Article

Identification of New Activators of Mitochondrial

Fusion Reveals a Link between Mitochondrial
Morphology and Pyrimidine Metabolism
Graphical Abstract Authors
Laia Miret-Casals, David Sebastián,
José Brea, ..., M. Isabel Loza,
Fernando Albericio, Antonio Zorzano

Correspondence
albericio@ub.edu (F.A.),
antonio.zorzano@irbbarcelona.org (A.Z.)

In Brief
Miret-Casals et al. identify leflunomide as
an activator of MFN1/2 expression and
demonstrate a connection between
pyrimidine metabolism and mitochondrial
fusion. This connection provides new
avenues toward the treatment of
diseases linked to mitochondrial
dysfunction.

Highlights
d High-throughput screening identifies leflunomide as an
activator of MFN2 expression

d Leflunomide induces an MFN1/2-dependent mitochondrial

fusion by inhibiting DHODH

d Disruption of functional interaction DHODH-complex III

promotes mitochondrial fusion

d Inhibition of de novo synthesis of pyrimidines is coupled to

mitochondrial fusion

Miret-Casals et al., 2018, Cell Chemical Biology 25, 268–278

March 15, 2018 ª 2017 Elsevier Ltd.
https://doi.org/10.1016/j.chembiol.2017.12.001
 Cell Chemical Biology

Article

Identification of New Activators of Mitochondrial

Fusion Reveals a Link between Mitochondrial
Morphology and Pyrimidine Metabolism
Laia Miret-Casals,1 David Sebastián,2,3,4 José Brea,5 Eva M. Rico-Leo,6 Manuel Palacı́n,2,3,7
Pedro M. Fernández-Salguero,6 M. Isabel Loza,5 Fernando Albericio,1,8,9,* and Antonio Zorzano2,3,4,10,*
1Department of Organic Chemistry, University of Barcelona, Barcelona Science Park (PCB), Barcelona 08028, Spain
2Institutefor Research in Biomedicine (IRB Barcelona), The Barcelona Institute of Science and Technology, Barcelona 08028, Spain
3Departament de Bioquı́mica i Biomedicina Molecular, Universitat de Barcelona, Barcelona 08028, Spain
4CIBER de Diabetes y Enfermedades Metabólicas Asociadas (CIBERDEM), Instituto de Salud Carlos III, Madrid 28029, Spain
5Grupo BioFarma–Unidad de Evaluación de Actividades Farmacológicas de Compuestos Quı́micos, Universidad de Santiago de

Compostela, Santiago de Compostela 15782, Spain

6Departamento de Bioquı́mica y Biologı́a Molecular y Genética, Facultad de Ciencias, Universidad de Extremadura, Badajoz 06006, Spain
7Centro de Investigación Biomédica en Red de Enfermedades Raras, Barcelona 08028, Spain
8Networking Centre on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN), Barcelona Science Park, Barcelona 08028, Spain
9School of Chemistry & Physics, University of KwaZulu-Natal, Durban 4001, South Africa
10Lead Contact

*Correspondence: albericio@ub.edu (F.A.), antonio.zorzano@irbbarcelona.org (A.Z.)

https://doi.org/10.1016/j.chembiol.2017.12.001

SUMMARY (MFN2) and Mitofusin 1 (MFN1) (Rojo et al., 2002), localized

Mitochondria are dynamic organelles that produce
most of the cellular ATP, and are involved in many
other cellular functions such as Ca2+ signaling, dif-
ferentiation, apoptosis, cell cycle, and cell growth.
One key process of mitochondrial dynamics is mito-
chondrial fusion, which is catalyzed by mitofusins
(MFN1 and MFN2) and OPA1. The outer mitochon-
drial membrane protein MFN2 plays a relevant role
in the maintenance of mitochondrial metabolism,
insulin signaling, and mutations that cause neuro-
degenerative disorders. Therefore, modulation of
proteins involved in mitochondrial dynamics has
emerged as a potential pharmacological strategy.
Here, we report the identification of small molecules
by high-throughput screen that promote mito-
chondrial elongation in an MFN1/MFN2-dependent
manner. Detailed analysis of their mode of action
reveals a previously unknown connection between
pyrimidine metabolism and mitochondrial dynamics.
Our data indicate a link between pyrimidine biosyn-
thesis and mitochondrial dynamics, which maintains
cell survival under stress conditions characterized by
loss of pyrimidine synthesis.
INTRODUCTION
Mitochondrial fusion is a complex process that leads to the
separate fusion of the outer and the inner mitochondrial mem-
branes of neighbor mitochondria. The proteins involved in
fusion in mammals are the two highly conserved dynamin-
related guanosine triphosphatases (GTPases) Mitofusin 2
in the outer mitochondrial membrane, and Optic atrophy 1
(OPA1) (Olichon et al., 2003), localized in the inner mitochon-
drial membrane. Mitochondrial fusion is balanced by fission,
which is catalyzed by other set of proteins. Mutations in
MFN2 or OPA1 cause disease in humans. Thus, MFN2 muta-
tions are responsible for the development of Charcot-Marie-
Tooth neuropathy, sometimes linked to visual impairment
(Rouzier et al., 2012; Verhoeven et al., 2006; Zuchner et al.,
2004, 2006). OPA1 mutations have been reported in patients
affected by autosomal dominant optic atrophy (ADOA) (Alex-
ander et al., 2000; Delettre et al., 2000). Some of these
OPA1 missense mutations are associated with altered mitoph-
agy and parkinsonism (Carelli et al., 2015). In addition to
ADOA, OPA1 mutations also cause a multi-systemic disorder
called ADOA plus syndrome, which results in severe myopathy
(Amati-Bonneau et al., 2008; Hudson et al., 2008). Further-
more, a deficient Mfn2 expression has been documented in
metabolic disorders, which includes type 2 diabetic patients,
obese or diabetic mice, and aged mice (Bach et al., 2003;
Liu et al., 2014; Schneeberger et al., 2013; Sebastián et al.,
2016). Evidence has also accumulated indicating that a defi-
cient Mfn2 expression in tissues is linked to the development
of obesity, insulin resistance, sarcopenia, and alterations
linked to aging (Schneeberger et al., 2013; Sebastián et al.,
2012, 2016). Overall, currently available data strongly docu-
ment that mitochondrial fusion proteins are novel pharmaco-
logical targets.
As a result of the growing number of potential therapeutic tar-
gets and the development of large compound libraries, the use of
high-throughput screening technologies is a powerful tool for
chemical biology research and drug discovery (Fernandes,
1998; Hertzberg and Pope, 2000; Moore and Rees, 2001). In
addition, cell-based screening has become a powerful method
in target identification and plays an important role in drug discov-
ery (Cooper et al., 2016; Mervin et al., 2016; Rocha et al., 2016).

268 Cell Chemical Biology 25, 268–278, March 15, 2018 ª 2017 Elsevier Ltd.

Mfn2 Activators
Mfn2 Luciferase
Promoter Gene
transcription
mRNA
Prestwick library
24 h
transcriptional activity
2.0
Mfn2 promoter
(Relative units)
1.5
1.0
0.5
0.0
C RA C1 C2 C3 C4 C5 C6 C7 C8 C9 C10 C11
Figure 1. Screening Strategy for the Identification of MFN2 Activators
Transcriptional activity of the human MFN2 promoter (luciferase reported gene) was measured in HeLa Mfn2P-14 cells incubated with 9-cis-retinoic acid (RA, as a
positive control) and with the Prestwick library compounds at 10 mM for 16 hr. Eleven positive hits were subjected to validation analysis, and data are shown in the
final panel. Data are mean ± SEM of five independent experiments performed in triplicate, and are expressed as relative to the control group. All the compounds
showed statistically significant differences compared with the control group at p < 0.001. C6 is leflunomide.
In some screening expeditions cell-based reporter gene assays
have been used to identify modulators of gene promoter activity,
leading to pharmacological development (Zorzano et al., 2012;
Campana et al., 2015; Kyo et al., 2008; Nemunaitis et al.,
2010). Here, we have developed and optimized a phenotype
high-throughput screen on HeLa cells by using a lumines-
cence-based gene expression to identify modulators of the
MFN2 promoter activity. This methodology has allowed us to
search for molecules that upregulate MFN2 expression and
induce mitochondrial fusion.
RESULTS AND DISCUSSION
High-Throughput Screening of MFN2 Activators
To find activators of MFN2 expression, we developed a pheno-
type-based high-throughput screen to monitor human MFN2
transcriptional activity. We generated a HeLa cell line that stably
expresses the reporter gene luciferase under the control of 2 kb
of human MFN2 promoter (Figure 1). For the screening, the Pre-
stwick Chemical Library, a US Food and Drug Administration
(FDA)-approved library of 1,120 compounds showing high
chemical and pharmacological diversity, as well as bioavailability
and safety in humans, was selected. Cells were incubated with
the library compounds at 10 mM for 16 hr and luciferase activity
was measured. Eleven compounds were found as positive hits,
and caused a marked stimulation of human MFN2 promoter
activity (Figure 1). Biochemical in vitro luciferase assays indi-
cated that none of the identified compounds acted as positive
modulators of luciferase activity itself (data not shown).
Luciferin Oxyluciferin
HO S N COOH HO O
S N
N S +N S
hν
translation Luciferase
protein
+ lysis buffer + luciferin
16 h 30 min
Controls Controls
Negative control
Positive Hit
Identification of Leflunomide as a Validated MFN2
Activator
To further validate the activity of the hits, we measured MFN2
mRNA in HeLa cells. Among all hits, leflunomide was identified
as the most active compound (Figures 2A and 2B), and its
concentration-dependent activity was similar to that reported
previously (Cherwinski et al., 1995b, 1995c; Greene et al.,
1995; Ruckemann et al., 1998). Thus, leflunomide showed
highest MFN2 promoter activity at 10 and 50 mM, in line with prior
studies (Cherwinski et al., 1995a, 1995b; Greene et al., 1995;
Ruckemann et al., 1998; Zielinski et al., 1995). Subsequent
experiments were carried out using leflunomide at 50 mM to
secure maximal biological effects.
Leflunomide also increased MFN1 mRNA levels in HeLa cells
(Figure 2B). To better understand the global effects of lefluno-
mide, we measured the expression of proteins involved in mito-
chondrial dynamics, including MFN2, MFN1, OPA1, DRP1, and
FIS1 in HeLa as well as in C2C12 muscle cells. Leflunomide
induced the expression of the mitochondrial fusion proteins
MFN2 and MFN1 in C2C12 muscle (Figure 2C) and in HeLa cells
(Figure S1B). In addition, the expression of short forms of OPA1,
which are involved in mitochondrial fragmentation (Duvezin-
Caubet et al., 2006), were slightly decreased (Figures S1A and
S1B). No changes were observed for porin, indicating that mod-
ulation of proteins involved in mitochondrial dynamics was not a
consequence of increased mitochondrial mass (Figures 2C and
S1B). In addition, leflunomide repressed the mitochondrial
fission protein DRP1, and FIS1 remained unaltered (Figures
S1A and S1B). We also assessed DRP1 phosphorylation in
Cell Chemical Biology 25, 268–278, March 15, 2018 269
 C Lef
A B C
Mfn2
O
* Mfn1

levels relative to control values)

H N 2.5

Effect of Leflunomide (mRNA

N
β-actin
2.0
O Porin
F3C 1.5 *
Leflunomide

levels relative to control values)

2.5 *

Effect of Leflunomide (protein

1.0
**
0.5 2.0

0.0 1.5
Mfn2 Mfn1
1.0

D C Lef 0.5

0.0
Mfn2 Mfn1 Porin

E F
20
(OCR, pmol/min x ug prot)

1.5 C
***
Oxygen consumpt ion
Mit. membrane potential

Lef
15
(relative units)

1.0
10

0.5
5

0.0 0
C Lef Basal Leak Maximal

Figure 2. Leflunomide Induces Mitochondrial Elongation and Induction of Mitofusins

(A) Chemical structure of leflunomide.
(B) MFN2 and MFN1 mRNA in HeLa cells.
(C) MFN2, MFN1, and porin protein abundance in C2C12 muscle cells.
(D) Representative confocal images of mitochondrial morphology in mtDSRed-expressing muscle cells. Scale bars, 10 mm.
(E) Mitochondrial membrane potential of C2C12 muscle cells was measured with TMRM.
(F) Mitochondrial respiration in C2C12 muscle cells. All cells were treated with leflunomide at 50 mM for 48 hr.
C, control; Lef, leflunomide. Data are mean ± SEM of 3–5 independent experiments performed in triplicate (n = 3–5). Values are expressed relative to the control
untreated group. *p < 0.05, **p < 0.01, and ***p<0.001 indicate statistically significant effects of leflunomide.

Ser616, which has been described to induce the translocation of caused a marked increase in mitochondrial membrane potential,
DRP1 to mitochondria, promoting mitochondrial fission (Taguchi indicating mitochondrial energizing (Figure 2E), without changes
et al., 2007; Yu et al., 2011). Leflunomide induced a decrease in in mitochondrial respiration (Figure 2F).
p-DRP1 levels in HeLa cells, whereas in C2C12 muscle cells Leflunomide is indicated for the treatment of active rheuma-
phosphorylation of DRP1 in Ser616 was increased (Figures toid arthritis as a disease-modifying antirheumatic drug (Maddi-
S1A and S1B). In keeping with the upregulation of mitofusins, son et al., 2005; Olsen and Stein, 2004), and once administrated
an elongated mitochondrial network was detected upon incu- is rapidly converted to its active metabolite A771726 (Teschner
bation with leflunomide in muscle and HeLa cells (Figures 2D and Burst, 2010), also known as teriflunomide (Figure S1D). In
and S1C). In keeping with the morphological data, leflunomide keeping with leflunomide activity, teriflunomide also increased

270 Cell Chemical Biology 25, 268–278, March 15, 2018

MFN2 transcriptional activity and mitofusin mRNA levels in HeLa
cells (Figures S1E and S1F).
To evaluate whether leflunomide induces mitofusin expres-
sion by modulating key transcriptional regulators of MFN2
and MFN1, such as PGC1a, PGC1b, and ERRa (Liesa et al.,
2008; Soriano et al., 2006), we treated cells with leflunomide
and measured the expression of these transcriptional regula-
tors. Leflunomide did not cause any change in the expression
of Pgc1a, Pgc1b, or Erra (Figure S1G), suggesting that another
yet unidentified transcriptional regulator could be involved.
Further studies in this regard are required to identify the pre-
cise mechanism by which leflunomide promotes mitofusin
expression.
It has been reported that certain cell stresses such as starva-
tion, cycloheximide, or actinomycin D cause mitochondrial
elongation or hyperfusion (Tondera et al., 2009), and some of
these conditions are linked to enhanced autophagy (Gomes
et al., 2011; Rambold et al., 2011). Based on this, we analyzed
the effect of leflunomide on autophagy flux. To this end, the
abundance of LC3-II, p62, and BNIP3 were measured upon
treatment with bafilomycin A, an inhibitor of autophagy, for
6 hr in cells untreated or treated with leflunomide for 48 hr.
Data showed that autophagic flux was inhibited in lefluno-
mide-treated cells, clearly indicating that leflunomide inhibits
autophagy (Figure S1H). Based on these data, we propose
that leflunomide causes enhanced MFN expression and mito-
chondrial elongation, and that this is not driven by a primary
stimulation of autophagy.
The Effects of Leflunomide Require Cellular Expression
of Mitofusins
To further test whether the molecular components of the mito-
chondrial fusion process are necessary for the response to leflu-
nomide, we used mouse embryonic fibroblast (MEF) wild-type,
MEF Mfn2
/
, MEF Mfn1
/
, and MEF double-knockout (dKO)
(ablated for both Mfn2 and Mfn1) cells (Figure S2A). Leflunomide
upregulated MFN2 and MFN1 protein expression in MEF wild-
type cells and in MEF cell lines with deficiencies in Mfn1 or
Mfn2, respectively (Figures 3A–3C). No changes were observed
in porin and DRP1 expression (Figures 3A–3C and S2B–S2D).
However, in contrast to muscle and HeLa cells, OPA1 protein
abundance was upregulated in MEF cells, suggesting that
leflunomide’s effect on OPA1 expression is cell specific and
probably of adaptive nature (Figures S2B–S2D). MEF cells defi-
cient for Mfn2 and/or Mfn1 displayed aberrant mitochondrial
morphology, as reported by Chen et al. (2003a). Exposure of
MEF wild-type, MEF Mfn2
/
, and MEF Mfn1
/
cells to lefluno-
mide induced mitochondrial elongation (Figures 3D and 3E).
Importantly, mitochondrial elongation did not occur in cells defi-
cient for both Mfn1 and Mfn2, indicating a specific role of these
proteins (Figure 3D). Leflunomide treatment of MEF Mfn2
/

increased from 8% up to 53% the cells containing elongated
mitochondrial network (mitochondrial tubules longer than 9 mm)
and decreased from 82% to 41% the cells containing ovals
and short tubules. Leflunomide treatment of MEF Mfn1
/
did
not increase them as much as the MEF Mfn2
/
cells containing
elongated mitochondria. However, cells containing short mito-
chondria increased from 12% up to 34% (mitochondrial tubules
ranged from several microns to 5 mm), and decreased from 88%
to 63% the cells containing fragmented mitochondria (Figure 3E).
Our data indicate that leflunomide-induced mitochondrial elon-
gation is somewhat more dependent on MFN1 than on MFN2.
This differential sensitivity is in keeping with prior observations
showing that overexpression of MFN1 in Mfn2-deficient cells
rescued the mitochondrial morphology in 75%–80%, whereas
overexpression of MFN2 in Mfn1-deficient cells only restored
mitochondrial tubules in 25% (Chen et al., 2003a). This may be
explained by the observations from Ishihara et al. (2004) indi-
cating that mitochondrial fusion depends on GTPase activity,
which is greater for MFN1 than for MFN2.
Leflunomide Promotes Mitochondrial Elongation by
Inhibition of Dihydroorotate Dehydrogenase
We next examined the mechanism of action of leflunomide.
Leflunomide has been described to inhibit dihydroorotate
dehydrogenase (DHODH), an inner mitochondrial membrane
enzyme that catalyzes the fourth step in the de novo synthesis
of pyrimidines, in vitro (Cherwinski et al., 1995b; Greene et al.,
1995). Leflunomide inhibits DHODH by binding to the ubiqui-
none binding channel and prevents the production of the py-
rimidine ribonucleotide uridine monophosphate (UMP) (Fox
et al., 1999). UMP is a source of pyrimidine nucleotides, which
are essential for cellular metabolism and cell growth. DHODH
inhibition causes depletion of ribonucleotide pools and pro-
duces cell stress and cell-cycle arrest (Cherwinski et al.,
1995a; Fox et al., 1999; Herrmann et al., 2000; Zielinski et al.,
1995). In this regard, leflunomide and teriflunomide showed
anti-proliferative effects in MEF and HeLa cells (Figures S3A
and S3B). External uridine is taken up by the cells and restores
pyrimidine nucleotide levels through the salvage pathway. This
is achieved by conversion of uridine to UMP by uridine kinase
(Schwartsmann et al., 1988). The addition of external uridine
reverses the deficiency in pyrimidine biosynthesis (Fox et al.,
1999) and antagonized the ability of leflunomide and
teriflunomide to inhibit cell proliferation in HeLa cells (Fig-
ure S3B). Based on this, we analyzed whether uridine pre-
vents the actions of leflunomide/teriflunomide on mitochondrial
morphology. Uridine blocked the induction of MFN2 and MFN1
mRNA levels in cells incubated in the presence of leflunomide
(Figures 4A and 4B) or teriflunomide (Figures S3C and S3D).
Moreover, uridine prevented the upregulation of mitofusin pro-
tein in muscle cells (Figure 4C) and also blocked mitochondrial
elongation in MEF cells (Figure 4D). These results indicate
that leflunomide and teriflunomide induce the upregulation of
mitofusins, and also mitochondrial elongation by depletion of
the cellular pyrimidine pool secondary to DHODH inhibition.
Therefore, by studying these compounds we have found an
important and as yet unknown connection between pyrimidine
metabolism and mitochondrial morphology. This connection is
in keeping with the observations by Tufi et al. (2014), who re-
ported that activation of the nucleotide salvage pathway (deox-
ynucleoside kinase) occurs in PINK1 mutant flies, suggesting
an adaptive mechanism to ameliorate mitochondrial function.
To further document that deficiency in cellular pyrimidine pools
induced mitochondrial fusion, we used brequinar sodium
(BRQ), an inhibitor of DHODH activity that also binds to the ubi-
quinone binding site (Xu et al., 1998). BRQ increased both
MFN2 and MFN1 protein abundance in muscle cells (Figure 4E).
Cell Chemical Biology 25, 268–278, March 15, 2018 271
 A B C MEF Mfn1-/-
MEFwt MEF Mfn2 -/-

C Lef C Lef C Lef

Mfn2 Mfn1 Mfn2

Porin Porin
Mfn1
β-actin β-actin
Porin

β-actin
levels relative to control values)

levels relative to control values)

2.5 * 2.0
*

levels relative to control values)

Effect of leflunomide (protein

Effect of leflunomide (protein

2.0

Effect of leflunomide (protein

*
2.0
1.5
1.5
1.5 *
1.0 1.0
1.0
0.5 0.5
0.5

0.0 0.0 0.0

Mfn2 Mfn1 Porin Mfn1 Porin Mfn2 Porin

D MEFwt MEF Mfn2-/- MEF Mfn1-/- MEF dKO

Lef

E Mitochondrial morphology Mitochondrial morphology

100 100
C
C
cells

cells

Lef
75 75
Lef
***
-/-

-/-

***
% MEF Mfn2

% MEF Mfn1

50 *** 50
***
25 25
***
0 0
Ovals Short Elongated Ovals Short Elongated

Figure 3. Leflunomide Promotes Mitochondrial Elongation in MEF Wild-Type, MEF Mfn2–/–, and MEF Mfn1–/– Cells
(A–C) MFN2, MFN1, and porin protein levels were measured in MEF wild-type (A), MEF Mfn2
/
(B), and MEF Mfn1
/
(C) cells. b-Actin was used as a loading
control.
(D) Representative images of mitochondrial morphology in MEF wild-type, MEF Mfn2
/
, MEF Mfn1
/
, and MEF dKO (ablated from MFN2 and MFN1) live cells
stably expressing mtDsRed. Scale bars, 10 mm.
(E) Quantification of mitochondrial morphology in MEF Mfn2
/
and Mfn1
/
. All cells were treated with leflunomide at 50 mM for 48 hr.
C, control; Lef, leflunomide. Data are mean ± SEM of three independent experiments performed in triplicate (n = 3), and are expressed relative to the untreated
control group. *p < 0.05 and ***p<0.001 indicate statistically significant effects of leflunomide.

272 Cell Chemical Biology 25, 268–278, March 15, 2018

 A B
2.5 *
1.5 *

Mfn1 mRNA levels

Mfn2 mRNA levels

2.0

(relative units)
(relative units)

1.0 1.5

1.0
0.5
0.5
0.0 0.0
C Lef U Lef+U C Lef U Lef+U

C D C Lef
C Lef U Lef+U

Mfn2

Mfn1
-U
β-actin

Porin

+U

E F
3
(Relative to control values)

4 C
Effect of BRQ (protein levels

*
relative to control values)

* Lef
3
mRNA levels

2 Dip
*
2
*** 1
1

0 0
Mfn2 Mfn1 Porin Mfn2 Mfn1

Figure 4. Leflunomide Induces Mitofusin Expression and Mitochondrial Elongation due to Inhibition of Pyrimidine Synthesis
(A and B) MFN2 (A) and MFN1 (B) mRNA levels in HeLa cells incubated with 50 mM leflunomide in the absence or presence of 50 mM uridine for 48 hr.
(C) MFN2, MFN1, and porin protein levels in C2C12 muscle cells incubated with 50 mM leflunomide in the absence or presence of 200 mM uridine for 48 hr.
(D) Representative images of mitochondrial morphology in live MEF cells stably expressing mtDsRed incubated with 50 mM leflunomide in the absence or
presence of 200 mM uridine for 48 hr. Scale bars, 10 mm.
(E) MFN2, MFN1, and porin protein levels in C2C12 cells treated with 1 mM brequinar sodium (BRQ) for 48 hr. Tubulin was used as a loading control.
(F) Mfn2 and Mfn1 mRNA levels in MEF cells incubated with either 50 mM leflunomide or 10 mM dipyridamole (Dip) for 48 hr.
C, control; Lef, leflunomide; U, uridine. Data are mean ± SEM of a representative experiment (n = 3). Values are expressed relative to the control untreated group.
*p < 0.05 and ***p<0.001 indicate statistically significant effects of leflunomide.

These data suggest that depletion of pyrimidine pools induced mine whether inhibition of the pyrimidine salvage pathway also
by the DHODH inhibitors (leflunomide, teriflunomide, or brequi- leads to an increase in mitofusin expression, we used dipyrida-
nar sodium) promotes mitochondrial elongation through induc- mole, a specific inhibitor of equilibrative nucleoside transporters,
tion of the mitochondrial proteins MFN1 and MFN2. the main transporters of nucleosides in cultured cells (Molina-
Pyrimidines can be also synthesized by the salvage pathway, Arcas et al., 2009; Schaper, 2005). In contrast to leflunomide,
which utilizes the nucleosides uridine and/or cytidine. To deter- dipyridamole did not produce any change in Mfn1 and Mfn2

Cell Chemical Biology 25, 268–278, March 15, 2018 273

A B C
4 1.5

Complex III activity

DHODH activity
3

(fold change)
1.0

(U/mg prot)
2
* * *
1
* 0.5

0 0.0
C Lef Myx C Lef Myx

D E C Myx U Myx + U
levels relative to control values)

C Myx
Effect of myxothiazol (protein

1.5 * **
Mfn2

Mfn1 1.0

β-actin 0.5

Porin
0.0
Mfn2 Mfn1 Porin

F G
1.5
**
1.5 *
Mfn1 mRNA levels
Mfn2 mRNA levels

(relative units)
(Relative units)

# 1.0
1.0 # #

0.5 0.5

0.0 0.0
C Myx U Myx+U Ct Myx U Myx+U

Figure 5. Role of Pyrimidine Synthesis in Mitochondrial Elongation

(A) The de novo synthesis of pyrimidine nucleotides is coupled to the mitochondrial respiratory chain via the activity of dihydroorotate dehydrogenase (DHODH).
(B) Complex III activity was measured in MEF cells untreated or treated with either 50 mM leflunomide for 48 hr or 2 mM myxothiazol for 12 hr.
(C) DHODH activity was measured in MEF cells untreated or treated with either 50 mM leflunomide for 48 hr or 2 mM myxothiazol for 12 hr.
(D) MFN2, MFN1, and porin protein expression in HeLa cells treated with 2 mM myxothiazol for 24 hr.
(E) Representative confocal images of mitochondrial morphology in mtDSRed-expressing MEF wild-type cells incubated with 2 mM myxothiazol for 12 hr in the
absence or presence of 200 mM uridine for 12 hr. Scale bars, 10 mm.
(F) MFN2 mRNA levels in HeLa cells incubated with 2 mM myxothiazol in the absence or presence of 50 mM uridine for 24 hr.
(G) MFN1 mRNA levels in HeLa cells incubated with 2 mM myxothiazol in the absence or presence of 50 mM uridine for 24 hr.
C, control; Lef, leflunomide; Myx, myxothiazol; U, uridine. Data are mean ± SEM of three independent experiments. Values are expressed relative to the control
untreated group. *p < 0.05 and **p < 0.01 indicate statistically significant effects due to the different treatments versus control group; #p < 0.05 versus group
without uridine.

expression, strongly suggesting that the pyrimidine salvage Inhibition of Respiratory Complex III Causes
pathway is not associated with mitochondrial elongation Mitochondrial Elongation through DHODH
(Figure 4F). To better understand the link between mitochondrial elongation
Leflunomide has been also described as an activator of the and pyrimidine synthesis, we further analyzed the implications of
aryl hydrocarbon receptor (AhR) (O’Donnell et al., 2012). In line DHODH. DHODH catalyzes oxidation of dihydroorotate into oro-
with this, leflunomide and teriflunomide upregulated the AhR tate using ubiquinone as co-substrate electron acceptor. In this
target gene CYP1A1 mRNA in HeLa cells, and CH-223191 reaction ubiquinone is converted to ubiquinol, which is a sub-
(a ligand-selective antagonist of AhR) blocked this induction (Fig- strate of respiratory complex III. Thus, the novo synthesis of py-
ure S4A). Under these conditions, CH-223191 did not block the rimidine nucleotides is coupled to the mitochondrial respiratory
effects of leflunomide or teriflunomide on MFN2 transcriptional chain via DHODH (Figure 5A). It has been reported that DHODH
activity, or MFN2 gene expression in HeLa cells (Figures S4B depletion partially inhibits complex III and increases reactive ox-
and S4C). CH-223191 did not block either leflunomide-depen- ygen species generation (Fang et al., 2013). In turn, respiratory
dent MFN2 or MFN1 expression in MEF cells (Figure S4D). More- chain dysfunction using specific inhibitors of complex III, such
over, p70 S6 kinase (S6K1) has been identified as a molecular as myxothiazol, also impairs DHODH activity (Figure 5A). To
target of teriflunomide (Doscas et al., 2014). However, under assess the interaction between DHODH and complex III, we
our conditions leflunomide did not alter S6K1 activity in muscle measured both activities in control cells and cells treated with
cells (Figure S4E). In all, our results indicate that the effects of leflunomide or myxothiazol. Leflunomide or myxothiazol in-
leflunomide or teriflunomide on MFN2 expression are not depen- hibited DHODH and complex III, demonstrating the functional
dent on AhR or S6K1. interaction between these two activities under these conditions

274 Cell Chemical Biology 25, 268–278, March 15, 2018

 MEFwt
Dox
C Lef C Lef
Cleaved PARP
Cleaved Casp3
Tubulin
5 MEFwt * effects due to the different treatments; ##p < 0.01
MEFdKO ***
Cleaved PARP
4
(fold change)
Cleaved Casp3
3
2 ##
1 5
0 0
C Lef Dox Dox+Lef
(Figures 5B and 5C). In line with this, myxothiazol increased mi-
tofusins protein levels in HeLa (Figure 5D) and MEF wild-type
cells (Figure S5A), whereas no differences were detected for
DRP1, and alterations of OPA1 expression were variable depen-
dent on the cell type (Figures S5A and S5B). Addition of uridine
blocked the effects of myxothiazol on MFN1 and MFN2 expres-
sion (Figure S5C). Myxothiazol also promoted elongation of the
mitochondrial network in MEF and HeLa cells (Figures 5E and
S5D), and this effect was conserved in Mfn1
/
and Mfn2
/

MEF cells (Figure S5E). The addition of external uridine, which
prevents a deficient pyrimidine cell pool, blocked myxothiazol-
induced mitochondrial elongation in MEF and HeLa cells (Figures
5E and S5D) and the induction of MFN2 and MFN1 gene expres-
sion (Figures 5F and 5G). Use of antimycin A (AA), another inhib-
itor of complex III, also increased MFN2 gene and protein
expression, and the addition of external uridine blocked this ef-
fect (Figures S5F and S5G). However, in contrast to the effect
of myxothiazol, AA induced mitochondrial fragmentation and
the appearance of donut-like structures (Figure S5H). This
discrepancy could be explained by the different mechanism of
action of both compounds inhibiting complex III. AA is a Qi-site
inhibitor, increasing the steady-state concentration of ubisemi-
quinone, which leads to an increase in superoxide generation
within the Q cycle (Chen et al., 2003b). Myxothiazol is a Qo-
site inhibitor, preventing the oxidation of ubiquinol, and is sup-
posed to be a superoxide formation inhibitor (Viola and Hool,
2010). Therefore, it is possible that superoxide generation
upon treatment with AA could induce mitochondrial fragmenta-
tion and donut-like structures as reported in other conditions
(Ahmad et al., 2013; Magrane et al., 2009; Song et al., 2013).
In all, our data further support the view that pyrimidine defi-
ciency is a key event downstream of inhibition of either DHODH
or complex III leading to mitofusin induction and mitochondrial
elongation. These data confirm that depletion of pyrimidine
pools by myxothiazol causes cell-cycle arrest and promotes
mitochondrial elongation to provide stress resistance on cells.
Leflunomide-Induced Mitochondrial Fusion Confers
Resistance to Cell Death
Mitochondrial elongation has been described to protect against
apoptosis (Rambold et al., 2011; Wang et al., 2012). To
MEF dKO Figure 6. Role of Pyrimidine Synthesis and
Dox Leflunomide in Protection from Doxoru-
C Lef C Lef bicin-Induced Apoptosis
Cleaved PARP and cleaved caspase-3 in MEF
wild-type and MEF dKO cells incubated with 1 mM
doxorubicin (Dox; 12 hr) and 50 mM leflunomide
(Lef) for 48 hr. Data are mean ± SEM of three in-
dependent experiments. Values are expressed
relative to the control (C) untreated group. *p < 0.05
and ***p < 0.001 indicate statistically significant
MEFwt
20
MEFdKO and ###p < 0.001 indicate differences from the
*
(fold change)
15 doxorubicin-treated group.
10
***
###
*** examine whether mitochondrial elonga-
tion induced by leflunomide could have
C Lef Dox Dox+Lef
a similar effect, we treated MEF wild-
type and MEF dKO cells with the
apoptotic agent doxorubicin (DOX) in the absence or presence
of leflunomide. DOX is an anticancer chemotherapy drug that
acts as a DNA intercalating agent and triggers apoptosis. Dur-
ing apoptosis, caspase-3 activation leads to downstream
cleavage of specific proteins in the cytoplasm or nucleus
including poly(ADP-ribose)polymerase (PARP) (Slee et al.,
1999). MEF wild-type cells treated with DOX for 12 hr caused
a marked increase in cleaved PARP and caspase-3 (Figure 6).
In contrast, leflunomide pre-treatment for 48 hr dramatically
decreased the PARP and caspase-3 activity, preventing
apoptosis in MEF wild-type cells (Figure 6). Leflunomide pre-
treatment did not prevent DOX-induced apoptosis in MEF
dKO cells (Figure 6). Our data indicate that mitofusins are indis-
pensable for the effects of leflunomide on mitochondrial elon-
gation, and protect from apoptosis.
In conclusion, we have identified small molecules from a pheno-
type-based high-throughput screen that promote enhanced abun-
dance of MFN2 and MFN1 mitochondrial fusion proteins and
induce mitochondrial elongation. Leflunomide, teriflunomide, bre-
quinar sodium, and myxothiazol have permitted identification of a
new link between pyrimidine synthesis and mitochondrial dy-
namics. This effect occurs in different cell lines from human and
mouse origin, indicating that the connection between pyrimidine
metabolism and mitochondrial morphology is conserved across
species and cell types. The depletion of pyrimidine pools induced
by DHODH inhibition triggers cell-cycle arrest, upregulates MFN1
and MFN2, and promotes mitochondrial elongation to confer
stress resistance on cells. Mitochondrial elongation represents
an adaptive response against depletion of pyrimidine pools and
also confers protection against induced apoptosis. The addition
of external uridine blocks the signaling, leading to upregulation of
mitofusins in the presence of DHODH inhibitors. This study may
lead to a new strategy for the treatment of diseases linked to mito-
chondrial dysfunction.
SIGNIFICANCE
A growing number of pathologies are associated with alter-
ations in mitochondrial dynamics. In this regard, a reduction
in mitochondrial fusion proteins is linked to metabolic dis-
orders, neurodegeneration, and cardiovascular diseases in
Cell Chemical Biology 25, 268–278, March 15, 2018 275
mouse models. In humans, mutations in genes encoding
mitochondrial fusion proteins cause Charcot-Marie-Tooth
2A neuropathy, autosomal dominant optic atrophy (ADOA),
and parkinsonism. In addition, the expression of mitochon-
drial fusion proteins have been found to be decreased in
obesity, type 2 diabetes, and aging. In consequence, the
identification of activators of mitochondrial fusion amenable
for pharmacological intervention could be beneficial in the
treatment of different disorders. In this regard, by using a
phenotype-based high-throughput screening using an
FDA-approved library of 1,120 compounds, we have identi-
fied leflunomide as an activator of mitofusin expression
and mitochondrial fusion. Leflunomide blocks pyrimidine
biosynthesis by inhibiting dihydroorotate dehydrogenase
(DHODH), a mitochondrial protein functionally connected
with respiratory complex III. Importantly, other inhibitors of
DHODH or complex III, also increase mitofusin expression
and promote mitochondrial fusion. Of particular signifi-
cance, our results reveal a previously unknown connection
between pyrimidine metabolism and mitochondrial dy-
namics at the level of DHODH, which maintains cell survival
under stress conditions characterized by loss of pyrimidine
synthesis. In all, our findings may lead to new strategies
for the treatment of diseases linked to mitochondrial
dysfunction.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Cell Lines
d METHOD DETAILS
B Chemicals, Reagents, and Equipment/Software
B High throughput Screening Using Prestwick Library
B Luciferase Reporter Assay
B RNA Extraction and Real-Time PCR
B Western Blotting
B Confocal Microscopy and Morphological Analysis
B Labelling of Mitochondrial Compartment
B Mitochondrial Complex III Activity Assay
B Dihydroorotate Dehydrogenase (DHODH) Activ-
ity Assay
B Mitochondrial Respiration Assay
d QUANTIFICATION AND STATISTICAL ANALYSIS
SUPPLEMENTAL INFORMATION
Supplemental Information includes five figures and one table and can be found
with this article online at https://doi.org/10.1016/j.chembiol.2017.12.001.
ACKNOWLEDGMENTS
We thank Dr. Juan Pablo Muñoz and Dr. Saska Ivanova for their contribution in
materials and helpful discussions, and Jordi Manuel Seco for technical assis-
tance. We also thank the Genomic Facility (Scientific and Technological Cen-
ters, Universitat de Barcelona), and Advanced Digital Microscopy Facility (IRB
276 Cell Chemical Biology 25, 268–278, March 15, 2018
Barcelona). The study was partially funded by the MINECO ‘‘Ministerio de
Economia y Competitividad’’ (SAF2013-40987-R, SAF2016-75246-R, and
CTQ2012-30930), the Generalitat de Catalunya (2014SGR48 and 2014 SGR
137), INFLAMES (PIE-14/00045, Instituto de Salud Caros III), and CIBERDEM
(Instituto de Salud Carlos III). We gratefully acknowledge institutional funding
from the MINECO through the Centers of Excellence Severo Ochoa Award,
and from the CERCA Program of the Generalitat de Catalunya. A.Z. is a recip-
ient of an ICREA Academia (Generalitat de Catalunya).
AUTHOR CONTRIBUTIONS
L.M.-C. performed the high-throughput screening and the cell experiments,
and wrote the manuscript; D.S. performed cell experiments and wrote the
manuscript; J.B. and M.I.L. designed and performed the high-throughput
screening studies; E.M.R.-L. and P.M.F.-S. contributed with materials and
analysis tools; M.P. analyzed the experimental data; A.Z. directed the
research, revised the experimental data, and wrote the manuscript; F.A.
directed the research and revised the experimental data.
Received: April 19, 2017
Revised: September 12, 2017
Accepted: November 30, 2017
Published: December 28, 2017
REFERENCES
Ahmad, T., Aggarwal, K., Pattnaik, B., Mukherjee, S., Sethi, T., Tiwari, B.K.,
Kumar, M., Micheal, A., Mabalirajan, U., Ghosh, B., et al. (2013).
Computational classification of mitochondrial shapes reflects stress and redox
state. Cell Death Dis. 4, e461.
Alexander, C., Votruba, M., Pesch, U.E., Thiselton, D.L., Mayer, S., Moore, A.,
Rodriguez, M., Kellner, U., Leo-Kottler, B., Auburger, G., et al. (2000). OPA1,
encoding a dynamin-related GTPase, is mutated in autosomal dominant optic
atrophy linked to chromosome 3q28. Nat. Genet. 26, 211–215.
Amati-Bonneau, P., Valentino, M.L., Reynier, P., Gallardo, M.E., Bornstein, B.,
Boissiere, A., Campos, Y., Rivera, H., de la Aleja, J.G., Carroccia, R., et al.
(2008). OPA1 mutations induce mitochondrial DNA instability and optic atro-
phy ’plus’ phenotypes. Brain 131, 338–351.
Bach, D., Pich, S., Soriano, F.X., Vega, N., Baumgartner, B., Oriola, J.,
Daugaard, J.R., Lloberas, J., Camps, M., Zierath, J.R., et al. (2003).
Mitofusin-2 determines mitochondrial network architecture and mitochondrial
metabolism. A novel regulatory mechanism altered in obesity. J. Biol. Chem.
278, 17190–17197.
Campana, C., Pezzi, V., and Rainey, W.E. (2015). Cell-based assays for
screening androgen receptor ligands. Semin. Reprod. Med. 33, 225–234.
Carelli, V., Musumeci, O., Caporali, L., Zanna, C., La Morgia, C., Del Dotto, V.,
Porcelli, A.M., Rugolo, M., Valentino, M.L., Iommarini, L., et al. (2015).
Syndromic parkinsonism and dementia associated with OPA1 missense
mutations. Ann. Neurol. 78, 21–38.
Cooper, D.J., Zunino, G., Bixby, J.L., and Lemmon, V.P. (2016). Phenotypic
screening with primary neurons to identify drug targets for regeneration and
degeneration. Mol. Cell. Neurosci. 80, 161–169.
Chen, H., Detmer, S.A., Ewald, A.J., Griffin, E.E., Fraser, S.E., and Chan,
D.C. (2003a). Mitofusins Mfn1 and Mfn2 coordinately regulate mitochon-
drial fusion and are essential for embryonic development. J. Cell Biol.
160, 189–200.
Chen, Q., Vazquez, E.J., Moghaddas, S., Hoppel, C.L., and Lesnefsky, E.J.
(2003b). Production of reactive oxygen species by mitochondria: central role
of complex III. J. Biol. Chem. 278, 36027–36031.
Cherwinski, H.M., Byars, N., Ballaron, S.J., Nakano, G.M., Young, J.M., and
Ransom, J.T. (1995a). Leflunomide interferes with pyrimidine nucleotide
biosynthesis. Inflamm. Res. 44, 317–322.
Cherwinski, H.M., Cohn, R.G., Cheung, P., Webster, D.J., Xu, Y.Z., Caulfield,
J.P., Young, J.M., Nakano, G., and Ransom, J.T. (1995b). The immunosup-
pressant leflunomide inhibits lymphocyte proliferation by inhibiting pyrimidine
biosynthesis. J. Pharmacol. Exp. Ther. 275, 1043–1049.
Cherwinski, H.M., McCarley, D., Schatzman, R., Devens, B., and Ransom, J.T.
(1995c). The immunosuppressant leflunomide inhibits lymphocyte progres-
sion through cell cycle by a novel mechanism. J. Pharmacol. Exp. Ther. 272,
460–468.
Delettre, C., Lenaers, G., Griffoin, J.M., Gigarel, N., Lorenzo, C., Belenguer, P.,
Pelloquin, L., Grosgeorge, J., Turc-Carel, C., Perret, E., et al. (2000). Nuclear
gene OPA1, encoding a mitochondrial dynamin-related protein, is mutated
in dominant optic atrophy. Nat. Genet. 26, 207–210.
Doscas, M.E., Williamson, A.J., Usha, L., Bogachkov, Y., Rao, G.S., Xiao, F.,
Wang, Y., Ruby, C., Kaufman, H., Zhou, J., et al. (2014). Inhibition of p70 S6
kinase (S6K1) activity by A77 1726 and its effect on cell proliferation and cell
cycle progress. Neoplasia 16, 824–834.
Duvezin-Caubet, S., Jagasia, R., Wagener, J., Hofmann, S., Trifunovic, A.,
Hansson, A., Chomyn, A., Bauer, M.F., Attardi, G., Larsson, N.G., et al.
(2006). Proteolytic processing of OPA1 links mitochondrial dysfunction to al-
terations in mitochondrial morphology. J. Biol. Chem. 281, 37972–37979.
Fang, J., Uchiumi, T., Yagi, M., Matsumoto, S., Amamoto, R., Takazaki, S.,
Yamaza, H., Nonaka, K., and Kang, D. (2013). Dihydro-orotate dehydrogenase
is physically associated with the respiratory complex and its loss leads to mito-
chondrial dysfunction. Biosci. Rep. 33, e00021.
Fernandes, P.B. (1998). Technological advances in high-throughput
screening. Curr. Opin. Chem. Biol. 2, 597–603.
Fox, R.I., Herrmann, M.L., Frangou, C.G., Wahl, G.M., Morris, R.E., Strand, V.,
and Kirschbaum, B.J. (1999). Mechanism of action for leflunomide in rheuma-
toid arthritis. Clin. Immunol. 93, 198–208.
Gomes, L.C., Di Benedetto, G., and Scorrano, L. (2011). During autophagy
mitochondria elongate, are spared from degradation and sustain cell viability.
Nat. Cell Biol. 13, 589–598.
Greene, S., Watanabe, K., Braatz-Trulson, J., and Lou, L. (1995). Inhibition of
dihydroorotate dehydrogenase by the immunosuppressive agent leflunomide.
Biochem. Pharmacol. 50, 861–867.
Herrmann, M.L., Schleyerbach, R., and Kirschbaum, B.J. (2000). Leflunomide:
an immunomodulatory drug for the treatment of rheumatoid arthritis and other
autoimmune diseases. Immunopharmacology 47, 273–289.
Hertzberg, R.P., and Pope, A.J. (2000). High-throughput screening: new tech-
nology for the 21st century. Curr. Opin. Chem. Biol. 4, 445–451.
Hudson, G., Amati-Bonneau, P., Blakely, E.L., Stewart, J.D., He, L., Schaefer,
A.M., Griffiths, P.G., Ahlqvist, K., Suomalainen, A., Reynier, P., et al. (2008).
Mutation of OPA1 causes dominant optic atrophy with external ophthalmople-
gia, ataxia, deafness and multiple mitochondrial DNA deletions: a novel disor-
der of mtDNA maintenance. Brain 131, 329–337.
Ishihara, N., Eura, Y., and Mihara, K. (2004). Mitofusin 1 and 2 play distinct
roles in mitochondrial fusion reactions via GTPase activity. J. Cell Sci. 117,
6535–6546.
Kyo, S., Takakura, M., Fujiwara, T., and Inoue, M. (2008). Understanding and
exploiting hTERT promoter regulation for diagnosis and treatment of human
cancers. Cancer Sci. 99, 1528–1538.
Liesa, M., Borda-d’Agua, B., Medina-Gomez, G., Lelliott, C.J., Paz, J.C., Rojo,
M., Palacin, M., Vidal-Puig, A., and Zorzano, A. (2008). Mitochondrial fusion is
increased by the nuclear coactivator PGC-1beta. PLoS One 3, e3613.
Liu, R., Jin, P., Yu, L., Wang, Y., Han, L., Shi, T., and Li, X. (2014). Impaired
mitochondrial dynamics and bioenergetics in diabetic skeletal muscle. PLoS
One 9, e92810.
Maddison, P., Kiely, P., Kirkham, B., Lawson, T., Moots, R., Proudfoot, D.,
Reece, R., Scott, D., Sword, R., Taggart, A., et al. (2005). Leflunomide in rheu-
matoid arthritis: recommendations through a process of consensus.
Rheumatology (Oxford) 44, 280–286.
Magrane, J., Hervias, I., Henning, M.S., Damiano, M., Kawamata, H., and
Manfredi, G. (2009). Mutant SOD1 in neuronal mitochondria causes toxicity
and mitochondrial dynamics abnormalities. Hum. Mol. Genet. 18, 4552–4564.
Mervin, L.H., Cao, Q., Barrett, I.P., Firth, M.A., Murray, D., McWilliams, L.,
Haddrick, M., Wigglesworth, M., Engkvist, O., and Bender, A. (2016).
Understanding cytotoxicity and cytostaticity in a high-throughput screening
collection. ACS Chem. Biol. 11, 3007–3023.
Molina-Arcas, M., Casado, F.J., and Pastor-Anglada, M. (2009). Nucleoside
transporter proteins. Curr. Vasc. Pharmacol. 7, 426–434.
Moore, K., and Rees, S. (2001). Cell-based versus isolated target screening:
how lucky do you feel? J. Biomol. Screen. 6, 69–74.
Nemunaitis, J., Tong, A.W., Nemunaitis, M., Senzer, N., Phadke, A.P., Bedell,
C., Adams, N., Zhang, Y.A., Maples, P.B., Chen, S., et al. (2010). A phase I
study of telomerase-specific replication competent oncolytic adenovirus (telo-
melysin) for various solid tumors. Mol. Ther. 18, 429–434.
O’Donnell, E.F., Kopparapu, P.R., Koch, D.C., Jang, H.S., Phillips, J.L.,
Tanguay, R.L., Kerkvliet, N.I., and Kolluri, S.K. (2012). The aryl hydrocarbon re-
ceptor mediates leflunomide-induced growth inhibition of melanoma cells.
PLoS One 7, e40926.
Olichon, A., Baricault, L., Gas, N., Guillou, E., Valette, A., Belenguer, P., and
Lenaers, G. (2003). Loss of OPA1 perturbates the mitochondrial inner mem-
brane structure and integrity, leading to cytochrome c release and apoptosis.
J. Biol. Chem. 278, 7743–7746.
Olsen, N.J., and Stein, C.M. (2004). New drugs for rheumatoid arthritis. N. Engl.
J. Med. 350, 2167–2179.
Rambold, A.S., Kostelecky, B., Elia, N., and Lippincott-Schwartz, J. (2011).
Tubular network formation protects mitochondria from autophagosomal
degradation during nutrient starvation. Proc. Natl. Acad. Sci. USA 108,
10190–10195.
Rocha, D.N., Carvalho, E.D., and Pego, A.P. (2016). High-throughput platforms
for the screening of new therapeutic targets for neurodegenerative diseases.
Drug Discov. Today 21, 1355–1366.
Rojo, M., Legros, F., Chateau, D., and Lombes, A. (2002). Membrane topology
and mitochondrial targeting of mitofusins, ubiquitous mammalian homologs of
the transmembrane GTPase Fzo. J. Cell Sci. 115, 1663–1674.
Rouzier, C., Bannwarth, S., Chaussenot, A., Chevrollier, A., Verschueren, A.,
Bonello-Palot, N., Fragaki, K., Cano, A., Pouget, J., Pellissier, J.F., et al.
(2012). The MFN2 gene is responsible for mitochondrial DNA instability and
optic atrophy ’plus’ phenotype. Brain 135, 23–34.
Ruckemann, K., Fairbanks, L.D., Carrey, E.A., Hawrylowicz, C.M., Richards,
D.F., Kirschbaum, B., and Simmonds, H.A. (1998). Leflunomide inhibits pyrim-
idine de novo synthesis in mitogen-stimulated T-lymphocytes from healthy
humans. J. Biol. Chem. 273, 21682–21691.
Schaper, W. (2005). Dipyridamole, an underestimated vascular protective
drug. Cardiovasc. Drugs Ther. 19, 357–363.
Schneeberger, M., Dietrich, M.O., Sebastián, D., Imbernon, M., Castano, C.,
Garcia, A., Esteban, Y., Gonzalez-Franquesa, A., Rodriguez, I.C., Bortolozzi,
A., et al. (2013). Mitofusin 2 in POMC neurons connects ER stress with leptin
resistance and energy imbalance. Cell 155, 172–187.
Schwartsmann, G., Peters, G.J., Laurensse, E., de Wall, F.C., Loonen, A.H.,
Leyva, A., and Pinedo, H.M. (1988). Schedule-dependency of growth-inhibi-
tory and antipyrimidine effects. Biochem. Pharmacol. 37, 3257–3266.
Sebastián, D., Hernández-Alvarez, M.I., Segalés, J., Sorianello, E., Muñoz,
J.P., Sala, D., Waget, A., Liesa, M., Paz, J.C., Gopalacharyulu, P., et al.
(2012). Mitofusin 2 (Mfn2) links mitochondrial and endoplasmic reticulum func-
tion with insulin signaling and is essential for normal glucose homeostasis.
Proc. Natl. Acad. Sci. USA 109, 5523–5528.
Sebastián, D., Sorianello, E., Segalés, J., Irazoki, A., Ruiz-Bonilla, V., Sala, D.,
Planet, E., Berenguer-Llergo, A., Muñoz, J.P., Sánchez-Feutrie, M., et al.
(2016). Mfn2 deficiency links age-related sarcopenia and impaired autophagy
to activation of an adaptive mitophagy pathway. EMBO J. 35, 1677–1693.
Slee, E.A., Adrain, C., and Martin, S.J. (1999). Serial killers: ordering caspase
activation events in apoptosis. Cell Death Differ. 6, 1067–1074.
Song, W., Song, Y., Kincaid, B., Bossy, B., and Bossy-Wetzel, E. (2013).
Mutant SOD1G93A triggers mitochondrial fragmentation in spinal cord motor
neurons: neuroprotection by SIRT3 and PGC-1alpha. Neurobiol. Dis.
51, 72–81.
Soriano, F.X., Liesa, M., Bach, D., Chan, D.C., Palacin, M., and Zorzano, A.
(2006). Evidence for a mitochondrial regulatory pathway defined by peroxi-
some proliferator-activated receptor-gamma coactivator-1 alpha, estrogen-
related receptor-alpha, and mitofusin 2. Diabetes 55, 1783–1791.
Cell Chemical Biology 25, 268–278, March 15, 2018 277
Taguchi, N., Ishihara, N., Jofuku, A., Oka, T., and Mihara, K. (2007). Mitotic
phosphorylation of dynamin-related GTPase Drp1 participates in mitochon-
drial fission. J. Biol. Chem. 282, 11521–11529.
Teschner, S., and Burst, V. (2010). Leflunomide: a drug with a potential beyond
rheumatology. Immunotherapy 2, 637–650.
Tondera, D., Grandemange, S., Jourdain, A., Karbowski, M., Mattenberger, Y.,
Herzig, S., Da Cruz, S., Clerc, P., Raschke, I., Merkwirth, C., et al. (2009). SLP-2
is required for stress-induced mitochondrial hyperfusion. EMBO J. 28,
1589–1600.
Tufi, R., Gandhi, S., de Castro, I.P., Lehmann, S., Angelova, P.R., Dinsdale, D.,
Deas, E., Plun-Favreau, H., Nicotera, P., Abramov, A.Y., et al. (2014).
Enhancing nucleotide metabolism protects against mitochondrial dysfunction
and neurodegeneration in a PINK1 model of Parkinson’s disease. Nat. Cell
Biol. 16, 157–166.
Verhoeven, K., Claeys, K.G., Zuchner, S., Schroder, J.M., Weis, J., Ceuterick,
C., Jordanova, A., Nelis, E., De Vriendt, E., Van Hul, M., et al. (2006). MFN2
mutation distribution and genotype/phenotype correlation in Charcot-Marie-
Tooth type 2. Brain 129, 2093–2102.
Viola, H.M., and Hool, L.C. (2010). Qo site of mitochondrial complex III is the
source of increased superoxide after transient exposure to hydrogen peroxide.
J. Mol. Cell. Cardiol. 49, 875–885.
Wang, D., Wang, J., Bonamy, G.M., Meeusen, S., Brusch, R.G., Turk, C., Yang,
P., and Schultz, P.G. (2012). A small molecule promotes mitochondrial fusion
in mammalian cells. Angew. Chem. Int. Ed. 51, 9302–9305.
Xu, X., Williams, J.W., Shen, J., Gong, H., Yin, D.P., Blinder, L., Elder, R.T.,
Sankary, H., Finnegan, A., and Chong, A.S. (1998). In vitro and in vivo mecha-
278 Cell Chemical Biology 25, 268–278, March 15, 2018
nisms of action of the antiproliferative and immunosuppressive agent, brequi-
nar sodium. J. Immunol. 160, 846–853.
Yin, S., Kabashima, T., Zhu, Q., Shibata, T., and Kai, M. (2017). Fluorescence
assay of dihydroorotate dehydrogenase that may become a cancer biomarker.
Sci. Rep. 7, 40670.
Yu, T., Jhun, B.S., and Yoon, Y. (2011). High-glucose stimulation increases
reactive oxygen species production through the calcium and mitogen-acti-
vated protein kinase-mediated activation of mitochondrial fission. Antioxid.
Redox Signal. 14, 425–437.
Zielinski, T., Zeitter, D., Muller, S., and Bartlett, R.R. (1995). Leflunomide, a
reversible inhibitor of pyrimidine biosynthesis? Inflamm. Res. 44 (Suppl 2 ),
S207–S208.
Zorzano, A., Sebastián, D., Sánchez-Wandelmer, J., Miret, L., and Albericio, F.
(2012). Gene promoters and transcription control regions as therapeutic tar-
gets. In Therapeutic Targets: Modulation, Inhibition, and Activation, L.M.
Botana and M. Loza, eds. (Wiley), pp. 327–350.
Zuchner, S., De Jonghe, P., Jordanova, A., Claeys, K.G., Guergueltcheva, V.,
Cherninkova, S., Hamilton, S.R., Van Stavern, G., Krajewski, K.M., Stajich, J.,
et al. (2006). Axonal neuropathy with optic atrophy is caused by mutations in
mitofusin 2. Ann. Neurol. 59, 276–281.
Zuchner, S., Mersiyanova, I.V., Muglia, M., Bissar-Tadmouri, N., Rochelle, J.,
Dadali, E.L., Zappia, M., Nelis, E., Patitucci, A., Senderek, J., et al. (2004).
Mutations in the mitochondrial GTPase mitofusin 2 cause Charcot-Marie-
Tooth neuropathy type 2A. Nat. Genet. 36, 449–451.
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Mouse monoclonal anti-Mitofusin 2 Abcam Cat#ab56889 RRID: AB_2142629
Mouse monoclonal anti-Mitofusin 1 Abcam Cat#ab57602 RRID: AB_2142624
Mouse monoclonal anti-OPA1 (clone 18/OPA1) BD Transduction Laboratories Cat#612606 RRID: AB_399888
Mouse monoclonal anti-DRP1 BD Transduction Laboratories Cat#611112
Rabbit anti-phospho-DRP1 (Ser616) Cell Signaling Cat#3455 RRID: AB_2085352
Rabbit anti-FIS1 BioVision Cat#3491-100 RRID: AB_2246806
Rabbit anti cleaved Caspase-3 Cell Signaling Cat#9661 RRID: AB_2341188
Rabbit monoclonal anti-PARP Cell Signaling Cat#9532 RRID: AB_10695538
Mouse monoclonal anti-VDAC1/Porin Abcam Cat#ab14734 RRID: AB_443084
Rabbit anti-LC3 MBL Cat#PM036 RRID: AB_2274121
Guinea pig anti-p62 Progen Cat#GP62-C RRID: AB_2687531
Mouse monoclonal anti-BNIP3 Abcam Cat#ab10433 RRID: AB_2066656
Mouse monoclonal anti-b-actin Sigma-Aldrich Cat#A1978 RRID: AB_476692
Mouse monoclonal anti-a-tubulin Sigma-Aldrich Cat#T5168
Rabbit anti-p70 S6 kinase Cell Signaling Cat#9202 RRID: AB_331676
Rabbit anti-phospho-p70 S6 kinase (Thr421/Thr424) Cell Signaling Cat#9204 RRID: AB_2265916
Chemicals, Peptides, and Recombinant Proteins
9-cis-retinoic acid Sigma-Aldrich Cat#R4643
DMSO Sigma-Aldrich Cat#D2650
Doxorubicin Sigma-Aldrich Cat#44583
Leflunomide Sigma-Aldrich Cat#L5025
Teriflunomide Sigma-Aldrich Cat#SML0936
Brequinar Sodium Sigma-Aldrich Cat#SML0113
CH-223191 Sigma-Aldrich Cat#C8124
Myxothiazol Sigma-Aldrich Cat#T5580
Orotic Acid Sigma-Aldrich Cat#O2750
DL-Dyhidroorotic acid Sigma-Aldrich Cat#D7003
4-(Trifluoromethoxy)benzamidoxime Aldrich Cat#422231
Antimycin A Sigma-Aldrich Cat#A8674
Critical Commercial Assays
Mitochondrial Complex III Activity Assay kit BioVision Cat#K520-100
Experimental Models: Cell Lines
HeLa M2P (stable HeLa cell line expressing 2kb of human This paper N/A
Mfn2 promoter)
C2C12 ATCC Cat#CRL-1772
HeLa ECACC Cat#93021013
MEFwt David Chan laboratory N/A
MEF Mfn1 KO David Chan laboratory N/A
MEF Mfn2 KO David Chan laboratory N/A
MEF dKO (Mfn1/Mfn2 KO) ATCC Cat#CRL-2994
Oligonucleotides
Primers for human Mfn2; Fwd: GACCAAGTTTGAGCAGCACACG. This paper N/A
See Table S1.
(Continued on next page)

Cell Chemical Biology 25, 268–278.e1–e4, March 15, 2018 e1

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Recombinant DNA
pGL3-Mfn2Prom plasmid This paper N/A
Software and Algorithms
ImageJ NIH https://imagej-nih-gov.sire.ub.edu/ij/
Other
TaqMan assay for human Mfn1 Applied Biosystems Hs00966851_m1
TaqMan assay for human Dnm1 Applied Biosystems Hs00247147_m1
TaqMan assay for human OPA1 Applied Biosystems Hs01047018_m1

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact: Antonio
Zorzano (antonio.zorzano@irbbarcelona.org)

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell Lines
HeLa (Human from cervical cancer, female), C2C12 (mouse muscle, sex unspecified), MEFwt (mouse embryonic fibroblasts, sex
unspecified) , MEF Mfn1-/- (embryonic fibroblasts from Mfn1-/- male mice) , MEF Mfn2-/- (embryonic fibroblasts from Mfn2-/- male
mice) and MEF dKO (embryonic fibroblasts from Mfn1-/-/Mfn2-/- mice, sex unspecified) were used in this study. SV-40-transformed
wild-type, Mfn1-/-, and Mfn2-/- MEFs were a gift from D.C. Chan (Division of Biology, California Institute of Technology, UA). MEF dKO
(ablated from Mfn2 and Mfn1) cells, and C2C12 cell lines were from ATCC. All cells were grown in DMEM (Gibco-Invitrogen) with
4.5 g/L of D-glucose, FBS (Gibco, 10%) and penicillin/streptomycin (100 U/mL, Invitrogen) at 37 C in a humidified atmosphere of
5% CO2/95% air.

METHOD DETAILS

Chemicals, Reagents, and Equipment/Software

9-cis-retinoic acid, dimethyl sulfoxide, doxorubicin, leflunomide, myxothiazol, brequinar sodium, and CH-223191 were purchased
from Sigma-Aldrich. Teriflunomide was purchased in Bio Trend. MitoTracker Red CMXRos was from Invitrogen.

High throughput Screening Using Prestwick Library

The compounds of the Prestwick Chemical Library were delivered at 10 mM in DMSO (200 mL of each compound) in 96 well plates.
A diluted stock of the compounds at 1 mM in DMSO (10 mL) was prepared in 96 well plates to avoid frosting and defrosting problems.
The final concentration of the compounds with the cells must be 10 mM with a maximum 1% of DMSO to avoid toxicity problems. An
intermediate 96 well plate with the compounds at 100 mM (10% DMSO) was prepared with cell growth medium with a Multidrop
system (TermoLab Systems) and the Aquarius robot (Tecan).
In the intermediate 96 well plate with the compounds at 100 mM, RA (100 mM) and DMSO (10 %) were added as a positive and
negative controls, respectively. Then, 10 mL from each well of the intermediates plates were transferred to final plates, which con-
tained HeLa M2P14 cells (20.000 cells/well) with 90 mL of growth medium, with the Aquarius robot (Tecan).
Then, the cells were incubated with the compounds of the Prestwick Chemical Library at a final concentration of 10 mM for
16 hours. Cells were incubated in parallel with RA (10 mM) and 1% DMSO (v:v). Positive and negative controls were run as an integral
part of each assay to ensure the validity of the obtained results.
The next day the plates were washed with PBS1X, and lysis buffer (50 mL) was added. The plates were shaken for 35 min. Then,
10 mL of each well plates were added in a new 96 well black plates (clear bottom) with the Aquarius robot (Tecan). Finally, luciferine
was added (20 mL) to each well plates and the plates were shaken. Luciferase activity was measured after 5 minutes of the addition of
the luciferine substrate in a Tecan Ultra Evolution detector.
The results of the screening were expressed as the activity percentage compared to 10 mM 9-RA, which has been considered as
100 % activity. Compounds showing an activity higher than 60% compared to 9-RA were considered as hits and were confirmed in
an independent assay. Finally, 11 compounds were considered possible activators of the human Mfn2 promoter.

Luciferase Reporter Assay

Several human cell clones that stably expresses luciferase under the control of 2 kb (region -1982/+54) of the human MFN2 promoter
were generated. Hela cells were transfected for 24 h with 10 mg of pGL3-Mfn2Prom plasmid encoding the luciferase reporter gene

e2 Cell Chemical Biology 25, 268–278.e1–e4, March 15, 2018

under the control of the MFN2 promoter with and neomycin resistance gene and 1 mg GFP expression vector, following the manu-
facturer’s instructions. To validate the cellular clones obtained, they were incubated with 9-cis-retinoic acid (9-RA) for 16 h. 9-RA acts
by binding to heterodimers of the retinoic acid receptor (RAR) and the retinoid X receptor (RXR). RAR-RXR complex binds to retinoic
acid response elements (RAREs) in the regulatory regions of direct targets, thereby activating gene transcription. Mfn2 promoter re-
sponds to 9-RA, which acts as a positive control generating luciferase enzyme. All the clones incubated with 9-RA exhibited a higher
transcriptional activity in relation to the control groups. One clone was selected. Luciferase activity was determined with the Lucif-
erase Assay System (Promega) in a luminometer Lumat LB 9507 (Berthold Technologies).

RNA Extraction and Real-Time PCR

RNA from cells was extracted by using RNeasy Mini Kit columns (Quiagen) following the manufacturer’s instructions. RNA was
reverse-transcribed with the SuperScriptTM II Reverse Transcriptase (RT) kit and oligo dT both from Invitrogen. PCRs were performed
with the ABI Prism 7900 HT real-time PCR machine (Applied Biosystems) and the SYBR Green PCR Master Mix or the TaqMan
Probes 203 (Applied Biosystems). All measurements were normalized to GAPDH. The oligonucleotide sequences for the primer pairs
used were as follows (given as 50 - to -30 , Table S1): MFN2 (human), forward: GACCAAGTTTGAGCAGCACACG, reverse: TTCACGC
ATTTCCTCGCAGTAA; GAPDH (human), forward: TGCACCACCAACTGCTTA, reverse: GAGGGCATGGACTGTGGTCAT; CYP1A1
(human), forward: GCTGACTTCATCCCTATTCT, reverse: GCTCCAGGAGATAGCAGTTG; Pgc1a (mouse), forward: GAAAGGGC
CAAACAGAGAGA, reverse: GTAAATCACACGGCGCTCTT; Pgc1b (mouse), forward: , reverse; Erra (mouse), forward: GGAG
GACGGCAGAAGTACAAA, reverse: GCGACACCAGAGCGTTCAC.

Western Blotting
Homogenates for western blot analyses were obtained from cell cultures. Cells were washed with PBS1x, homogenized with a 100 mL
of cold lysis buffer [50 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 2 mM sodium orthovanadate, 100 mM NaF, 20 mM sodium
pyrophosphate, 1% NP-40, and protease inhibitors Mini protease tablet (Roche)], and centrifuged at 700 3 g for 10 min to remove
nuclei and cellular debris. Proteins from total homogenates were resolved in 7.5%, 10% or 12.5% acrylamide gels for SDS/PAGE and
transferred to Immobilon membranes (Millipore). The antibodies used included: PARP (Cell Signaling; 1/1,000 diluted), caspase 3
(Cell Signaling; 1/1,000 diluted), VDAC-1/Porin (Abcam; 1/5,000 diluted), MFN1 (Abcam; 1/1,000 diluted), MFN2 (Abcam, 1/1,000
diluted), OPA1 (BD Transduction LaboratoriesTM, 1/1,000 diluted), DRP1 (BD Transduction LaboratoriesTM, 1/1,000 diluted), phos-
pho-DRP1 Ser616 (Cell Signaling, 1/1,000 diluted), FIS1 (BioVision Corporate Headquarters, 1/1,000 diluted), p70 S6 kinase
(Cell Signaling; 1/1,000 diluted), Phospho-p70 S6 kinase (Cell Signaling; 1/1,000), LC3 (MBL, 1/1,000 diluted), p62 (Progen,
1/1,000 diluted), BNIP3 (Abcam, 1/1,000 diluted), b-actin (Sigma-Aldrich; 1/10,000 diluted), and a-tubulin (Sigma-Aldrich; 1/5,000
diluted). Proteins were detected by the ECL method and quantified by scanning densitometry.

Confocal Microscopy and Morphological Analysis

HeLa expressing mtDsRed treated with leflunomide for 48 hr were fixed in 4% paraformaldehyde and analyzed with a confocal fluo-
rescence microscope. Immunofluorescence microscopy was performed with a Leica TCS SPE (Leica DM2500) confocal scanning
microscope. mtDsRed was scanned at 532 nm diode laser. Images were then processed with ImageJ software (NIH). The visualiza-
tion of living cells was performed in an inverted spinning disk microscope (Olympus IX 81 confocal) for fast acquisition and FRAPPA
processes, or in an automated fluorescence widefield microscopy with High content screening and TIRF for imaging wide areas auto-
matically at different z planes. Images were collected using a 561 nm excitation laser and emission was detected in red fluorescence
for Mitotracker Red CMXRos. C2C12, MEF wild-type, MEF Mfn2-/- and MEF Mfn1-/- cells stably expressing mtDsRed were plated on
22-mm glass coverslips, and the next day the cells were treated with leflunomide or myxothiazol for 48 and 12 h, respectively. Then,
live cells were placed in a chamber under culture conditions (DMEM at 37  C and 5% CO2), and were visualized. Images were then
processed with ImageJ software (NIH).
MEF Mfn1-/- cells were classified on the basis of their mitochondrial morphology: oval, short (< 5 mm), or elongated (> 5 mm) mito-
chondrial filaments. MEF Mfn2-/- cells were classified on the basis of their mitochondrial morphology: oval, short (< 9 mm), or elon-
gated (> 9 mm) mitochondrial filaments. At least 500 cells/sample were counted in triplicate samples/condition/experiment.

Labelling of Mitochondrial Compartment

MEF dKO cells were loaded with 100 nM Mitotracker Red CMXRos for the last 20 min of incubation in culture medium. They were then
washed with culture medium, and live cells were analyzed in in an automated fluorescence widefield microscopy with High content
screening and TIRF. Images were collected using a 561 nm excitation laser and emission was detected in red fluorescence for Mito-
tracker Red CMXRos. They were then processed with ImageJ software (NIH).

Mitochondrial Complex III Activity Assay

For determination of complex III activity, the Mitochondrial Complex III Activity Assay Kit (BioVision) was used, following manufac-
turer instruction. Briefly, MEF cells were grown in 15-cm diameter plates and incubated with or without leflunomide or myxothiazol,
and mitochondrial enriched fractions were obtained. Mitochondria enriched fractions from MEF cells were obtained by homogeni-
zation of a 15-cm plate of cells using a douncer with a Teflon pestle in homogenization buffer (0.25M sucrose, 50mM KCl, 5mM EDTA,
1 mM sodium pyrophosphate, 5 mM MgCl2, pH 7.4 and protease inhibitors tablet, Roche). Homogenates were centrifuged at 740 g

Cell Chemical Biology 25, 268–278.e1–e4, March 15, 2018 e3

for 5 min at 4 C. Supernatant was centrifuged at 9,000 g for 15 min at 4 C. The supernatant was the cytosolic fraction and the pellet
(mitochondria enriched fraction) was washed in homogenization buffer and resuspended in lysis buffer. Ten micrograms of mitochon-
drial enriched extracts were used for the assay.

Dihydroorotate Dehydrogenase (DHODH) Activity Assay

DHODH activity was determined by a fluorimetric method as described in (Yin et al., 2017). MEF cells were grown in 6-well plates and
incubated with either leflunomide or myxothiazol. Cell extracts were obtained and used for determination of DHODH activity.

Mitochondrial Respiration Assay

Respiration in cultured muscle cells was performed using the XF-24 Extracellular Flux Analyzer (Seahorse Bioscience, Billerica, MA).
C2C12 cells were seeded, in XF-24 plates. Respiration was measured in the presence of 5.5 mM glucose and 2 mM glutamine (basal
respiration), after addition of 5 mM oligomcyin (leak), 0.5 mM CCCP (maximal respiration) and 1 mM rotenone and 1 mM Antimycin
A (non-mitochondrial respiration).

QUANTIFICATION AND STATISTICAL ANALYSIS

Data are presented as mean ± SEM of a number of independent experiments (ranging from 3 to 5, and indicated in the figure legends)
and were analyzed with the Student’s t test with an appropriate post hoc test. Parameters used to quantify the data are reported in the
Figures and Figure Legends. N in the figure legends indicates the number of independent experiments (experimental replication). An
F-test of equality of variances was performed to demonstrate that the variance between groups was not different. Significance was
established at P < 0.05. Randomization/stratification, blinding, sample-size estimation and inclusion/exclusion criteria were not
applied in this study.

e4 Cell Chemical Biology 25, 268–278.e1–e4, March 15, 2018