Dig Dis Sci (2008) 53:925–932
DOI 10.1007/s10620-007-9978-y
ORIGINAL PAPER
cagA Gene and Protein Status Among Iranian Helicobacter pylori
Strains
Yeganeh Talebkhan Æ Marjan Mohammadi Æ Mohammad Ali Mohagheghi Æ
Hamid Reza Vaziri Æ Mahmoud Eshagh Hosseini Æ Nazanin Mohajerani Æ
Akbar Oghalaei Æ Maryam Esmaeili Æ Leili Zamaninia
Received: 1 March 2007 / Accepted: 15 August 2007 / Published online: 16 October 2007
Ó Springer Science+Business Media, LLC 2007
Abstract The wide geographic genetic diversity of
Helicobacter pylori (Hp) and, in particular, the varying
prevalence of cagA in different countries has been docu-
mented repeatedly. This study was designed to determine
the frequency of cagA in Iranian Hp strains by means of
genotyping and assessment of host antibodies. Helicobacter
pylori strains from 235 patients, including 174 non-ulcer
dyspepsia, 25 peptic ulcer and 36 gastric cancer patients,
were studied. The frequencies of the 50 , middle and 30
terminal regions of the cagA gene were 90.6, 57.6, 89%,
respectively, with no correlation to the clinical outcomes.
Antibodies against the CagA protein were present in 90.7%
of patients. Multiple biopsy sampling in 97 cases revealed
multiple infection in 16.5% of the patients. Sequencing of
the seven variants of the 30 end of the cagA gene revealed no
clustering and the distribution of the Iranian strains among
those of other countries. Our results from the genotyping and
serology analyses confirm that the majority of Iranian Hp
strains are cagA-positive.
Y. Talebkhan
M. Mohammadi (&)
N. Mohajerani

A. Oghalaei
M. Esmaeili
L. Zamaninia
Biotechnology Research Center, Pasteur Institute of Iran, Tehran
13164, Iran
e-mail: marjan@pasteur.ac.ir
M. A. Mohagheghi
Cancer Research Center, Tehran University of Medical Sciences,
Tehran, Iran
H. R. Vaziri
Endoscopy Unit, Mofarrah Hospital, Tehran, Iran
M. Eshagh Hosseini
Gastroenterology Department, Amiralam Hospital, Tehran, Iran
Keywords cagA
Genotype
Iran
Helicobacter pylori

Western blotting
Introduction
Helicobacter pylori (Hp) infection is one of the most
common bacterial infections worldwide and a causative
agent of chronic gastritis, peptic ulcer disease, gastric
adenocarcinoma and even B cell MALT lymphoma [1–3].
Molecular studies on Hp pathogenesis have resulted in
identifying a number of major virulence markers of the
microorganism. One of the most well-studied heterogenic
virulence markers of Hp is cytotoxin-associated gene A
(cagA), which is present in 60–70% of Hp strains and
located at the right end of the cag pathogenicity island
(cagPAI) and encodes the high-molecular-weight immu-
nogenic protein, CagA [4, 5]. Several studies have
demonstrated a strong association between the presence of
anti-CagA antibodies and the occurrence of peptic ulcers
[4, 6, 7]. Genotyping studies have shown that despite the
conservation of nucleotide sequences in the 50 region of the
cagA gene [4, 5], existing variations in the 30 terminal
region alter the immunogenicity of its encoded protein
[8, 9]. Epidemiological studies from different parts of the
world have revealed that cagA-positive strains are present
at different frequencies in various populations. In East
Asia, nearly all of the isolated Hp strains are cagA-positive
[10–12], whereas the frequency of cagA-positive Hp strains
is lower in Western countries [13].
The aim of this study was to determine the frequency
and genetic diversity of the cagA gene among Iranian Hp
strains, to identify sero-prevalence of anti-CagA antibodies
in Hp-infected individuals and to evaluate their potential
values in screening Hp-infected patients.
123
926
Methods
Study population
The study population consisted of 174 non-ulcer dyspepsia
(NUD; 90 females, 84 males), 25 peptic ulcer (PU; 4
females, 21 males) and 36 gastric cancer cases (GC; 11
females, 25 males). The median age among NUD subjects
was 37 years (Range 7–82), among PU cases it was
41.5 years (Range 19–85) and among GC cases the median
age was 60 years (Range 30–75).
Patient sampling
Informed consent was obtained before biopsy sampling.
Biopsy specimens were obtained from the antral region of
the stomach. In 97 of the 235 subjects, additional sampling
was performed for assessment of multiple strain infection.
Biopsy specimens in these patients were taken from the
antrum (A), pylorus (P), body (B) and cardia (C). Serum
samples from 118 patients were studied for the presence of
anti-CagA antibodies.
Bacterial strains
Homogenized biopsy specimens were cultured on Helico-
bacter pylori-specific agar (HPSPA) medium containing
the appropriate antibiotic concentrations (8 mg/l ampho-
tericin B, 5 mg/l trimetoprim, 6 mg/l vancomycin). Plates
were incubated under microaerophilic conditions at 37°C
for 3–5 days. The cultured bacteria were then harvested
and identified as Hp on the basis of biochemical and
microbiological assays and Gram staining.
DNA extraction and gene-specific PCR
Hp isolates were harvested from agar plates in phosphate-
buffer saline (PBS; pH 7.2) and stored at –20°C until DNA
extraction. Chromosomal DNA was extracted using a
standard protocol. Briefly, washed bacteria were centri-
fuged at 3300 rcf for 5 min, and the bacterial pellets dried,
resuspended in Solution I (50 mM NaOH) and boiled for
20 min. The suspension was then centrifuged at 3300 rcf
for 5 min followed by the addition of Solution II (1 M
Tris–HCl) and a second centrifugation at 800 rcf for
10 min. The supernatant was then transferred to a new tube
and stored at –20°C until further use. The identity of the
isolated Hp strains was confirmed by means of PCR
analysis of the conserved ureC gene. Gene-specific PCR
analyses were performed using the published primer pairs
123
Dig Dis Sci (2008) 53:925–932
listed in Table 1; the primers and PCR conditions have
been described elsewhere [4, 5, 12, 14, 15]. Each PCR
analysis was repeated for confirmation.
PCR-restriction fragment length polymorphism analysis
of the cagA 30 variable region
Restriction fragment Length polymorphism (RFLP) anal-
ysis was performed on the variable 1100-nt fragment of the
30 end of the cagA gene following PCR amplification.
Samples (10 ll) of the amplified fragments were digested
with 10 U of HaeIII restriction enzyme for 3 h at 37°C and
the restriction profiles visualized on 1.5% agarose gels.
Sequencing and alignment of the 30 variable region
of the cagA gene
One 30 terminal end amplicon from each RFLP category was
purified using the PCR Clean-up kit (Roche, Germany)
according to the manufacturer’s instruction. The purified frag-
ments were sequenced using the PCR forward primer in an
automated sequencer. The obtained nucleotide sequences of
this region from seven different strains are deposited in Gen-
Bank under accession numbers DQ865226, DQ865227,
DQ865228, DQ865229, EF444936, EF444937, and EF444938,
respectively. These sequences were aligned with the corre-
sponding sequences available in the GenBank, and their
nucleotide similarity matrix was created using the BioEdit
SEQUENCE ALIGNMENT EDITOR programme (ver 5.0.9). The phy-
logenetic tree was drawn using the CLUSTAL X programme (ver.
1.8) via the bootstrap neighbor joining method. The seed was set
at an odd number and the number of replicates at 500 ([100).
Western blotting assay for detection of anti CagA
antibodies
Serum samples from 118 subjects were analysed for the
presence of anti-CagA antibodies using the Helicoblot 2.1
Western Blotting kit (Genelabs Diagnostics, Singapore,
Republic of Singapore). Blotting was performed according
to the manufacturer’s instructions.
Prevalence of cagA in Asia
The search strategy consisted of extracting pertinent
information from the PubMed database of the National
Library of Medicine using the key search words Helico-
bacter pylori, virulence markers and the name of each
country in Asia. Data presented here are those available in
PubMed.
Dig Dis Sci (2008) 53:925–932 927

Table 1 List of primers

Gene (accession Primer Primer sequence (50 ?30 ) PCR product Nucleotide
number) size (bp) location

ureC (M60398) Forward ggataagcttttaggggtgttagggg 294 1289–1584

Reverse gcttactttctaacactaacgcgc
cag350 (L117714) Forward gataacaggcaagcttttgagg 349 1228–1576
Reverse ctgcaaaagattgtttggcaga
cag570 (X70039) Forward gatatagccactaccaccacc 570 1249–1819
Reverse ggaaatctttaatctcagttcgg
cag1100 Forward gcatcaaaagggaattgtctg 1059 2566–3624
(X70039) Reverse gcgtgtgtggctgttagtag

Statistical analysis genotypes (16.5%) exists, the majority of patients (78.4%)

SPSS package v.11.5 (SPSS, Chicago, IL) was used for
statistical analysis. Fisher’s exact probability test or the
chi-square test was applied for determining any existing
associations between categorical variables, with a P value
of less than 0.05 indicating statistical significance.
Results
cagA gene status and its clinical significance among Hp
strains isolated from single biopsy samples
Published primers for the conserved 50 terminal region of
cagA gene (F1, B1 primers) amplified a 350-bp fragment in
90.6% of the 235 isolated Hp strains from single biopsy
specimen (Tables 2, 3). Negative cases were tested twice to
confirm the obtained results. Statistical analysis revealed
that there was no association between amplification of the 50
terminal fragment of the cagA gene and clinical outcomes.
Genotyping studies on different locations of the cagA
gene showed that the prevalence of the conserved 570-bp
fragment (in the middle region of cagA gene) and the 30
terminal region (1100 bp fragment) in the whole study
population was 57.6 and 89%, respectively, without any
statistical association with clinical manifestations.
cagA gene status among Hp strains isolated from
multiple biopsy specimens
Multiple sampling in 97 patients indicated that although
multiple strain infection with cagA-positive and -negative
harbour all cagA-positive strains (Table 2).
PCR-RFLP and sequence analysis of the cagA 30
variable region
The PCR-RFLP (restriction with HaeIII) analysis revealed
seven different RFLP patterns in 97 Hp strains that were
examined (data not shown). Frequencies for these seven
patterns were 41.2, 18.6, 8.2, 7.2, 5.2, 4.1 and 3.1%,
respectively; these were subsequently labeled Iran-1 to
Iran-7, respectively. One PCR product from each RFLP
pattern was sequenced and their nucleotide sequences
compared with specific sequences reported in the GenBank
from different geographic locations. Sequencing created no
clustering for the Iranian strains, and the existing sequence
disparity placed them inter-dispersed between strains from
the rest of the world (Fig. 1, Table 4).
Detection of anti-CagA antibodies and their association
with cagA gene and clinical outcomes
Serum samples from 118 of the 235 patients who were
included in genotyping studies were studied for the
presence of anti-CagA antibodies by means of Western
blotting. The total frequency of CagA sero-positivity was
90.7% (Table 5). The presence of anti-CagA antibodies
showed an association with clinical manifestations when
the patients were categorized into three groups – NUD,
PU and GC (P \ 0.05). High-risk individuals, including
GC and PU patients, were strongly associated with the
presence of anti-CagA antibodies as these two groups did

Table 2 Frequency of
cagA gene (350 bp) Clinical groups Total no. (%)
Helicobacter pylori (Hp) cagA
genotypes in patients with NUD [n (%)] PU [n (%)] GC [n (%)]
different clinical outcomes who
underwent two biopsy sampling Single biopsy (n = 235) + 155 (89.1) 24 (96) 34 (94.4) 213 (90.6)
procedures Multiple biopsy (n = 97) All+ 50 (74.6) 5 (71.4) 21 (91.3) 76 (78.4)
All– 5 (7.5) 0 0 5 (5.2)
NUD, Non-ulcer dyspepsia; PU, +/– 12 (17.9) 2 (28.6) 2 (8.7) 16 (16.5)
peptic ulcer; GC, gastric cancer

123
928 Dig Dis Sci (2008) 53:925–932

Table 3 Amplified cagA gene fragments. NUD Non-ulcer dyspepsia, PU peptic ulcer, GC gastric cancer

A- Schematic view of annealing site for each primer pair on cagA gene based on J99 Hp strain

cag350 cag570 cag1100

1 3505

B- The frequency of each PCR in different clinical group

Studied cag350 % cag570 % cag1100 %

cases (157-505) (727-1297) (2045-2880)

NUD 89.1 61.4 83.3

PUD 96 69.6 90.9

GC 94.4 39.4 93.9

Total 90.6 59.1 89

not have any anti-CagA sero-negative cases. Statistical
analysis revealed that there is a significant association
between the positive genotype of the 50 terminal region
of the cagA gene and the presence of anti-CagA anti-
bodies (P \ 0.05), although there were some
discrepancies between the two applied tests. The sensi-
tivity and the accuracy of the cagA PCR on the 50
terminal region were 95.3 and 89%, respectively when
Western blotting against the CagA protein was used as
the gold standard test.
99
52
52
60
86
99
95
99
85
Fig. 1 Phylogenetic tree of cagA nucleotide sequences. Bootstrap
values greater than 50 are illustrated
cagA genotyping studies in Asia
A vast heterogeneity among Hp strains isolated from dif-
ferent parts of Asia has been reported in the literature
(Table 6). Of the countries listed in Table 6, Israel and
Jordan demonstrate the lowest cagA prevalence in the
region, while Iran ranks just under China and Japan in
showing the highest cagA prevalence of Hp strains in Asia.
Discussion
Japan-1
The reported high prevalence of the cagA gene among East
China
NCTC11637
Asian Hp strains places a question-mark on the value of
Iran-4
cagA genotyping as a tool for predicting the related clinical
Iran-5
outcomes in this part of the world [10, 11, 39, 40]. In
Iran-6 contrast, in Western countries, cagA genotyping has been
Iran-7 reported to be indicative of severe clinical manifestations
Iran-1 [41–43]. Given that Iran is located in the Middle East and
Japan-2 Asian populations are showing rising rates of gastric can-
Iran-3 cer, it is of clinical interest to explore the potential of Hp
Korea virulence markers in predicting the associated clinical
Austria outcomes. However, as the value of cagA genotyping is
Iran-2 open to dispute based on reports from different parts of the
Colombia world, we decided to study the frequency of the cagA gene
J99
in isolated Hp strains and the presence of specific anti-
CagA antibodies among Iranian Hp-infected patients by
means of molecular and serological assays.

123
Dig Dis Sci (2008) 53:925–932 929

Table 4 Nucleotide sequence identity matrix among 30 terminal region of cagA genes from different parts of the world
Iran Japan China Korea Austria NCTC11637 Colombia J99
1 2 3 4 5 6 7 1 2

Iran 1 1 0.749 0.913 0.876 0.854 0.838 0.829 0.776 0.837 0.784 0.900 0.916 0.861 0.383 0.820
2 1 0.717 0.722 0.702 0.668 0.678 0.630 0.656 0.638 0.716 0.717 0.710 0.384 0.719
3 1 0.880 0.855 0.822 0.819 0.786 0.810 0.787 0.934 0.946 0.843 0.390 0.832
4 1 0.907 0.806 0.841 0.793 0.781 0.801 0.864 0.875 0.897 0.390 0.831
5 1 0.789 0.820 0.777 0.771 0.784 0.834 0.850 0.928 0.399 0.808
6 1 0.936 0.717 0.835 0.722 0.823 0.825 0.794 0.355 0.762
7 1 0.729 0.833 0.735 0.817 0.820 0.822 0.370 0.786
Japan 1 1 0.707 0.967 0.795 0.780 0.778 0.369 0.725
2 1 0.712 0.807 0.818 0.773 0.356 0.743
China 1 0.791 0.784 0.788 0.371 0.716
Korea 1 0.944 0.833 0.393 0.858
Austria 1 0.845 0.390 0.842
NCTC11637 1 0.396 0.802
Colombia 1 0.378
J99 1
Iran-1 Iran-2 Iran-3 Iran-4 Iran-5 Iran-6 Iran-7 Japan-
Accession Numbers: DQ865229, DQ865228, DQ865226, DQ865227, EF444937, EF444938, EF444936,
1
DQ091000, Japan-2AF083352, ChinaDQ306710, KoreaAF202973, Austria AY884089, NCTC11637AB015416, ColombiaAB057101, J99
NC000921

Table 5 Association between the cagA genotype and the presence of anti-CagA antibodies
Anti-CagA antibodies cagA gene status Clinical groups Total [n (%)]
NUD [n (%)] PU [n (%)] GC [n (%)]

Presence + 61 (89.7) 7 (100) 31 (96.9) 99 (92.5)

– 7 (10.3) 0 1 (3.1) 8 (7.5)
Absence + 8 (72.7) 0 0 8 (72.7)
– 3 (27.3) 0 0 3 (27.3)

Serological assays for detecting Hp infection are the
most appropriate non-invasive tests which are capable of
demonstrating the presence of various specific Hp viru-
lence markers, including the VacA and CagA proteins.
Western blotting, in particular, is the most reliable assay in
visualizing specific Ag–Ab complexes [44].
However, the use of gene-specific primers for detecting
the presence of virulence marker genes in the Hp genome is
still the first and the most important step in epidemiologic
studies. A previous Hp genotyping study from Iran [36]
showed that only 44% of the studied Hp strains were cagA
gene-positive. These investigators used a different pair of
primers from the ones used in the current study, with the
former designed for the 50 terminal region of the cagA gene
(D008, D009) and subsequently reported to have a unreli-
able efficiency [45, 46]. Our genotyping study revealed that
the absolute majority (about 91%) of Iranian Hp strains are,
in fact, cagA-positive, which was further confirmed by the
detection of host anti-CagA antibodies, similar to reports
from East Asia [19, 24, 47].
The presence of anti-CagA antibodies showed an asso-
ciation with clinical outcomes when the subjects were
divided into NUD, PU and GC disease categories. This
finding supports data indicating that CagA protein could be
a detection marker for Hp-related severe gastrointestinal
disorders.
Our Western blot analysis revealed a high overall rate of
sero-positivity towards the CagA protein among Iranian
Hp-infected individuals (90.7%), with most of the studied
individuals showing a correlation between the presence of
the anti-CagA antibody and the presence of the cagA gene.
This resulted in an accuracy of 86.6% for CagA sero-
positivity using the HelicoBlot2.1 kit and 89% for cagA
gene positivity by PCR analysis on the 50 terminal
fragment.
Due to the similar frequency of anti-CagA antibodies and
their association with severe clinical manifestations, tracing
CagA protein in infecting Hp strains using serological assays
can be a suitable approach to predicting the outcome of the
infection. Cover et al. [48] used an enzyme-linked

123
930 Dig Dis Sci (2008) 53:925–932

Table 6 Helicobacter pylori cagA gene and protein status in different geographic regions of Asia
Country Patients cagA gene status [reference] Anti-CagA antibody [reference]

Japan Gastric cancer 100% 87–94%

Controls 92.3% [16]
[17]
China PUD & NUD 98% [18] –
Iran NUD, PU, GC 90.6% 90.7%
Current study Current study
Korea PUD 90.6–98.2%
Chronic gastritis 92.3% –
[19]
India Dyspeptic Hp infected 89% [20] –
Hong Kong Hp infected 88.9% [21] –
Kuwait Unknown 87% [22] –
Korea NUD 85.7–91.4%
PUD 87–100% –
[23]
Taiwan GC, PU, gastritis 83% [24] –
Taiwan PU & gastritis 79–92% [25] –
Turkey PUD & NUD 78% [26] 79–100% [27]
Malaysia Hp infected 76.6% [28] –
China GI disorders 71.4% [29] –
India Dyspeptic-gastritis patients 70% [30] –
Bangladesh PUD 75% 71–86% [31]
NUD 55%
[32]
Bahrain NUD & PUD 59% [33] 57.9% [34]
Turkey PUD & NUD 46% [35] –
Iran NUD, DU, GC 44% [36] –
Jordan Consecutive patients 26.4% [37] –
Israel Symptomatic children 25.5% [38] –

immunosorbent assay (ELISA) to detect anti-CagA anti-
bodies and their correlation with the presence of the cagA
gene. These researchers found discrepancies between the
results of the ELISA and the molecular detection of the cagA
gene, especially in patients infected with cagA-negative Hp
strains. These sero-false positive results can be explained by
the presence of mixed infections with both CagA-positive
and CagA-negative Hp strains, which may be undetectable
by PCR in a group of patients. On the other hand, false
negative results in serology may indicate: (1) failure of gene
translation into an immunogenic protein and thus the lack of
antibody production; (2) nucleotide variation in the non-
conserved 30 terminal region of the cagA gene, resulting in a
protein conformation different from that shown by Western
blotting kit [49].
PCR-RFLP analysis of the 30 terminal region has been
previously used for cagA typing [50, 51]. Li et al. [50]
reported that RFLP analysis is a reliable method to detect
multiple Hp infections and suggested that it might be useful
as a primary approach for the identification of specific
H. pylori strains. In this study, PCR-RFLP analysis of this
region revealed genetic diversity within our limited popu-
lation and allowed us to identify typical sequences from
each subtype and subsequently sequence them. The
sequencing analysis and identity matrix of the cagA gene
from seven Iranian subtypes revealed that this region is
variable and different not only in terms of cagA gene
sequences from different geographic locations but also
within our own collection of Hp strains. The sequence
comparison demonstrated that the most heterogenic
sequence belongs to a Colombian strain from South
America, which stands completely apart. The illustrated
phylogenetic tree confirmed this heterogeneity (Fig. 1).
Some reports have indicated that multiple biopsy sam-
pling can be a suitable approach to prevent misleading
predictions about the actual prevalence of Hp genotypes in
the studied group of strains [52, 53]. Our study also con-
firms that in order to determine the accurate frequency of

123
Dig Dis Sci (2008) 53:925–932
the infecting genotypes, multiple sampling should be
performed.
Studies from Asian countries have confirmed that there
is a vast difference in the frequency of cagA-positive
strains in the region. Taken together, our search indicates
that countries near Europe, such as those located in West
Asia, possess a lower frequency of cagA-positive strains,
which is similar to the frequency of European Hp strains. In
contrast, the frequency of cagA-positive Hp strains is
highest among East Asian countries. Iran, unlike her
neighbouring countries, can be found among those coun-
tries showing the highest prevalence of cagA-positive Hp,
such as China and Japan. Such a high frequency calls for
additional subtyping of the cagA gene for clinical screening
purposes. We report here the detection of anti-CagA anti-
bodies as highly efficient CagA typing method. This
marker showed an association with Hp-related clinical
manifestations in Iranian populations. In other words,
molecular studies should consider anti-CagA antibodies as
a potential indicator of an immunogenic functionally active
CagA protein which, in turn, may be associated with a
more severe mucosal inflammation and, as such, may be a
more reliable factor for diagnosing Hp-related clinical
manifestations in highly Hp-prevalent countries such as
Iran.
Acknowledgements The authors would like to thank Masoumeh
Doraghi, Mohammad Hamid, Maryam Zohari, Masoud Ghaffarpour
and Nafiseh Nafisi from the HPRG (Helicobacter pylori Research
Group) at the Biotechnology Research Center of Pasteur Institute and
the clinical staff at Cancer Research Center of Tehran University of
Medical Sciences, and Gastroenterology Department of Amiralam
and Mofarrah Hospitals for their sincere technical and clinical sup-
port.This study was funded by a generous grant from the Deputy of
Research and Technology of the Iranian Ministry of Health and
Medical Education in support of international research collaborations.
References
1. Blaser MJ (1992) Hypothesis on the pathogenesis and natural
history of Helicobacter pylori induced inflammation. Gastroen-
terology 102:720–727
2. Parsonnet J, Hansen S, Rodriguez L, Gelb AB, Warnke RA,
Jellum E, Orentreich N, Vogelman JH, Friedman GD (1994)
Helicobacter pylori infection and gastric Lymphoma. N Engl J
Med 330:1267–1271
3. Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi
S, Yamakido M, Taniyama K, Sasaki N, Schlemper RJ (2001)
Helicobacter pylori infection and the development of gastric
cancer. N Engl J Med 345:784–789
4. Covacci A, Censini S, Bugnoli M, Petracca R, Burroni D, Mac-
chia G, Massone A, Papini E, Xiang Z, Figura N, Rappuoli R
(1993) Molecular characterization of the 128-kDa immunodom-
inant antigen of Helicobacter pylori associated with cytotoxicity
and duodenal ulcer. Proc Natl Acad Sci USA 90:5791–5795
5. Tumuru M, Cover T, Blaser M (1993) Cloning and expression of
a high molecular mass major antigen of Helicobacter pylori:
931
evidence of linkage to cytotoxin production. Infect Immun
61:1799–1809
6. Cover T, Dooley C, Blaser M (1990) Characterization of and
human serologic response to proteins in Helicobacter pylori broth
culture supernatants with vacuolating cytotoxin activity. Infect
Immun 58:603–610
7. Weel JF, van der Hulst RW, Gerrits Y, Roorda P, Feller M,
Dankert J, Tytgat GN, van der Ende A (1996) The interrela-
tionship between cytotoxin- associated gene A, vacuolating
cytotoxin, and Helicobacter pylori- related diseases. J Infect Dis
173:1171–1175
8. Rudi J, Kolb C, Maiwald M, Kuck D, Sieg A, Galle A, Stremmel
W (1998) Diversity of Helicobacter pylori vacA and cagA genes
and relationship to VacA and CagA protein expression, cytotoxin
production, and associated diseases. J Clin Microbiol 36:944–948
9. Yamaoka Y, Kodama T, Kashima K, Graham DY, Sepulveda AR
(1998a) Variants of the 30 region of the cagA gene in Helico-
bacter pylori isolates from patients with different H. pylori-
associated diseases. J Clin Microbiol 36:2258–2263
10. Ito Y, Azuma T, Ito S, Miyaji H, Hirai M, Yamazaki Y, Sato F,
Kato T, Kohli Y, Kuriyama M (1997) Analysis and typing of the
cagA gene from cagA-positive strains of Helicobacter pylori
isolated in Japan. J Clin Microbiol 35:1710–1714
11. Miehlke S, Kibler K, Kim JG, Figura N, Small SM, Graham DY,
Go MF (1996) Allelic variation in the cagA gene of Helicobacter
pylori obtained from Korea compared to the United States. Am J
Gastroenterol 91:1322–1325
12. Pan ZJ, van der Hulst RW, Feller M, Xiao SD, Tytgat GN,
Dankert J, van der Ende A (1997) Equally high prevalence of
infection with cagA positive Helicobacter pylori in Chinese
patients with peptic ulcer disease and those with chronic gastritis-
associated dyspepsia. J Clin Microbiol 35:1344–1347
13. van der Ende A, Pan ZJ, Bart A, van der Hulst RW, Feller M,
Xiao SD, Tytgat GN, Dankert J (1998) cagA positive Helico-
bacter pylori population in China and Netherlands are distinct.
Infect Immun 66:1822–1826
14. Labigne A, Cussac V, Courcoux P (1991) Shuttle cloning and
nucleotide sequencing of Helicobacter genes responsible for
urease activity. J Bacteriol 173:1920–1931
15. Evans DG, Queiroz DM, Mendes EN, Evans DJ Jr (1998) Heli-
cobacter pylori cagA status and s and m alleles of vacA in isolates
from individuals with a variety of Helicobacter pylori associated
gastric diseases. J Clin Microbiol 36:3435–3437
16. Maeda S, Kanai F, Ogura K, Yoshida H, Ikenoue T, Takahashi
M, Kawabe T, Shiratori Y, Omata M (1997) High seropositivity
of Anti-CagA antibody in Helicobacter pylori-infected patients
irrelevant to peptic ulcers and normal mucosa in Japan. Dig Dis
Sci 42:1841–1847
17. Shimoyama T, Fukuda S, Tanaka M, Mikami T, Saito Y, Mu-
nakata A (1997) High prevalence of the CagA-positive
Helicobacter pylori strains in Japanese asymptomatic patients
and gastric cancer patients. Scand J Gastroenterol 32:465–468
18. Wang J, van Doorn LJ, Robinson PA, Ji X, Wang D, Wang Y, Ge
L, Telford JL, Crabtree JE (2003) Regional variation among vacA
alleles of Helicobacter pylori in China. J Clin Microbiol
41:1942–1945
19. Park SM, Park J, Kim JG, Yoo BC (2001) Relevance of vacA
genotypes of Helicobacter pylori to cagA status and its clinical
outcome. Korean J Intern Med 16:8–13
20. Chaudhuri S, Chowdhury A, Datta S, Mukhopadhyay AK,
Chattopadhya S, Saha DR, Dhali G, Santra A, Nair GB, Bhat-
tacharya S, Berg DE (2003) Anti-Helicobacter pylori therapy in
India: differences in eradication efficiency associated with par-
ticular alleles of vacuolating cytotoxin (vacA) gene. J
Gastroenterol Hepatol 18:190–195
123
932
21. Wong BC, Yin Y, Berg DE, Xia HH, Zhang JZ, Wang WH,
Wong WM, Huang XR, Tang VS, Lam SK (2001) Distribution of
distinct vacA, cagA and iceA alleles in Helicobacter pylori in
Hong Kong. Helicobacter 6:317–324
22. Al Qabandi A, Mustafa AS, Siddique I, Siddigue I, Khajah AK,
Madda JP, Junaid TA (2005) Distribution of vacA and cagA
genotypes of Helicobacter pylori in Kuwait. Acta Trop 93:283–288
23. Park SM, Park J, Kim JG, Cho HD, Cho JH, Lee DH, Cha YJ
(1998) Infection with Helicobacter pylori expressing the cagA
gene is not associated with an increased risk of developing peptic
ulcer diseases in Korean patients. Scand J Gastroenterol 33:923–
927
24. Lin HJ, Perng CL, Lo WC, Wu CW, Tseng GY, Li AF, Sun IC,
Ou YH (2004) Helicobacter pylori cagA, iceA and vacA geno-
types in patients with gastric cancer in Taiwan. World J
Gastroenterol 10:2493–2497
25. Perng CL, Lin HJ, Sun IC, Tseng GY (2003) Helicobacter pylori
cagA, iceA and vacA status in Taiwanese patients with peptic
ulcer and gastritis. J Gastroenterol Hepatol 18:1244–1249
26. Saribasak H, Salih BA, Yamaoka Y, Sander E (2004) Analysis of
Helicobacter pylori genotypes and correlation with clinical out-
come in Turkey. J Clin Microbiol 42:1648–1651
27. Abasiyanik MF, Sander E, Salih BA (2002) Helicobacter pylori
anti-CagA antibodies: prevalence in symptomatic and asymp-
tomatic subjects in Turkey. Can J Gastroenterol 16:527–532
28. Tan HJ, Rizal AM, Rosmadi MY, Goh KL (2005) Distribution of
Helicobacter pylori cagA, cagE and vacA in different ethnic
groups in Kuala Lumpur, Malaysia. J Gastroenterol Hepatol
20:589–594
29. Chang YH, Wang L, Lee MS, Cheng CW, Wu CY, Shiau MY
(2006) Genotypic characterization of Helicobacter pylori cagA
and vacA from biopsy specimens of patients with gastroduodenal
diseases. Mt Sinai J Med 73:622–626
30. Kauser F, Hussain MA, Ahmed I, Srinivas S, Devi SM, Majeed
AA, Rao KR, Khan AA, Sechi LA, Ahmed N (2005) Comparing
genomes of Helicobacter pylori strains from the high-altitude
desert of Ladakh, India. J Clin Microbiol 43:1538–1545
31. Nessa J, Chart H, Owen RJ, Drasar B (2001) Human serum
antibody response to Helicobacter pylori whole cell antigen in an
institutionalized Bangladeshi population. J Appl Microbiol
90:68–72
32. Rahman M, Mukhopadhyay AK, Nahar S, Datta S, Ahmad MM,
Sarker S, Masud IM, Engstrand L, Albert MJ, Nair GB, Berg DE
(2003) DNA-level characterization of Helicobacter pylori strains
from patients with overt disease and with benign infections in
Bangladesh. J Clin Microbiol 41:2008–2014
33. Bindayna KM, Al Baker WA, Botta GA (2006) Detection of
Helicobacter pylori cagA gene in gastric biopsies, clinical iso-
lates and faeces. Indian J Med Microbiol 24:195–200
34. Bindayna KM, Al Baker WA (2000) Use of immunoblot assay to
define serum antibody patterns associated with Helicobacter
pylori infection from Bahrain. Clin Microbiol Infect 6:218–220
35. Baglan PH, Srinay E, Ahmed K, Ozkan M, Bozday G, Bozday
AM, Ozden A (2006) Turkish isolates of Helicobacter pylori
belong to the middle eastern genotypes. Clin Microbiol Infect Dis
12:97–98
36. Siavoshi F, Malekzadeh R, Daneshmand M, Ashktorab H (2005)
Helicobacter pylori endemic and gastric disease. Dig Dis Sci
50:2075–2080
37. Nimri LF, Matalka I, Bani Hani K, Ibrahim M (2006) Helico-
bacter pylori genotypes identified in gastric biopsy specimens
from Jordanian patients. BMC Gastroenterol 6:27
38. Benenson S, Halle D, Rudensky B, Faber J, Schlesinger Y,
Branski D, Rabinowitz N, Wilschanski M (2002) Helicobacter
pylori genotypes in Israeli children: the significance of geogra-
phy. J Pediatr Gastroenterol Nutr 35:680–684
123
Dig Dis Sci (2008) 53:925–932
39. Wang HJ, Kuo CH, Yeh AA, Chang PC, Wang WC (1998)
Vacuolating toxin production in clinical isolates of Helico-
bacter pylori with different vacA genotypes. J Infect Dis
178:207–212
40. Yamaoka Y, Kodama T, Kita M, Imanishi J, Kashima K, Graham
DY (1998b) Relationship of vacA genotypes of Helicobacter
pylori to cagA status, cytotoxin production, and clinical outcome.
Helicobacter 4:241–253
41. Blaser MJ (1995) Intrastrain differences in Helicobacter pylori: a
key question in mucosal damage? Ann Med 27:559–563
42. Rudi J, Kolb C, Maiwald M, Zuna I, von Herbay A, Galle PR,
Stremmel W (1997) Serum antibodies against Helicobacter pylori
VacA and CagA are associated with increased risk for gastric
adenocarcinoma. Dig Dis Sci 42:1652–1659
43. Takata T, Fujimoto S, Anzai K, Shirotani T, Okada M, Sawae Y,
Ono J (1998) Analysis of the expression of CagA and VacA and
the vacuolating activity in 167 Helicobacter pylori isolates from
patients with either peptic ulcers or non-ulcer dyspepsia. Am J
Gastroenterol 93:30–34
44. von Wulffen H (1992) An assessment of serological tests for
detection of Helicobacter pylori. Eur J Clin Microbiol Infect Dis
11:577–582
45. Figura N, Vindigni C, Covacci A, Presenti L, Burroni D, Vernillo
R, Banducci T, Roviello F, Marrelli D, Biscontri M, Kristodhullu
S, Gennari C, Vaira D (1998) cagA positive and negative Heli-
cobacter pylori strains are simultaneously present in the stomach
of most patients with non-ulcer dyspepsia: relevance to histo-
logical damage. Gut 42:772–778
46. Peters TM, Owen RJ, Slater E, Varea R, Teare EL, Saverymuttu
S (2001) Genetic diversity in the Helicobacter pylori cag path-
ogenicity island and effect on expression of anti-CagA antibody
in UK patients with dyspepsia. J Clin Pathol 54:219–223
47. Perng CL, Lin HJ, Lo WC, Tseng GY, Sun IC, Ou YH (2004)
Genotypes of Helicobacter pylori in patients with peptic ulcer
bleeding. World J Gastroenterol 10:602–605
48. Cover TL, Glupczynski Y, Lage AP, Burette A, Tummuru MK,
Perez-Perez GI, Blaser MJ (1995) Serologic detection of infec-
tion with cagA + Helicobacter pylori strains. J Clin Microbiol
33:1496–1500
49. Maeda S, Yoshida H, Ogura K, Yamaji Y, Ikenoue T, Mitsushima
T, Tagawa H, Kawaguchi R, Mori K, Mafune K, Kawabe T,
Shiratori Y, Omata M (2000) Assessment of gastric carcinoma
risk associated with Helicobacter pylori may vary depending on
the antigen used: CagA specific enzyme-linked immunosorbent
assay (ELISA) versus commercially available H. pylori ELISAs.
Cancer 88:1530–1535
50. Li C, Ha T, Chi DS, Ferguson DA Jr, Jiang C, Laffan JJ, Thomas
E (1997) Differentiation of Helicobacter pylori strains directly
from gastric biopsy specimens by PCR-based restriction fragment
length polymorphism analysis without culture. J Clin Microbiol
35:3021–3025
51. Tanahashi T, Kita M, Kodama T, Sawai N, Yamaoka Y, Mits-
ufuji S, Katoh F, Imanishi J (2000) Comparison of PCR-
restriction fragment length polymorphism analysis and PCR-
direct sequencing methods for differentiating Helicobacter pylori
ureB gene variants. J Clin Microbiol 38:165–169
52. Chen XJ, Yan J, Shen YF (2005) Dominant cagA/vacA genotypes
and coinfection frequency of H. pylori in peptic ulcer or chronic
gastritis patients in Zhejiang Province and correlations among
different genotypes, coinfection and severity of the diseases. Chin
Med J 118:460–467
53. Figueiredo C, van Doorn LJ, Nogueira C, Soares JM, Pinho C,
Figueira P, Ouint WG, Carneiro F (2001) Helicobacter pylori
genotypes are associated with clinical outcome in Portuguese
patients and show a high prevalence of infections with multiple
strains. Scand J Gastroenterol 36:128–135
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.