Sei sulla pagina 1di 33

Struttura degli

acidi nucleici
aa 2019/2020
Conoscenza da dati
sperimentali
in vitro VS in vivo

In vitro
Espressione usata nel linguaggio scient. con riferimento a processi biologici
che si fanno avvenire in laboratorio, dentro una provetta o in altro
recipiente di vetro e, comunque, al di fuori dell’organismo vivente.

In vivo
Espressione usata nel linguaggio scient. con riferimento a osservazioni ed
esperimenti che si compiono su organismi viventi, in contrapp. a quelli
compiuti in vitro.
Livelli di struttura

Come per le proteine, anche per gli acidi nucleici si possono


identificare vari livelli di struttura, che rendono agevole la
descrizione e rappresentazione di tali molecole.

Si passa dalla semplice successione delle unità


fondamentali (nucleotidi, amminoacidi), la cosiddetta
sequenza primaria, a livelli di struttura via via più
complessi.
Livelli di struttura

Le proteine sono polimeri che si formano a partire da unità


fondamentali dette amminoacidi, la reazione che unisce tali unità,
mediante condensazione porta alla formazione di un legame covalente
(peptidico) tra il gruppo carbossilico di un amminoacido ed il gruppo
amminico di un secondo amminoacido.

Modificato da
By Mjeltsch - Own work, CC BY-SA 4.0,
https://commons.wikimedia.org/w/index.php?curid=79173222

La successione degli amminoacidi viene indicata come struttura


primaria (dall’N-terminale al C-terminale)

Khan Academy
N-MPPGAVYNNQDFWRRWHR-C Image modified from OpenStax Biology's modification of
work by the National Human Genome Research Institute
Livelli di struttura

Come per le proteine, anche per gli acidi nucleici (DNA, RNA) si parla di struttura primaria,
riferendosi alla successione delle sue unità fondamentali (i nucleotidi, riportati con il codice a
singola lettera della basi dall’estremità 5’ a quella 3’), che spesso viene anche denominata
sequenza nucleotidica

5’ CCAGGCGGCGGCGGCCAAACTCCGCGGCGTCCCCAGGGCGCCAGCTTCGCCCTCGCCGCCGCGGCCGCGCTGCTCTTCGGCTCCGACATGGAAGATGGACCTTCTAA 3’

Questa rappresentazione, che in numerose situazioni viene adottata, è solo il primo livello di
struttura degli acidi nucleici, la disposizione nello spazio degli atomi che li compongono è più
complessa
I mattoni del DNA e
del RNA: i nucleotidi
DNA e RNA sono polimeri, ovvero molecole costituite dalla ripetizioni di unità fondamentali.
Sono anche dette catene polinucleotidiche proprio ad indicare che alla base della loro
struttura vi sono unità come gli anelli di una catena. Queste unità sono dette nucleotidi e
sono costituite da 3 componenti: lo zucchero, la base azotata, gruppi fosfato.
E’ molto importante ricordare la denominazione della posizione degli atomi che costituiscono
le componenti del nucleotide, dato che spesso si fa riferimento a queste posizioni nella
descrizione della struttura degli acidi nucleici e dei processi molecolari a cui partecipano.
Lo zucchero è il ribosio per la molecola di RNA ed il
desossiribosio per il DNA. Le posizioni degli atomi
sono indicate da un numero con l’apostrofo (in
modo da non confonderle con le posizioni degli
atomi delle basi, anch’esse numerate). La differenza
tra i due zuccheri è la presenza di un gruppo
ossidrile legato al carbonio in posizione 2’ nel
ribosio. Questa caratteristica è importante in quanto
è alla base di alcune differenza tra RNA e DNA, che si
riflettono non solo sulla struttura ma anche sulla
stabilità della molecola ed altre caratteristiche
I mattoni del DNA e
del RNA: i nucleotidi
Le basi azotate sono 4 per ogni acido nucleico e suddivise in due tipologie in base al numero
degli anelli eterociclici, come è possibile notare, la posizione degli atomi degli anelli è
numerata in modo da renderne semplice l'identificazione.
RNA

DNA
I mattoni del DNA e
del RNA: i nucleotidi
La base azotata è legata al carbonio in posizione 1’ dello zucchero, mentre i gruppi fosfato
sono legati a livello del carbonio in posizione 5’ e sono distinti usando lettere dell’alfabeto
greco, cominciando dal più vicino allo zucchero.

γ β α BASE AZOTATA

Come si vede dalla diapositiva successiva i tre gruppi fosfato partecipano in modo diverso alla
reazione di polimerizzazione, sottolineando l’importanza della nomenclatura che li distingue
I mattoni del DNA e
del RNA: i nucleotidi
La base azotata è legata al carbonio in posizione 1’ dello zucchero mediante un legame N-
glicosidico. Nella rappresentazione seguente la posizione della base rispetto allo zucchero è
definita «anti».

dATP dGTP

dCTP
dTTP
Il legame fosfodiestere alla base
della catena polinucleotidica

SCHEMA DELLA REAZIONE DI POLIMERIZZAZIONE DEL DNA


α β γ
Deossinucleoside- P P P + Catena polinucleotidica nascente (n nucleotidi)
∆G = 0,5 kcal/mole
β γ
Catena polinucleotidica nascente (n + 1 nucleotidi) + P P
pirofosfato
∆G = - 7 kcal/mole

2 P

IL BILANCIO FINALE DELLA REAZIONE

∆Gtot = 0,5 - 7 kcal/mole = - 6,5 kcal/mole


Il legame fosfodiestere alla base
della catena polinucleotidica
RAPPRESENTAZIONE GRAFICA DELLA REAZIONE DI POLIMERIZZAZIONE DEL DNA

BASE BASE
AZOTATA AZOTATA

attacco Legame BASE


nucleofilo fosfodiesterico AZOTATA
BASE
AZOTATA

pirofosfato
I nucleotidi formano
una catena
La catena polinucleotidica ha una polarità (5’ 3’)
BASE
AZOTATA

BASE
La catena polinucleotidica presente una polarità, AZOTATA
cioè alle due estremità, gli atomi di carbonio non
impegnati nel legame fosfodiesterico sono diversi,
da un’estremità si trova il carbonio in posizione 5’, BASE
dall’altra il carbonio in posizione 3’. AZOTATA
La polarità della catena polinucleotidica è
importante non solo per la descrizione della
struttura del DNA e del RNA, ma anche per BASE
comprendere e descrivere vari processi che AZOTATA
riguardano queste molecole, dalla sintesi
(polimerizzazione) alla degradazione.
I nucleotidi formano
una catena

BASE
AZOTATA

La parte della catena costituita dallo zucchero


e dai gruppi fosfato viene detta anche BASE
scheletro zucchero-fosfato e la posizione delle AZOTATA
basi rispetto allo scheletro ha importanti
ripercussioni nelle varie strutture degli acidi BASE
nucleici, basti pensare alle caratteristiche AZOTATA
chimico-fisiche di queste due parti della
catena: lo scheletro zucchero-fosfato è
idrofilo, mentre la parte costituita dalle basi è BASE
idrofobica. AZOTATA
STRUTTURA
TRIDIMENSIONALE DEL DNA
Intorno agli anni ’50 vi era un gran fervore intorno
all’ipotesi della struttura tridimensionale del DNA, di
fondamentale importanza furono le informazioni
provenienti dai dati sperimentali ottenuti dalla
diffrazione a raggi X. Un approccio tanto semplice
quanto pragmatico e funzionale fu quello adottato da
Watson e Crick che si basò sull’uso di modelli di
cartone e fil di ferro, che permise loro di effettuare
una sorta di prove (esperimenti in senso lato) e di
formulare il modello della struttura tridimensionale
del DNA che oggi diamo per scontato. La struttura
proposta è nota come DNA di tipo B ed è caratterizzata
da una serie di elementi che permettono di descriverla
e distinguerla dalle altre forme di DNA. Innanzitutto, si By Dietmar Rabich, CC BY-SA 4.0,
tratta di una doppia elica, per cui bisogna considerare https://commons.wikimedia.org/w
/index.php?curid=84054526
due catene polinucleotidiche come quelle descritte in
precedenza (dette anche filamenti).
Caratteristiche della
struttura di tipo B
Innanzitutto partendo dal fatto che la catena polinucleotidica ha una polarità
emerge un’importante caratteristica del DNA, cioè l’antiparallelismo, in pratica i
due filamenti sono disposti testa-coda (antiparalleli).

LE DUE CATENE POLINUCLEOTIDICHE SONO ANTIPARALLELE


5’ 3’

3’ 5’
I legami a idrogeno
nell’appaiamento tra le basi
Il legame (o ponte) a idrogeno si stabilisce tra un atomo di idrogeno, che legato covalentemente ad un atomo molto
elettronegativo, l’ossigeno (O) o l’azoto (N), acquisisce una parziale carica positiva (δ+) ed un atomo elettronegativo di un’altra molecola
(δ-).

A T G C
G C
δ- δ+ δ-
δ+ δ-
8 7
7 δ-
8 9 5 6 δ- 4 5
5 6 4 5 δ- δ+
9 δ- δ- 4 1 3 6
4 1 3 6 3 2 2 1
3 2 δ+ 2 1
δ- δ+ δ-

A T
By Yikrazuul - Own work, Public Domain, By Isilanes - Own work, Public Domain,
https://commons.wikimedia.org/w/index.php?curid=5141568 https://commons.wikimedia.org/w/index.php?curid=2085972
I legami a idrogeno
nell’appaiamento tra le basi
In quest’altra rappresentazione
sono evidenti i legami ad
idrogeno che concorrono alla
A T
formazione della doppia elica. Il
numero dei legami è diverso tra la
coppia AT (2) e la coppia GC (3).
G C A
T

C G

La rappresentazione permette di cogliere anche un


altro aspetto del DNA, ovvero la successione delle
basi, detta anche sequenza di basi, che costituisce T A
il linguaggio nel quale è scritto «il libro della vita»
(proprio come la successione delle lettere
dell’alfabeto permette di formare le parole) C
G
I legami a idrogeno
nell’appaiamento tra le basi
La rappresentazione permette di cogliere anche un
altro aspetto del DNA, ovvero la successione delle
basi, detta anche sequenza di basi, che costituisce T
il linguaggio nel quale è scritto «il libro della vita» A
(proprio come la successione delle lettere
dell’alfabeto permette di formare le parole)
C G

5’ A C T G 3’
T A
3’ T G A C 5’
C
La sequenza di un filamento è G
complementare alla sequenza dell’altro
Caratteristiche della
struttura di tipo B
Innanzitutto partendo dal fatto che la catena polinucleotidica ha una polarità
emerge un’importante caratteristica del DNA, cioè l’antiparallelismo, in pratica i
due filamenti sono disposti testa-coda (antiparalleli).
LE DUE CATENE POLINUCLEOTIDICHE SONO ANTIPARALLELE
5’ 3’

3’ 5’
La rappresentazione precedente è di tipo bidimensionale, ma nella realtà, la
disposizione dei due filamenti è tale da somigliare ad una scala a chiocciola con
andamento destrorso che può essere paragonato al movimento delle dita della
mano destra mentre si chiudono 5’ 3’

5’ 3’
Caratteristiche della
struttura di tipo B
La rappresentazione riportata a fianco evidenzia altre
importanti caratteristiche. Innanzitutto gli scheletri
zucchero-fosfato si trovano all’esterno della molecola,
mentre le basi si affacciano all’interno, questa
disposizione è importante per comprendere la
stabilità di questa molecola in soluzione acquosa. I
gruppi fosfato (idrofili) carichi negativamente sono
rivolti verso l’ambiente acquoso, mentre le basi
azotate idrofobiche sono schermate all’interno.
Inoltre, nel modello proposto da Watson e Crick le
basi di un’elica interagiscono con quelle sullo stesso
piano dell’altra elica formando legami ad idrogeno e
quindi risultando accoppiate. Una purina si accoppia
con una pirimidina. Le due coppie sono : AT e GC.
Caratteristiche della
struttura di tipo B
La rappresentazione riportata a fianco evidenzia altre
importanti caratteristiche. Innanzitutto gli scheletri
zucchero-fosfato si trovano all’esterno della molecola,
mentre le basi si affacciano all’interno. Le coppie di
basi consecutive sono ruotate di 36° in media.

Visione laterale di una


coppia di basi consecutiva

36°
Visione dall’alto di una
coppia di basi consecutiva
Caratteristiche della
struttura di tipo B
Il DNA di tipo B è caratterizzato da una
serie di parametri che come gli elementi di 3,4 Å
una carta d’identità permettono di
Solco maggiore
descrivere particolari caratteristiche della 22 Å (2,2nm)
struttura. Passo dell’elica
Giro completo
dell’elica lungo 34 Å, Solco minore
Con in media 10,5 12 Å (1,2nm)
coppie di basi

Di particolare rilevanza è la presenza di


due solchi di diverse dimensioni. Infatti le
basi azotate, e quindi la loro sequenza,
intesa come successione (come le lettere
in una parola), sono diversamente esposte
e disponibili ad interazioni con altre
Diametro dell’elica
molecole (ad esempio proteine). 20 Å (2nm)
Caratteristiche della
struttura di tipo B
IL LIBRO DI ISTRUZIONI
Come viene letto (interpretato)?
Proteine in grado di
«riconoscere» un istruzione
(cioè una sequenza di basi)

Nell’immagine è mostrato un dominio ad alfa elica


di una proteina che può stabilire legami con le basi
all’interno del solco maggiore. Queste interazioni
sono molto importanti perché sono alla base della
lettura della sequenza di basi da parte di varie
proteine che devono interagire con il DNA proprio
in maniera sequenza specifica.
Altre interazioni
concorrono alla struttura

I legami idrogeno che si stabiliscono tra le basi non


sono gli unici a concorrere alla stabilità della struttura
del DNA, molto importante è anche l’effetto idrofobico
dell’impilamento (stacking) delle basi dei piani contigui.
Se si immagina di guardare la doppia elica lungo il
proprio asse come nell’immagine a fianco, si possono
notare gli scheletri zucchero-fosfato all’esterno, e
all’interno di questo cilindro virtuale, una fitta zona
dove le base dei vari piani si sovrappongono.
La sovrapposizione delle basi dei vari piani, seppur non
perfetta, da il proprio contributo con un’energia di
impilamento differente a seconda delle coppie di basi
«impilate».
Altre caratteristiche
della struttura del DNA
Sebbene per semplicità la doppia elica può essere immaginata e rappresentata come una scala
a chiocciola con le coppie di basi parallele le une alle altre (proprio come i gradini), in realtà
questo parallelismo non è quasi mai perfetto. E’ possibile infatti descrivere situazioni alternative
a due piani perfettamente paralleli. Tra i parametri descrittivi si identificano i seguenti.

Visione laterale di una


coppia di basi consecutiva

Propeller TWIST TWIST ROLL TILT

Visione laterale di una Visione laterale di una


coppia di basi consecutiva coppia di basi consecutiva
Visione laterale di una Visione dall’alto di una
coppia di basi coppia di basi consecutiva
Queste inclinazioni dipendono dalla sequenza delle coppie di basi nel DNA, per cui ci sono zone del DNA
«intrinsecamente» predisposte a formare curvature. Varie evidenze hanno suggerito che tali curvature
abbiano una funzione biologica, ad esempio anche nel «posizionamento» del nucleosoma, l’unità
fondamentale della cromatina di cui il DNA genomico fa parte nelle cellule eucariotiche.
Strutture alternative al
DNA di tipo B
La struttura del DNA di tipo B, fino ad ora descritta, è quella principale in condizioni fisiologiche. Sono
possibili anche strutture alternative, tra cui la forma A e la forma Z. Tutte le forme sono caratterizzate da
specifici parametri che definiscono la loro organizzazione nello spazio.
Strutture alternative al
DNA di tipo B
La struttura del DNA di tipo B, fino ad ora descritta, è quella principale in condizioni fisiologiche. Sono
possibili anche strutture alternative, tra cui la forma A e la forma Z. Di seguito una rappresentazione delle
tre forme con in rosso gli atomi esposti nel solco minore.
B: in soluzione alto grado di umidità,
vicina alla struttura in condizioni
fisiologiche
A: in soluzione a basso contenuto d’acqua,
in condizioni fisiologiche si manifesta in
presenza di complessi con proteine
Z: in soluzione si manifesta per sequenze
di purine e pirimidine alternate e elevate
A concentrazioni di cationi (Na+)
B Z
La forma Z è particolarmente diversa dalle altre, in quanto sinistrorsa e a zig zag. Alla base di tale struttura
vi è la particolare disposizione della base rispetto allo zucchero, nella forma B, la conformazione è ANTI, in
questo caso SYN (diapositiva successiva), esponendo la base all’esterno dell’elica.
Al seguente link è possibile visualizzare in maniera interattiva le 3 strutture
alternative del DNA e familiarizzare con le differenze sostanziali.
https://proteopedia.org/wiki/index.php/Forms_of_DNA
DNA di tipo Z

ANTI SYN
L’importanza del rapporto
struttura/funzione
in vivo può dipendere dalla presenza di superavvolgimenti del
DNA, specifiche proteine, modifiche delle basi. Quindi, oltre ad
una specifica sequenza nel DNA, altre condizioni possono
favorire la formazione del DNA Z (si può parlare di regolazione).

in vivo potrebbe influenzare la trascrizione dei geni

Esistono proteine che interagiscono con il DNA Z


[Z-DNA-binding proteins (ZBPs)]

Ravichandran et al. 2019. Biophysical Reviews. 11:383–387


La tripla elica del DNA

Si forma in presenza di tratti


polipirimidinici (Y) o polipurinici (R),
grazie alla formazione di legami ad
idrogeno non canonici detti
“appaiamenti di Hoogsteen”

Ruolo naturale ancora ignoto, ma di


interesse per diverse applicazioni in
quanto può influenzare la funzione dei
geni. Oligonucleotidi sintetici possono
essere usati per interagire con
specifiche sequenze di DNA (targeting)
Stephen Neidle. Principles of Nucleic Acid
Structure. 2008. Academic Press

DNA H (tripla elica intramolecolare)

Jain et al. Biochimie. 2008 Aug; 90(8): 1117–1130.


TARGETING

Targeting system

5’CCAGGCGGCGGCGGCCAAACTCCGCGGCGTCCCCAGGGCGCCAGCTTCGCCCTCGCCGCCGCGGCCGCGCTGCTCTTCGGCTCCGACATGGAAGATGGACCTTCTAA 3’
3’GGTCCGCCGCCGCCGGTTTGAGGCGCCGCAGGGGTCCCGCGGTCGAAGCGGGAGCGGCGGCGCCGGCGCGACGAGAAGCCGAGGCTGTACCTTCTACCTGGAAGATT 5’
Il quartetto G

Un’altra struttura particolare che si è dimostrato poter essere presente sia nel DNA che nel RNA è il
cosiddetto quartetto G. In questo caso, riguarda tratti a singolo filamento dove sono presenti almeno 3 G
consecutive. Come mostrato in B da una visione dall’alto le 4 G sono disposte sullo stesso piano e
formano appaiamenti di Hoogsteen.

R rappresenta lo zucchero
DNA cruciforme

5’CCAGGCGGCGGCGGCCAAACTCCGCGGCGTCCCCAACCTGTACAGGTCGCCCTCGCCGCCGCGGCCGCGCTGCTCTTCGGCTCCGACATGGAAGATGGACCTTCTAA 3’
3’GGTCCGCCGCCGCCGGTTTGAGGCGCCGCAGGGGTTGGACATGTCCAGCGGGAGCGGCGGCGCCGGCGCGACGAGAAGCCGAGGCTGTACCTTCTACCTGGAAGATT 5’

5’CCAGGCGGCGGCGGCCAAACTCCGCGGCGTCCCCAACCTGTACTCACAGGTCGCCCTCGCCGCCGCGGCCGCGCTGCTCTTCGGCTCCGACATGGAAGATGGACCTT 3’
3’GGTCCGCCGCCGCCGGTTTGAGGCGCCGCAGGGGTTGGACATGAGTGTCCAGCGGGAGCGGCGGCGCCGGCGCGACGAGAAGCCGAGGCTGTACCTTCTACCTGGAA 5’

C T
Ripetizioni invertite: sequenze identiche in ANSA
A C
orientamento opposto
T A
Palindrome: quando tali sequenze sono
G C
adiacenti STELO
T A
C G
C G
GTCCCCA A T CGCCCTC 3’
5’
Struttura cruciforme 3’ CAGGGGT T A GCGGGAG 5’
G C
G C
A T
C G
A T
T G
G A