones.

Fig:-Electrophoretic chamber for Agarose gel electrophoresis (C.B.S SCIENTIFIC)

Material:-Reagents:1. 40ml TBE buffer (1X) 2. 1% Agarose (AMRESCO) 3. 6X Loading dye (Bromophenol blue) 4. 350ml TBE buffer

PREPARATION OF 1% AGAROSE GEL (40ml):-

0.8gm of Agarose was taken in a conical flask and 100ml of TBE buffer was added to it.

30

PREPARATION O 10X TBE BU

ER (STOCK SOLUTION):

From 10X TB buffer, 1X (350ml) of TB buffer (working solution) was prepared. In the preparation of 1X (350ml) TB buffer, 35ml of TB buffer is taken in a

flask and to that 315ml of distilled water is added.

PROCEDURE OR GEL LOADING: 0.8gm of Agarose was taken in a conical flask and 100ml of TB buffer was added to it. Then the solution was boiled for 2 minutes in an oven. The electrophoretic tank, comb and baffles were properly washed with distilled water. As the electrophoretic chamber get dried and wiped with the tissue paper, then the boiled 1% Agarose was added to it and waited till the Agarose gel solidified.

After that the baffles and comb were separated from the electrophoretic chamber as the wells have been created. Then approximately 350ml of 1X TB buffer was added to the electrophoretic chamber. Thereafter sample along with the loading dye (Bromophenol blue) was mixed properly and was loaded into the wells. Then a proper voltage (120V) was maintained throughout the procedure. As the 70% gel has been run, the gel was carefully taken out from the electrophoretic chamber and was taken carefully to the TBR (Staining solution). The gel was kept in TBR solution for

approximately 5 minutes, and then it was placed on the distilled water (D estaining
31

solution) for 1 minutes. Thereafter the gel was observed under the U Transilluminator for the detection of bands.

Proper RNA bands were observed under U Transilluminator.

32

CDNA SYNTHESIS FROM MRNA (REVERSE TRANSCRIPTION):-

Introduction:-cDNA was synthesized from mRNA template using Reverse

transcriptase (RT). The resulted cDNA was a single stranded. This process was called Reverse transcription (RT) or first strand synthesis cDNA synthesis. The aim of converting mRNA to cDNA was mainly for the analysis of the template mRNA because DNA was much more stable than RNA. REAGENT: 2X RT reaction mix 10 l 2 unit enzyme mix RNA DEPC water 2 l 1 l 7l

Total

20l

METHOD:1. Mix and incubate at 25 C for 10 minutes. 2. Incubate tube at 50 C for 30 minutes. 3. Terminate the reaction at 85 C at 5 minutes. 4. Chill on ice. 5. Add 1l (2U) of e.coliRNAse H and incubate at 37 C for 20 minutes. 6. Store at -80 C.

33

AGAROSE GEL ELECTROPHORESIS OF CDNA AFTER ISOLATING IT FROM RNA:Agarose gel electrophoresis was a technique in which movement of molecule occurs in the presence of an applied electric field. Agarose gel electrophoresis was a effective method of separating, identifying and purifying 0.5 to 2.5 kb DNA fragments. It is achieved by moving negatively charged nucleic acid molecules through an Agarose matrix with an applied electric field. cDNA is synthesized by the use of mRNA as a template using reverse transcriptase (RT).

MATERIAL: REAGENT: 6X loading dye (Bromophenol blue) 400ml TBE buffer TRIS base- 0.89M Boric acid- 0.89M EDTA- 0.02M 0.8% Agarose DNA staining solution (ETBR)

Fig: Electrophoretic Chamber

34

METHOD:

PREPARATION OF 0.8% AGAROSE GEL (80ml):0.64gm of Agarose was taken in a conical flask and 80ml of 1x TBE buffer was added to it.

PREPARATION OF 10X TBE BUFFER (STOCK SOLUTION):From 10X TBE buffer, 1X (400ml) of TBE buffer (Working solution) was prepared. In the preparation of 1X (400ml) TBE buffer, 35ml of TBE buffer was taken in a flask and to that 315ml of distilled water was added.

PROCEDURE FOR GEL LOADING:0.64gm of Agarose was taken in a conical flask and 80ml of TBE buffer was added to it. Then the solution was boiled for 2 minutes in an oven. The electrophoretic tank, comb and baffles were properly washed with distilled water. As the electrophoretic chamber get dried and wiped with the tissue paper, then the boiled 0.8% Agarose was added to it and waited till the Agarose gel solidified. After that the baffles and comb were separated from the electrophoretic chamber as the wells have been created. Then approximately 300ml of 1X TBE buffer was added to the electrophoretic chamber. Thereafter sample along with the loading dye (Bromophenol blue) was mixed properly and was loaded into the wells. Then a proper voltage (150 ) was maintained throughout the procedure. As the 70% gel has been run, the gel was carefully taken out from the electrophoretic chamber and was taken carefully to the ETBR (Staining solution). The gel was kept in ETBR solution for approximately 5 minutes, and then it was placed on the distilled water (Destaining solution) for 1 minutes. Thereafter the gel was observed under the U Transilluminator for the detection of bands.

35

Fig: U TRANSILLUMINATOR (SPECTROLINE)

Proper and different sizes of cDNA bands were observed.

Real time Polymerase chain reaction of cDNA:-. INTRODUCTION:Real-time polymerase chain reaction, also

called quantitative real time polymerase chain reaction (Q-PCR/qPCR/qrt-PCR) or kinetic polymerase chain reaction(KPCR), is a laboratory technique based on the PCR, which is used to amplify and simultaneously quantify a

targeted DNA molecule. For one or more specific sequences in a DNA sample, RTPCR enables both detection and quantification

36

1. Denaturation Step:Provided heated treatment to the double stranded DNA molecule to separate the strands. Basically 94 C-98 C for 20-30 seconds was used. 3. Annealing Step:In this step, the reaction temperature was lowered to 50 C-65 C for 20-40 seconds allowing annealing of the primers to the single stranded DNA template. 4. Extension/ Elongation Step:In elongation step, Taq polymerase ( a DNA polymerase) purified from thermophilic bacterium thermos aquaticus was used. A temperature of 72 C was used with this enzyme. Taq polymerase adds nucleotides to the 3 end of each primer. With the help of Taq polymerase forward and reverse primers forms complementary strands. Reagent Used:y y y y y y y y

Template cDNA SYBR green dye dNTPs Taq DNA polymerase PCR buffer Primers -actin Mgcl2
H20

37

PROTOCOL FOR REAL TIME PCR:y y

cDNA(1:10 ; 1:100) Primers (-actin forward primer and -actin reverse primer)

2l 2l

2X master mix

5l

(SYBR green, dNTPs(2.5mM), RT enzyme,RT buffer)

y y

Double distilled water Total sample

11l 20l

Pcr Conditions:-

Steps
Initial Denaturation Denaturation Annealing Extension Go to step 2, repeat 29 cycles Final Extension Hold

Temperature
95C 95C 55C 72C

Time
10 minutes 1 minutes 30 seconds 30 seconds

72C 4C

5 minutes

METHOD: 1. All the components in a proper volume and concentration were taken and added to a microcentrifuge tube to prepare the master mix. 2. Forward and reverse primers were diluted with distilled water (Milli Q) in a ratio 1:9, before the master mix was prepared. 3. 1l was taken from each dilution that was made to prepare the master mix.

38

COMPETENT CELL PREPARATION:Under normal conditions several bacteria like E.coli receives a limited amount of DNA hence ,in order to introduce foreign DNA efficiently into these cells,the cells should have to undergo a chemical treatment .consequently,efficiency of receiving the foreign DNA is increased.such chemically treated cells are called competent cells. By addition of calcium chloride solution, ca ions destabilize the cell membrane or also forms a complex with the foreign DNA which attaches to the cell surface.by gently raising the temperature to 42c,the uptake of foreign DNA by E.coli cells is stimulated.the transformed e.coli cells can be plated on LB plate containing appropriate antibiotic(depending upon the antibiotic resistance gene present on the plasmid DNA used for transformation).then cells growing on such medium are selected and purified.

Media:- LB Broth Reagents:1M Cacl2 0.1M Cacl2 Glycerol

39

Methods:Take single colony of DH5 .

Inoculate in LB Broth for overnight,

1% cells have taken and inoculated in LB Broth for 3-4 hours.

Arrest the cell growth by put it on ice for 15-20 min at log phage.

Spin it for 15 min at 5000 rpm at 4 C.

Discard the supernatant.

Take the cells.

Add 1M Cacl2 treated with ice for 15-20 minutes.

Spin for 5-10 minutes at 2000 rpm at 4 C.

Discard the supernatant.

Add 0.1 M Cacl2 and hold on ice.

40

Add glycerol and store at -80 C.

Vector propagation:The vector used for the cloning purpose is pTZ57R/T cloning vector. Initially the concentration of the pTZ57R/T vector is low i.e.10ng/l for the cloning purpose the total concentration of the vector should be between 25-30g.

41

Method:Take PTZ57R/T vector of 10ng/l concentration for propagation its concentration from low concentration to high concentration.

take 3l (30ng/3l) of the pTZ57R/T vector.

add in 100l competence cell. s

Mix properly

Keep it on ice for 5 minutes.

Heat shock at 42 C for 2 minutes (to open the pores properly)

Keep it on ice

Add 300l LB Broth

Keep for 30-45 min at 37 C for regeneration.

Centrifugation at 5000 rpm for 5 minutes.

Discard 200l of the supernatant.

42

Resuspend the pallet.

Spread it onto the ampicillin (100g/ml) agar plate.

Put these agar plates on 37 C for incubation for overnight in inverted position.

43

PLASMID ISOLATION AND PURIFICATION:Plasmids are the circular, autonomously replicating, extra chromosomal doublestranded DNA molecules find in bacteria,cyanobacteria, fungi etc. there are three forms of plasmids;super-coiled, relaxed and linear.in recombinant DNA technology, plasmids are used as cloning vehicle or vector to introduce foreign genes into a host organism. In alkaline lysis method, the cells are lysed by using EDTA (that chelates metal ions) and SDS detergent.it weakens the bacterial cell wall and also inactivate the enzymes digesting the DNA (DNases).SDS removes lipid molecules,disrupts the cell membrane and also denatures the bacterial proteins. After adding NaOH, pH of the solution increases to 11-12.hence it denature the bacterial chromosomal DNA and the plasmid DNA. When the is reduced after adding potassium or sodium acetate in the solution,the plasmid DNA renatures because of its small size. But the chromosomal DNA strand and bacterial proteins form a precipitate along with SDS. Precipitate removed by centrifugation and adding isopropanol and can concentrate the renature plasmid in solution.

METHOD:Picksingle colony from the overnight growth on the ampicillin agar plate.

Inoculate it into 15 ml Luria broth.

Keep it for overnight growth in incubation in 37 C temp.

Take 1 ml of culture from the overnight growth in the luria broth.

44

Spin it at 5000 rpm for 15 minutes at 4 C temperature.

Decant the supernatant.

To thepallet add 100 l of Resuspension buffer and resuspend the pallet without clumps.

Add 100l of lysis buffer (mix 2-3 times).

Add 250l neutralization buffer or precipitation buffer.

Mix Resuspention, lysis and neutralization buffer until we get white milky precipitation.

Spin at 14000 rpm for 15 minutes at 4 C.

Collect the 400l supernatant.

Add 400l of 24:23:1of PCI (Phenol, chloroform isoamayl alcohol) i.e. equal amount to that of supernatant.

Spin at 14000 rpm for 15 minutes at 4 C.

Add 175l (0.7 volume) of supernatant of ice cold isopropanol.

45

Spin the cells at 14000 rpm for 3 minutes at 4 C.

Decant the supernatant.

To the pellet add 500l-1000l of 100% ethanol and mix well.

Spin at 14000 rpm for 15 minutes at 4 C temperature.

Air dry in laminar air flow.

To the pellet add 25l of DD water.

Resuspend the pellet gently.

46

QUANTITATIVE ESTIMATION OF PLASMID DNA BY NANODROP METHOD:Pure form of DNA can be measured by using a nanodrop method. Due to the presence of conjugated double bonds in purine and pyrimidine,both RNAand DNA strongly absorb the uv light. Protein are the main contaminants in nucleic acid extract.

Plasmid DNA concentration of pTZ57R/T:Concentration (ng/l) 1. 476.9 2. 922.2 3. 574.2 260/280 1.84 1.74 1.88 230/260 1.70 1.79 1.81

Pool the all the three samples in one eppendorf. Again check the concentration using Nano drop 565.1ng/l 1.87 1.59

Restriction mapping:-Restriction mapping involves digesting DNA with a series of restriction enzymes and then separating the resultant DNA fragments by agarose gel electrophoresis. The distance between restriction enzyme sites can be determined by the patterns of fragments that are produced by the restriction enzyme digestion. In this way, information about the structure of an unknown piece of DNA can be obtained.

47

HindIII and Kpn1 are the two restriction enzymes chosen for the restriction of the pTZ57R/T vector.

48

RESTRICTION DIGESTION OF PTZ57R/T VECTOR:Restriction enzymes are endonucleases which recognize and cleave the specific DNA sequence called restriction sites.for example,HindIII isolated from heamophilus influenzaerecognized cleaves the sequences 5`-AAGCTT-3`to generate cohesive and sticky ends. Enzyme activity is represented as IU(international unit).one unit of restriction enzyme is the amount of enzyme required to completely digest one microgram of plasmid DNA.

For Restriction digestion the concentration of the vector should be 30g.

Requirements:1. Vector 2. Restriction enzymes (HindIII and Kpn1) 3. 1X buffer 4. Double distil water

Restriction digestion components: PTZ57R/T plasmid HindIII Kpn1 Buffer (1X) Double distil water 8l 2l 1l 10 l 79l

Total

100l

49

Procedure:-

Take 8l of the plasmid having the 3996ng/l concentration in the appendorf. Add 79l of DD water. Add 10 l of 1x buffer. Add 2l of the Hind III restriction enzyme. Add 1l of the kpn1 restriction enzyme. Keep the appendorf in incubation at 37C for two hours.

50

AGAROSE GEL ELECTROPHORESIS OF THE RESTRICTED PLASMID VECTOR (PTZ57RT):Electrophoresis through agrose gel in the standard method used to separate identify and purity DNA fragment from 200bp to 50kb in length.when an electric field applied across the gel the negatively charged DNA at neutral pH migrates towards the anode.The rate of migration is determined by the number of parameter such as molecular size of the DNA, agrose concentration, conformation of the DNA (super helical circular,nicked circular and linear) applied voltage direction of the electric field, composition of the electrophores

REAGENT:6X loading dye (Bromophenol blue) 400ml TBE buffer 0.8% Agarose DNA staining solution (ETBR)

Methods:-

Add 5l uncut pTZ57R/T plasmid with 1l of the bromophenol dye for one each well. Pour it into 3 wells. Add 10l of restricted pTZ57R/T vector with 2l of the bromophenol dye each well. Pour it into 4 wells. Run the sample for 70% of the gel. Put the gel into staining solution for 15 minutes. Remove the gel and put it into the distaining solution for 3 minutes. Check the quality of the restricted plasmid.
51

Result:-The gel is showing that two kinds of bands- One is for the vector which is present on the

e upper side and one for the restricted DNA segment.

52

GEL PURIFICATION OF THE PTZ57R/T PLASMID VECTOR:Requirements:-

Gel solubilization buffer Wash buffer Gel elution buffer Isopropanol

Methods:Add 3 volumes of gel solublization buffer to the gel i.e. 15 l gel solublization buffer to the 5l of the gel of the pTZ57R/T vector. Add 20l isopropanol and vortex it. Keep it at thermoblock till melt on 50-60C temperature and mix it regularly and properly. Keep the appendrof onto the silica column. Spin at 1000 rpm for 1 minute. Discard flowthrough. Again add 500l of gel solublization buffer. Spin at 10000 rpm for 1 minute. Discard flowthrough. Add 750l OG wash buffer. Centrifuge for 1000 rpm for 1 minute. Discard supernatant. Centrifuge at 1000 rpm for 1-2 minutes (Dry spin). Put spin column in 1.5 ml appendorf. Add 30l of the elution buffer. Stand for 1 minute Centrifuge at 10000 rpm for 1 minute. Discard the column and take the elution. Check the concentration on Nano drop:-

53

LIGATION OF THE GENE AND PTZ57R/T VECTOR BY T4 LIGASE:Ligation process involves the formation of four phasphodiester bond i.e. two at each end of molecule such bonds can be formedthe generation phasphodieter bond between neighboring 3OH end and 5P ends of double stranded DNA chain is catalyzed coenzymes NAD+ and ATP.

Requirements:-

1. Template TNF gene pTZ57R/T vector 2. 10X ligation buffer 3. T4 DNA ligase 4. Water
Method:Take the vector and the gene in two types of ratio1. Three molecule of the vector : one molecule of the gene 2. Two molecule of the vector : one vector of the gene 3. Control

3:1 concentration2:1 concentration Template4.95l2 l pTZ57R/T vector6.67 l1 l1 l 10X ligation buffer2.00 l1 l1 l T4 DNA ligase1.00 l1 l2 l Water5.38 l5 l Total20 l10 l3 l

control

Incubate it onto 16C for overnight.

54

TRANSFORMATION OF THE PTZ57R/T VECTOR ALONG WITH TNF :For the cloning of the gene along with the vector, the vector inserted into the DH5Alpha cell and then its inoculation onto the ampicillin agar plates. Requirements:Competence cells Vector along with the gene Methods:  Take the pTZ57R/Tvector along with gene for propagation its concentration from low concentration to high concentration.  Take competence cells for 3:1, 2:1 and for the control.  Add 3:1 ligated vector in 200l of the competence cells.  Add 2:1 ligated vector in 200l of the competence cells.  Add control in 200l of the competence cells.  mix properly  Keep it on ice for 5 minutes.  Heat shock at 42 C for 2 minutes (to open the pores properly)  Keep it on ice  Add 300l LB Broth  Keep for 30-45 min at 37 C for regeneration.  Centrifugation at 5000 rpm for 5 minutes.  Discard 200l of the supernatant.  Resuspend the pallet.  Spread it onto the ampicillin (1l/ml) agar plate. For 3:1 :- spread it onto two ampicillin plates.  50l in one ampicillin plate (For test).  Rest in another ampicillin plate. For 2:1 :- spread it onto two ampicillin plates. 50l in one ampicillin plate (For test).  Rest in another ampicillin plate. For control :- Spread it onto one ampicillin plate. Put these agar plates on 37 C for incubation for overnight in inverted position.

55

PLASMID (PTZ57R/T ALONG WITH GENE) ISOLATION:Method: Pick one colony from the overnight growth on the ampicillin agar plate.Inoculate it into 15 ml Luria broth.  Keep it for overnight growth in incubation in 37 C temp.  Take 1 ml of culture from the overnight growth in the Luria broth.  Spin it at 5000 rpm for 15 minutes at 4 C temperature.  Decant the supernatant.  To the pallet add 100 l of Resuspention buffer and resuspend the pallets without clumps.  Add 100l of lysis buffer (mix 2-3 times).  Add 250l neutralization buffer or precipitation buffer.  Mix Resuspention, lysis and neutralization buffer until we get white milky precipitation.  Spin at 14000 rpm for 15 minutes at 4 C.  Collect the 400l supernatant.  Add 400l of 24:23:1of PCI (Phenol, chloroform, isoamayl alcohol) i.e. equal amount to that of supernatant.  Spin at 14000 rpm for 15 minutes at 4 C.  Add 175l (0.7 volume) of supernatant of ice cold isopropanol.  Spin the cells at 14000 rpm for 3 minutes at 4 C.  Decent the supernatant.  To the pellet add 500l-1000l of 100% ethanol and mix well.  Spin at 14000 rpm for 15 minutes at 4 C temperature.  Airs dry in laminar air flow. To the pellet add 25l of DD water.  Resuspend the pellet gently.  Check its concentration.

56

Nano drop result:-

Concentration Plasmid pTZ57R/T gene with 987ng/l

260/280 1.87

260/230 1.94

57

SUBCLONING OF TNF-alpha INTO pcDNA3VECTOR:Restriction Mapping Of Pcdna3.1 E pression Vector Restriction mapping is the process of obtaining structural information on a piece of DNA by the use of restriction enzymes. Restriction mapping involves digesting DNA with a series of restriction enzymes and then separating the resultant DNA fragments by agarose gel electrophoresis. The distance between restriction enzyme sites can be determined by the patterns of fragments that are produced by the restriction enzyme digestion. In this way, information about the structure of an unknown piece of DNA can be obtained.

pcDNA3.1 SEQUENCE IN FASTA FORMAT:GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGC CGCATAGTTAAGCCAGTAT CTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAA CAAGGCAAGGCTTGACCGA CAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCC AGATATACGCGTTGACATT GATTATTGACTAG TTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATAT GGAGTTCCGCGTTACATAA CTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATA ATGACGTATGTTCCCATAGT AACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCA CTTGGCAGTACATCAAGTGT ATCATATGCCAAGTACGCCCCCTATT GACGTCAATGACGGTAAATGGCCCGCCTGGCATTA TGCCCAGTACATGACCTTA TGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGC GGTTTTGGCAGTACATCAA TGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAAT GGGAGTTTGTTTTGGCACC AAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCG CCCCATTGACGCAAATGGGCG GTAGGCGTGTACGGTGGGAG GTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAA TTAATACGACTCACTATAG GGAGACCCAAGCTGGCTAGCGTTTAAACGGGCCCTCTAGACTCGAGCGGCCGCCACTGTG CTGGATATCTGCAGAATTCC

58

ACCACACTGGACTAGTGGATCCGAGCTCGGTACCAAGCTTAAGTTTAAACCG CTGATCAG CCTCGACTGTGCCTTCTAGT TGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCC CACTGTCCTTTCCTAATA AAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGT GGGGCAGGACAGCAAGGGGG AGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGG CGGAAAGAACCAGCTGGGGC TCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTT ACGCGCAGCGTGACCGCTAC ACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCG CCGGCTTTCCCCGTCAAG CTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAA AAAACTTGATTAGGGTG AT GGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCA CGTTCTTTAATAGTGGACT CTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGG ATTTTGCCGATTTCGGCCT ATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGT GTGTCAGTTAGGGTGTGGAA AGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAA CCAGGTGTGGAAAGTCCCCA GGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTC CCGCCCCTAACTCCGCCCAT CCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTA TTTATGCAGAGGCCGAGG CCGCCTCTGCCTCTGAGCTATTC CAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTT TTGCAAAAAGCTCCCGGGA GCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTG AACAAGATGGATTGCACGC AGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAAT CGGCTGCTCTGATGCCGCCG TGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTT TTGTCAAGACCGACCTGTCCGGTGC CCTGAATGAACTGCAGGAC GAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGAC GTTGTCACTGAAGCGGGAAG GGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCT GCCGAGAAAGTATCCATCA TGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCC ATTCGACCACCA AGCGAAACATCGCATCGAG

59

CGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCAT CAGGGGCTCGCGCCAGCCGA ACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGG CGATGCCTGCTTGCCGAATA TCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGA CCGCTATCAGGACATAGCG TTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGC TTTACGGTATCGCCGCTCC CGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGG GGTTCGAAATGACCGACCA AGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTG GGCTTCGGAATCGTTTTCC GGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACC CCAACTTGTTTATTGCAGCT TATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCAC TGCATTCTAGTTGTGGTTT GTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTG GCGTAATCATGGTCATAGC TGTTTCC TGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCAT AAAGTGTAAAGCCTGGGGT GCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGG GAAACCTGTCGTGCCAGCT GCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGC TTCCTCGCTCACTGACTCGC TGCGCTCGGTCGTTCGGCTG CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGT TATCCACAGAATCAGGGGAT AACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGG CCGCGTTGCTGGCGTTTTTCCA TAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAA CCCGACAGGACTATAAAGAT ACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGC GCTCTCCTGTTCCGACCCTGCCGCTTAC CGGATACCTGTCCGCCTTT CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGT AGGTCGTTCGCTCCAAGCT GGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGT CTTGAGTCCAACCCGGTAA GACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAG CAGAGCGAGGTATG TAGGCGGTGCTACAGAGTTC TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGC TGAAGCCAGTTACCTTCGG

60

AAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTTTTTGTT TGCAAGCAGCAGATTACGC GCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAG T GGAACGAAAACTCACGTTAA GGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAAT GAAGTTTTAAATCAATCTA AAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATC TCAGCGATCTGTCTATTTC GTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACC ATCTGGCCCCAGTGCTGCA ATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCC GGAAGGGCCGAGCGCAGAAG TGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTA AGTAGTTCGCCAGTTAATA GTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTAT GGCTTCATTCAGCTCCGGT TCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCC TTCGGTCCTCCGATCGTTGT CAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTT ACTGTCATGCCATCCGTAA GATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCG ACCGAGTTGCTCTTGCCCG GCGTCAATACGGGATAA TACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGA AAACGTTCTTCGGGGCGAAA ACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAAC TGATCTTCAGCATCTTTTA CTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGA ATAAGGGCGACACGGAAATGT TGAATACTCATACTCTTCCTTTTTCAATAT TATTGAAGCATTTATCAGGGTTATTGTCTCAT GAGCGGATACATATTTGA ATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACC TGACGTC

RESTRICTION MAP OF pcDNA 3.1 VECTOR:

61

62

RESTRICTION DIGESTION OF pcDNA3.1 VECTOR:Restriction digestion is a procedure used in molecular biology to prepare DNA for analysis or other processing. It is sometimes termed DNA fragmentation (this term is used for other procedures as well). This enzymatic technique can be used for cleaving DNA molecules at specific sites, ensuring that all DNA fragments that contain a particular sequence have the same size The cleavage method makes use of an important class of DNA-cleaving enzymes isolated primarily from bacteria. These enzymes are called restriction endonucleases or restriction enzymes, and they are able to cleave DNA molecules at the positions at which particular short sequences of bases are present.

Reagents:
y y y y

Vector Restriction enzymes (BamH1 and Kpn1) 1X buffer Double distilled water

Method: i. ii. iii. iv. v. vi. Take 8l of pcDNA3.1 vector in the appendorf. Add 79l of DD water. Add 10 l of 1x buffer. Add 2l of the Hind III restriction enzyme. Add 1l of the kpn1 restriction enzyme. Keep the appendorf in incubation at 37C for two hours.
y y

pcDNA3.1 vector BamH1

8l 2 l

y Kpn1 y Buffer (1X)

1l 10 l

63

y DD water y Total

79l 100l

LIGATION OF TNF alpha GENE WITH THE pcDNA3.1 VECTOR:Ligation is a process of inserting our gene of interest into a suitable vector. Here TNFalpha gene is ligated into a cloning vector i.e ptz57r/t. vector should be large enough to engulf our gene of interest and proper clones should obtained i.e the concentration should be in the ratio of 2:1 0r 3:1. The gene and the vector should have the same restriction enzymes to cut the both gene and a vector at the suitable sites. One thing one should keep in mind the Restriction enzymes that we are using to cut the vector, it should cut our gene otherwise the gene gets disrupture and further no result found.

Requirements:y y y y y

Template for TNF-alpha gene PcDNA3.1 vector 10X ligation buffer T4 DNA ligase Water

Method:Take the ptz57r/t vector and the TNF alpha gene in two types of ratio i.e 1. Three molecule of the vector : one molecule of the gene(3:1) 2. Two molecule of the vector : one vector of the gene(2:1 3. Control

3:1 Template(TNFalpha) 4.95l 2 l

2:1

Control

64

Ptz57r/t vector 10X buffer T4 DNA ligase Water Total

6.67 l

1 l 1 l

1 l 1 l

ligation 2.00 l

1.00 l 5.38 l 20 l

1 l 5 l 10 l

2 l

3 l

Thereafter incubate it onto 16C for overnight.

TRANSFORMATION OF RECOMBINENT VECTOR pcDNA3.1 INTO DH5 alpha :Here I transform my transformed vector sample (pcDNA3.1 + tnf alpha gene) into the competent cells i.e DH5 .
REAGENT USED:y y y y y

LB broth Ampicillin Competent cells (DH5 ) Ligated gene 70% ethanol

METHOD:i. ii. Add 200l of competent cells in each three eppendorf Add 2:1, 3:1 and control vector (prepared during ligation procedure) to the respective tubes

65

iii. iv. v. vi. vii. viii. ix. x.

Put these tubes on ice for 45 min Heat shock for 20 min at 42 C Add 500l of LB broth to the each tube Put for regeneration at 37 C for 60 min in an incubator Spin at 5000 rpm for 5 min at 4 C Decant the supernatant i.e 200l from each tube Resuspend the pallet with remaining supernatant Spread onto the ampicillin plates
y y y

Two plates for 3:1 sample (one 450l and another 50l) Two plates for 2:1 sample(same as above) One plate for control

xi.

Put these plates in an inverted position at room temperature in an incubator for overnight

66

INOCULATION OF THE TRANSFORMED SAMPLE:Reagent Used:y y y

70% ethanol LB broth Transformed cells

Method:a. After the overnight incubation, the colonies are grown during transformation process b. Take 25 ml of LB broth in a falcon tube, add 25l of ampicilin to it c. Now pick a single colony and inoculate it into the falcon d. Put it at 37 C for overnight in a shaking incubator

PLASMID DNA ISOLATION FROM INOCULATED SAMPLE:The next step is to isolate the plasmid DNA from the overnight inoculated sample (pcDNA3.1+tnf alpha).

Reagents Used: Resuspension buffer (500 ml)

y y

50mM glucose 25mM Tris Hcl (ph8.0)

67

10mM EDTA (ph8.0)

Lysis buffer (500 ml)

y y y y y

50mM tris pH 8.0 100mM EDTA pH 8.0 100mM NaCl 1% SDS 2.5% beta mercaptoethanol

Neutralization buffer (100 ml)

y y y

5M potassium acetate (60 ml) Glacial acetic acid (11.5 ml) Autoclaved water (28.5 ml)

Phenol: Chloroform: Isoamyl alcohol RNase Isopropanol Ethanol Methods: Pick single colony from overnight culture on the ampicillin agar plate  Inoculate it into 15ml of LB broth  Incubate at 37 C Overnight in the shaking incubator  Then take 1 ml of culture in eppendorf

68

 Spin/Centrifuge it on 5000 rpm for 15 min at 4 C  Decant the supernatant  Add 100l of resuspension buffer and resuspend the pallets without clumps Also add 1l of RNase alongwith resuspension buffer  Add 100l of lysis buffer and immediately add 250l of nutrlization buffer  Mix it well  Spin on 14000 rpm for 15 min at 4 C  Take out supernatant as much as you can(500l-600l)  Discard the pallet  Add equal amount of P:C:I in supernatant(500-600l)  Spin on 14000rpm for 15 min at 4 C  Take out aqueous layer (200l)  Add 0.7volume of Isopropenol (i.e 200*0.7=140l)  Spin on 14000 rpm for 30 min at 4 C  Decant the supernatant  Add 500l of 70% ethanol  Spin on 15000 rpm for 15 min at 4 C  Decant the supernatant  Air dry it for 10-15 min in LAF  Place it in -80 C

Then check the concentration of the cloned gene using nanodrop.

69

Result -: Concentration of RNA sample isolated from chick liver. .

Concentration of cDNA on Nanodrop:Conc. 2096 ng/l, 260/280 = 1.93, 260/230 = 1.42 After that c- DNA synthesized from m-RNA and real time PCR. We check the quantity of c-DNA sample. c-DNA quantities are maximum 30 ng/l. after c-DNA transform in plasmid vector pTZ57R/T. we check the concentration on nanodrop.

Plasmid DNA concentration of pTZ57R/T:Concentration (ng/l) 4. 476.9 5. 922.2 6. 574.2 260/280 1.84 1.74 1.88 230/260 1.70 1.79 1.81

After restriction digestion plasmid vector we have done subcloning of TNF plasmid vector p c-DNA 3.1. and finally we clone the gene.

gene in

70

SUMMARY
We isolated TNF gene from chick liver. We made c-DNA from mRNA and we get multipal copies of c-DNA by real time PCR. After that we run electrophoresis gel that show proper band of c-DNA. We done TNF gene fasta and blast in ncbi. And we get prpper sequence of TNF gene. And it cloned in Ptz57 vector we done restriction mapping and digestion in pub med and we get sequence of plasmid vector . afterThis gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. This cytokine is mainly secreted by macrophages. It can bind to, and thus functions through its receptors This cytokine is involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. This cytokine has been implicated in a variety of diseases, including autoimmune diseases, insulin resistance, and cancer. Knockout studies in mice also suggested the neuroprotective function of this cytokine.

NF-kappaB (nuclear factor-kappa B) is a rapidly acting primary transcription factor found in all cell types.

It is involved in cellular responses to stimuli such as cytokines and stress and plays a key role in regulating the immune response to infection. In unstimulated cells NFkappaB dimers are sequestered inactively in the cytoplasm by a protein complex called inhibitor of kappa B (IkappaB). IkappaB inactivates NF-kappaB by masking the nuclear localization signals (NLS). Activation of NF-kappaB occurs via degradation of IkappaB, a process that is initiated by its phosphorylation by IkappaB kinase (IKK). Phosphorylated IkappaB becomes dissociated from NF-kappaB, unmasking the NLS. Phosphorylation also results in IkappaB ubiquitination and targeting to the proteasome. NF-kappaB can now enter the nucleus and regulate gene expression. NF-kappaB turns on expression of IkappaB forming a negative feedback loop
.

71

REFERENCE:1. Beutler B, Greenwald D, Hulmes JD, Chang M, Pan YC, Mathison J, Ulevitch R, Cerami A (1985). "Identity of tumour necrosis factor and the macrophage-secreted factor cachectin". 2. Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF, Castner BJ, Stocking KL, Reddy P, Srinivasan S, Nelson N, Boiani N, Schooley KA, Gerhart M, Davis R, Fitzner JN, Johnson RS, Paxton RJ, March CJ, Cerretti DP (1997). "A metalloproteinase disintegrin that releases tumour-necrosis factoralpha from cells". 3. Carswell EA, Old LJ, Kassel RL, Green S, Fiore N, Williamson B (1975). "An endotoxin-induced serum factor that causes necrosis of tumors 4. Chen G, Goeddel DV (2002). "TNF-R1 signaling: a beautiful pathway". 5. Dowlati Y, Herrmann N, Swardfager W, Liu H, Sham L, Reim EK, Lanctt KL (2010). "A meta-analysis of cytokines in major depression". 6. Elias A. Said et al. 2009, PD-1 Induced IL10 Production by Monocytes Impairs Tcell Activation in a Reversible Fashion. 7. Gaur U, Aggarwal BB (2003). "Regulation of proliferation, survival and apoptosis by members of the TNF superfamily". 8. Kolb WP, Granger GA (1968). "Lymphocyte in vitro cytotoxicity:

characterization of human lymphotoxin"

72

9. Kriegler M, Perez C, DeFay K, Albert I, Lu SD (1988). "A novel form of TNF/cachectin is a cell surface cytotoxic transmembrane protein: ramifications for the complex physiology of TNF". Cell 53. 10. Locksley RM, Killeen N, Lenardo MJ (2001). "The TNF and TNF receptor superfamilies: integrating mammalian biology". Cell 104 (4): 487501. 11. Micheau, Olivier; Tschopp Jrg (Jul. 2003). "Induction of TNF receptor Imediated apoptosis via two sequential signaling complexes". 12. Nedwin GE, Naylor SL, Sakaguchi AY, Smith D, Jarrett-Nedwin J, Pennica D, Goeddel DV, Gray PW (1985). "Human lymphotoxin and tumor necrosis factor genes: structure, homology and chromosomal localization"Nucleic Acids 13. Old LJ (1985). "Tumor necrosis factor (TNF)". Science 230 (4726): 6302.. 14. Pennica D, Nedwin GE, Hayflick JS, Seeburg PH, Derynck R, Palladino MA, Kohr WJ, Aggarwal BB, Goeddel DV (1984). "Human tumour necrosis factor: precursor structure, expression and homology to lymphotoxin". 15. Ruddle NH, Waksman BH (December 1968). "Cytotoxicity mediated by soluble antigen and lymphocytes in delayed hypersensitivity. 3.Analysis of mechanism" 16. Swardfager W, Lanctt K, Rothenburg L, Wong A, Cappell J, Herrmann N (2010). "A meta-analysis of cytokines in Alzheimer's disease".. 17. Tracey KJ, et al. (October 1986). "Shock and tissue injury induced by recombinant human cachectin". 18. Tracey KJ, Fong Y, Hesse DG, Manogue KR, Lee AT, Kuo GC, Lowry SF, Cerami A (December 1987). "Anti-cachectin/TNF monoclonal antibodies prevent septic shock during lethal bacteraemia". 19. Tang P, Hung M-C, Klostergaard J (1996). "Human pro-tumor necrosis factor is a homotrimer".. 20. Wajant H, Pfizenmaier K, Scheurich P (2003). "Tumor necrosis factor signaling". Cell Death Differ.
73

APPENDIX
y y y y y y y y y y y y y y y y y y y y

Nano drop Q PCR PCR Realtime pcr Gradient pcr Bio analyzer Centrifuge Electronic balance electrophoresis Vortex Shaking Incubator 4C refrigerator -80C refrigerator Spinner Ice maker Microwave micropipettes Autoclave pH meter (EUTECH INSTRUMENT) laminar air flow
74

y y y y y y

Electrophoresis chamber Vaccum desiccator Thermo cycler Water distillation unit Quebec colony counter Uv transilluminater

y y y y y y y

Microcentrifuge (SORVALL) Vortex mixer (GENIE) Refrigerated centrifuge (SORVALL) Micropipettes (NICHIPET EX) TNT Blue powder free nitrile gloves (ANSELL) Centrifuge tubes (LABWARE) Sprout (HEATH ROW SCIENTIFIC, U.S.A)

Appendix
y
y y y y y y y y y y y

Ethanol (BIOGENE, U.S.A) Sodium acetate (BIO BASIC INC) Potassium acetate (BIO BASIC INC) TRIS (BIOGENE, U.S.A) Boric acid (BIOGENE, U.S.A) EDTA (AMRESCO) Glucose (BIOGENE, U.S.A) Sodium hydroxide (AMRESCO) Sodium Dodecyl Sulphate (BIOGENE, U.S.A) Calcium chloride (AMRESCO) Distilled water (MILLI Q) 100%ethanol
75

y y y y y y y y y y y y y y y y y y y y y y y

70%ethanol PCI (Phenol: Chloroform: Isoamyl). Chloroform Neutralization buffer. Resuspension buffer T4 DNA ligase Ligase buffer Bromophenol blue Ethidium bromide 0.5% Peptone(Amresco) 0.3% Beef extract(Amresco) 1.5% Agar(Amresco) RNase, DNase free water (MOLECULAR BIOPRODUCTS) Ice cold PBS (Phosphate Buffer Saline) RBC lysis buffer Diethyl pyrocarbonate (DEPC) treated water (AMBION) Trizol reagent (INVITROGEN) Ethanol (BIOGENE, U.S.A) Sodium acetate (BIO BASIC INC) Potassium acetate (BIO BASIC INC) TRIS (BIOGENE, U.S.A) Boric acid (BIOGENE, U.S.A) EDTA (AMRESCO)
76

y y y y y

Glucose (BIOGENE, U.S.A) Sodium hydroxide (AMRESCO) Sodium Dodecyl Sulphate (BIOGENE, U.S.A) Calcium chloride (AMRESCO) Distilled water (MILLI Q)

Appendix
Beakers (50ml, 100ml, 250ml, 500ml, 1000ml) BOD bottles Cotton Aluminium foil. Powder free nitrile gloves (ANSELL) Flasks (50ml, 100ml, 250ml,500ml,1000ml) Inoculating loop Measuring cylinders (10-1000ml) Micropipette tips Petriplates Falcon Eppendorf Para film

77