Sei sulla pagina 1di 210

LP5: Culturile în vitro

Culturile in vitro

2
Scurt istoric al culturilor in vitro

• - 1902 - Haberlandt proposed concept of in vitro cell culture • - 1964 - Guha and Maheshwari produced first haploid
• - 1904 - Hannig cultured embryos from several cruciferous species plants from pollen grains of Datura (Anther culture)
• - 1922 - Kolte and Robbins successfully cultured root and stem • - 1966 - Steward demonstrated totipotency by
tips respectively regenerating carrot plants from single cells of tomato
• - 1926 - Went discovered first plant growth hormone –Indole • - 1970 - Power et al. successfully achieved protoplast
acetic acid fusion
• - 1934 - White introduced vitamin B as growth supplement in • - 1971 - Takebe et al.regenerated first plants
tissue culture media for tomato root tip
from protoplasts
• - 1939 - Gautheret, White and Nobecourt established
• - 1972 - Carlson produced first interspecific hybrid of
endless proliferation of callus cultures
Nicotiana tabacum by protoplast fusion
• - 1941 - Overbeek was first to add coconut milk for cell division in
Datura • - 1974 – Reinhard introduced biotransformation in
plant tissue cultures
• - 1946 - Ball raised whole plants of Lupinus by shoot tip culture
• - 1977 - Chilton et al. successfully integrated Ti
• - 1954 - Muir was first to break callus tissues into single cells
plasmid DNA from Agrobacterium tumefaciens in
• - 1955 - Skoog and Miller discovered kinetin as cell division hormone plants
• - 1957 - Skoog and Miller gave concept of hormonal control • - 1978- Melchers et al. carried out somatic hybridization
(auxin: cytokinin) of organ formation of tomato and potato resulting in pomato
• - 1959 - Reinert and Steward regenerated embryos from • - 1981- Larkin and Scowcroft introduced the
callus clumps and cell suspension of carrot (Daucus carota)
term somaclonal variation
• - 1960 - Cocking was first to isolate protoplast by enzymatic
degradation of cell wall • - 1983 - Pelletier et al.conducted intergeneric cytoplasmic
hybridization in Radish and Grape
• - 1960 - Bergmann filtered cell suspension and isolated single cells
by plating • - 1984 - Horsh et al. developed transgenic tobacco
• - 1960 - Kanta and Maheshwari developed test tube by transformation with Agrobacterium
fertilization technique • - 1987 - Klien et al. developed biolistic gene transfer
• - 1962 - Murashige and Skoog developed MS medium with method for plant transformation
higher salt concentration • - 2005 - Rice genome sequenced under International
Rice Genome Sequencing Project
Plant Tissue Culture: Current Status and Opportunities,
Altaf Hussain, Iqbal Ahmed Qarshi, Hummera Nazir and Ikram Ullah,
Exemple de culturi “in vitro” :

• Culturi de plante sau organe întregi (ex. seminţe)


• Embriocultura
• Cultura de organe/fragmente de organe
1. meristeme apicale din tulpină
2. meristeme radiculare
3. frunze
4. antere
• Cultura de calus
• Cultura de suspensii de celule
• Cultura de protoplaşti

4
Termeni frecvent utilizaţi în culturile in vitro de ţesuturi
Altaf Hussain, Iqbal Ahmed Qarshi, Hummera Nazir and Ikram Ullah,
Recent Advances in Plant in vitro Culture
ISBN 978-953-51-0787-3, 2012, Publisher: InTech

Termen Semnifica
ţie

Adventitious development of organs such as buds, leaves, roots, shoots and somatic embryos from shoot and root tissues and callus

Agar natural gelling agent made from algae

Aseptic technique procedures used to prevent the introduction of microorganisms such as fungi, bacteria, viruses and phytoplasmas into
cell, tissue and organ cultures, and cross contamination of cultures

Autoclave a machine capable of sterilizing by steam under pressure

Axenic culture a culture without foreign or undesired life forms but may include the deliberate co-culture with different types of cells,
tissues or organisms
Callus an unorganized mass of differentiated plant cells

Cell culture culture of cells or their maintenance in vitro including the culture of single cells

Chemically defined a nutritive solution or substrate for culturing cells in which each component is specified
medium
Clonal propagation asexual multiplication of plants from a single individual or explant

Clones a group of plants propagated from vegetative parts, which have been derived by repeated propagation from a single
individual. Clones are considered to be genetically uniform

Contamination infected by unwanted microorganisms in controlled environment

Cryopreservation ultra-low temperature storage of cells, tissues, embryos and seeds

Culture a plant growing in vitro in a sterile environment


Differentiated cultured cells that maintain all or much of the specialized structure and function typical of the cell type in vivo

Embryo culture in vitro culture of isolated mature or immature embryos

Explant an excised piece or part of a plant used to initiate a tissue culture


Termeni frecvent utilizaţi în culturile in vitro de ţesuturi
Altaf Hussain, Iqbal Ahmed Qarshi, Hummera Nazir and Ikram Ullah,
Recent Advances in Plant in vitro Culture
ISBN 978-953-51-0787-3, 2012, Publisher: InTech

Termen Semnifica
ţie

Ex vitro organisms removed from tissue culture and transplanted; generally plants to soil or potting mixture.

Hormone generally naturally occurring chemicals that strongly affect plant growth

In Vitro to be grown in glass

In Vivo to be grown naturally

Laminar Flow Hood an enclosed work area where the air is cleaned using HEPA filters

Medium a solid or liquid nutritive solution used for culturing cells

Meristem a group of undifferentiated cells situated at the tips of shoots, buds and roots, which divide actively and give rise to
tissue and organs

Micropropagation multiplication of plants from vegetative parts by using tissue culture nutrient medium

Propagule a portion of an organism (shoot, leaf, callus, etc.) used for propagation

Somatic embryos non-zygotic bipolar embryo-like structures obtained from somatic cells

Subculture the aseptic division and transfer of a culture or portion of that culture to a fresh synthetic media

Tissue culture in vitro culture of cells, tissues, organs and plants under aseptic conditions on synthetic media

Totipotency capacity of plant cells to regenerate whole plants when cultured on


appropriate media
Transgenic plants that have a piece of foreign DNA

Undifferentiated cells that have not transformed into specialized tissues


Abrevieri utilizate în culturile in vitro

• BAP 6 - Benzylaminopurine
• 2,4 D - 2,4-dichlorophenoxyacetic acid
• EDTA - Ethylenediaminetetraacetic acid
• EtOH - Ethanol
• GA3 - Gibberellic acid
• IAA - Indole-3-acetic acid
• IBA - lndole-3-butyric acid
• NAA - Naphthaleneacetic acid
• KN - Kinetin
Mediul de cultură MS (Murashige, T. & F. Skoog)

Peter V. Minorsky, 2001. Tribute to Folke Skoog,


Plant Physiology April 2001 vol. 125 no. 4 1546-1547
1 Jablonski JR, Skoog F(1954) Cell enlargement and cell division
in excised tobacco pith tissue. Physiol Plant 7:16–24.
2 Miller CO, Skoog F, von Saltza MH, Strong FM(1955) Isolation,
structure and synthesis of kinetin, a substance promoting cell division. J
Am Chem Soc 78:1375–1380.
3 Murashige T, Skoog F(1962) A revised medium for rapid growth and
bio-assays with tobacco tissue cultures. Physiol Plant 15:473–497.
4 Niedergang-Kamien E, Skoog F(1956) Studies on polarity and auxin
transport in plants: I. Modification of polarity and auxin transport by
Mediu de cultură Murashige Skoog, Kit hormoni creştere plante, triiodobenzoic acid. Physiol Plant 9:60–73.
produs produs comercial, cca. 15 £ comercial, cca. 170 £ 5 Skoog F(1937) A de-seeded Avena test method for small amounts of
auxin and auxin precursors. J Gen Physiol 20:311–334.
6 Skoog F(1940) Relationships between zinc and auxins in the growth of
higher plants. Am J Bot 27:939–951.
7 Skoog F, Armstrong DJ, Cherayil JD, Hampel AE, Bock RM(1966)
Cytokinin activity: localization in transfer RNA preparations. Science
154:1354–1356.
8 Skoog F, Hamzi H, Szweykowska A, Leonard N, Carraway K, Fujii
T, Helegson J, Loeppky RN(1967) Cytokinins: structure/activity
relationships. Phytochemistry 6:1169–1192.
9 Skoog F, Tsui C(1948) Chemical control of growth and bud formation in
tobacco stem segments and callus cultured in vitro. Am J Bot 35:782–787.
http://www.timstar.co.uk/Category/0/Science_Supplies~A- 10 Thimann KV, Skoog F(1933) Studies on the growth hormone of plants:
Z_OF_SUPPLIES~Supplies_N_-_P~Plant_biology.html III. The inhibiting action of the growth hormone on bud development. Proc
Natl Acad Sci USA 19:714–716.

Murashige, T. & F. Skoog, 1962.


A revised medium for rapid growth and bioassay with tobacco
tissue cultures. Physiologia Plantarum 15: 473-497.
Mediile de cultură: Tipuri

I II III
Mediu cultură Mediu cultură
pentru alge pentru rădăcini
(Uspenski, (White, 1943)
1927)

Soluţii nutritive pentru


cultura plantelor întregi

Mediu nutritiv cu
săruri minerale
(Knop, 1865) Mediu cultură
pentru calus
(Gautheret, 1939)
U s p e n s k i E. E. (1927), Eisen als Faktor für die Verbreitung Gautheret, R. (1939). Sur la possibilité de réaliser la culture indéfinie des
niederer Wasserpflanzen, Pflanzenforschung, 9, Jena, citat de tissues de tubercules de carotte. C. R. Soc. Biol. Paris 208: 118–120, citat
Stefan GUMINSKI, în OUTLINE OF THE HISTORY OF STUDIES de Ian M. Sussex, în THE SCIENTIFIC ROOTS OF MODERN PLANT
ON THE EFFECT OF HUMIC COMPOUNDS ON ALGAE BIOTECHNOLOGY, The Plant Cell, 2008 vol. 20 no. 5 1189-1198
Oceanologia, 17 (1983), PL ISSN 0078-3234
Compoziţia de bază a mediilor de cultură

1. MACROELEMENTE(macronutrients, c% > 0,5 mM.l-1):


8. REGULATORI DE CREŞTERE
C, H, O, N, P, K, Ca, Mg, S
8.1. Auxine vegetale sau sintetice (stimulare
2. MICROELEMENTE (micronutrients, c% < 0,5 mM.l-1): calus, crestere, initiere lăstărire şi
Fe, Mn, Zn, B, Cu, Mo, facultativ Co, I, Na, Cl înrădăcinare) :
3. VITAMINE (catalizatori în procese metabolice): IAA (indol-3-acetic acid)
thiamină (B1), acid nicotinic, pyridoxină (B6), biotină, acid IBA (indole-3-butiric acide)
folic, acid ascorbic, acid panthotenic, tocoferol (E), 2,4-D (2,4-dichlorophenoxy-acetic acide)
riboflavina, acid p-amino benzoic NAA (naphtalene-acetic acid)
2,4,5 T, dicamba, picloram etc.
4. AMINOACIZI (nitrogen supplements mixtures):
cazeină hidrolizată, L-glutamină, L-asparagină, adenină, 8.2. Citokinine (stimulare diviziune celulară, inducerea
glicină, asparagină, arginină, cisteină, tirozină etc. formării lăstarilor, inhibarea formării rădăcinilor)
(surse de N organic, uşor asimilabil) BAP (6-benzyloaminopurine)
2iP (8-dimethylaminopurine)
5. SURSE DE CARBON ŞI ENERGIE:
Kinetina (N-2-furanymethyl-1H-purine-6-amine)
sucroză 2-5%; lactoză, galactoză, maltoză, amidon Zeatina, Benziladenina etc.
6. SUPLIMENTE ORGANICE (extracte naturale): 8.3. Gibereline (dezvoltarea calusului, elongarea plantuleler
hidrolizate proteice, lapte de cocos, extract de la întuneric): > 20 compuşi, GA3 (foarte frecvent folosit)
drojdie, 8.4. Acid abscisic (inhibare/stimulare creştere calus,
extract de malţ, extract de banane, melasă de trestie imbunătăţire proliferare lăstari)
de zahăr, suc de portocale, suc de tomate, cărbune de Fossard R. Tissue culture for plant propagation. Armidale: University of
vegetal (activated charcoal) New England; 1976, citat de Abobkar I. M. Saad and Ahmed M. Elshahed, în
Plant Tissue Culture Media, Recent Advances in Plant in vitro Culture, 2012,
7. AGENŢI DE SOLIDIFIERE: agar, agaroză, gumă gellan Publisher: InTech, www.intechopen.com/../recent-advances-in-plant-in-vitro-
(soluţie apoasă polizaharide din bacteria Pseudomonal elodea); făină culture
albă, amidon de cartof, pudră de orez
Exemple de medii de cultură

Macro- MS G5 LM VW Km NN
elemen W M
te Murashige Gambo Lloyd şi Vacin şi Kudson Nitsch şi
White Mitra el
şi Skoog rg et McCown Went modific Nitsch
mg.l1- all. at
all.

Ca3(PO4)2 200.0

NH4NO3 1650.0 400.0 720.0

KNO3 1900.0 2500.0 80.0 525.0 180.0 180.0 950.0

CaCl2.2H2O 440.0 150.0 96.0 166.0

MgSO4.7H2O 370.0 250.0 720.0 370.0 250.0 250.0 250.0 185.0

KH2PO4 170.0 170.0 250.0 150.0 150.0 68.0

(NH4)2SO4 134.0 500.0 100.0 100.0

NaH2PO4.H2O 150.0 16.5

CaNO3.4H2O 300.0 556.0 200.0 200.0

Na2SO4 200.0

KCl 65.0

K2SO4 990.0

Abobkar I. M. Saad and Ahmed M. Elshahed, în Plant Tissue Culture Media, Recent Advances in Plant in vitro
Culture, 2012, Publisher: InTech, www.intechopen.com/../recent-advances-in-plant-in-vitro-culture
Exemple de medii de cultură

Micro- MS G5 LM VW Km NN
elemen W M
te Murashige Gambo Lloyd şi Vacin şi Kudson Nitsch şi
White Mitra el
şi Skoog rg et McCown Went modific Nitsch
mg.l1- all. at
all.

KI 0.83 0.75 0.75 80.0 0.03

H3BO3 6.20 3.0 1.5 6.2 6.2 0.6 10.0

MnSO4.4H20 22.30 7.0 0.75 0.075 25.0

MnSO4.H2O 10.0 29.43

ZnSO4.7H2O 8.6 2.0 2.6 8.6 0.05 10.0

Na2MoO4.2H2 0.25 0.25 0.25 0.25 0.05 0.25


O

CuSO4.5H2O 0.025 0.025 0.25 0.025 0.025

CoCl2.6H2O 0.025 0.025 0.025

Co(NO3)2.6H2 0.05
O

Na2EDTA 37.3 37.3 37.3 74.6 37.3 37.3

FeSO4.7H2O 27.8 27.8 27.8 25.0 27.8 27.8

MnCl2 3.9 0.4


Fe(C4H4O6)3.2 28.0
H

2O
Exemple de medii de cultură

Vitamine
, alte MS G5 W LM VW Km M NN
suplimen Murashige Gambo Lloyd şi Vacin şi Kudson Nitsch şi
te mg.l1- White Mitra el
şi Skoog rg et McCown Went modific Nitsch
all.
all. at

Inositol 100.0 100.0 100.0 100.0

Glycine 2.0 2.0 3.0 2.0 2.0

Thiamine HCl 0.1 10.0 0.1 1.0 0.3 0.3 0.5

Pyridoxine HCl 0.5 0.1 0.5 0.3 0.3 0.5

Nicotinic acid 0.5 0.5 0.5 1.25 5.0

Ca- 1.0
panthothen
ate

Cysteine HCl 1.0

Riboflavin 0.3 0.05

Biotin 0.05 0.05

Folic acid 0.3 0.5


Abobkar I. M. Saad and Ahmed M. Elshahed, în Plant Tissue Culture Media, Recent Advances in Plant in vitro
Culture, 2012, Publisher: InTech, www.intechopen.com/../recent-advances-in-plant-in-vitro-culture
14

LP6: Embriogeneza somatică


Exemple de culturi “in vitro” (LP3):

• Culturi de plante sau organe întregi (ex. seminţe)


• Embriocultura
• Cultura de organe/fragmente de organe
1. meristeme apicale din tulpină
2. meristeme radiculare
3. frunze
4. antere
• Cultura de calus
• Cultura de suspensii de celule
• Cultura de protoplaşti
Embriocultura?

Celula somatica?

Somaclona?

Hibridul somatic?
Embriocultura? = cultura de embrioni imaturi

Celula somatica? = toate celulele corpului (cu excepția celor sexuale). Este diploidă,
având 2n cromozomi.

Somaclona? = este descendenţa vegetativă obţinută prin multiplicarea


unei celule somatice.

Hibridul somatic? = contopirea a două celule somatice (fuziune de protoplaşti-LP4)


Definitie?
Definitie:

Embriogeneza somatică „in vitro” presupune regenerarea de embrioni


somatici (sau adventivi) din fragmente de ţesuturi, calus, din celule izolate sau
agregate celulare în suspensii.
Definitie:

Embriogeneza somatică „in vitro” presupune regenerarea de embrioni


somatici (sau adventivi) din fragmente de ţesuturi, calus, din celule izolate sau
agregate celulare în suspensii.

Embrionia adventivă presupune formarea embrionilor seminţelor fără


fecundare, din celule somatice situate înafara sacului embrionar (ale chalazei
şi nucelei) care, fiind în apropiere, pot pătrunde în sacul embrionar şi se pot
dezvolta ca embrioni.
Tipuri de embriogeneza somatică:

DIRECTĂ :
celule/ţesuturi ale explantelor -> embrioni

INDIRECTĂ:
celule ale explantelor -> calus/suspensie celulară -> embrioni somatici
a1 a2
a1. Recoltarea şi fragmentarea
embrionilor imaturi din ovule
h b
a2. Prelevarea de explante din alte
organe ale plantelor (ex. frunze)

g d b. Iniţierea culturii de embrioni “in


vitro”
c. Criostocarea (facultiv)
d. Multiplicarea embrionilor tineri în

f e culturi cu suspensii de celule


e. Maturarea embrionilor
f. Germinarea embrionilor somatici
pe mediu solid
g. Aclimatizarea plantulelor în seră
h. Transferul plantelor în
pepinieră/ locul de plantare
definitiv
• stadiul „globular” (începe formarea
ţesuturilor)

• stadiul de „inimă” (apar cele două


cotiledoane)

• stadiul de „torpilă” (cotiledoanele se


alungesc, se formează axul principal)

• stadiul „cotiledonar” (cotiledoan


e
complet formate, meristemel
e
apar
primare la hipocotilulu
i
extremităţile
(apical- înt cotiledoane
caulinar re
şi
apical- în partea
radicular
opusă
cotiledoanelor
)

• stadiul de “maturare” (sinteza


substanţelor de rezervă, deshidratarea şi
intrarea în stare de latenţă a
Embriogeneza la gâscariţă (Arabidopsis thaliana) embrionului) având ca finalitate
(Taiz L., Zeiger E., 2010)
sămânţa.
Alunul de pământ (Arachis hypogaea)
Rapita (Brassica napus)

(A,B) Microspori la inceput.

(C,D) Proembrioni formati din


patru celule inconjurate de exine
(peretele celular al microsporilor)

(E) Cultura “in vitro” dupa 4 zile

(F,G) Embrion globular

(H) Embrion torpila.

(I) Cultura “in vitro” dupa 30 zile


(se observa morfologia
caracteristica a embrionilor
in stadiul cotiledonar;

Bars represent, in (A–D) 10 μm, in (E) 250 μm, in (F,G) 50 μm, in (H) 100 μm, in (I) 1mm. 14
• Iniţierea embriogenezei are loc artificial

• Suspensorul (formaţiune ce are rolul de a împinge embrionul în mediul


nutritiv al macroprotalului) lipseşte, fiind înlocuit de către mediul de
cultură

• Obţinerea unei embriogeneze somatice recurente la nivelul hipocotilului

• Absenţa latenţei embrionului


• Alegerea tipului de explant (inocul), în funcţie de specie, organ, vârstă, faza
de vegetaţie, condiţiile de vegetaţie, numărul de repicări (pasaje) de la
prima inoculare.

• Mediile de cultură bogate în azot (azotat de amoniu) ce facilitează o bună


inducere a embriogenezei şi o bună maturare a embrionilor.

• Regulatorii de creştere (auxinele în primele etape, pentru stimularea


rizogenezei, citochininele ulterior, pentru stimularea caulogenezei).

• Condiţiile de cultură specifice (to, u%, O2).

• Tipul mediului de cultură (lichid, solid).


1. Obţinerea unui număr foarte mare de copii ale unui organism valoros într-
un timp foarte scurt. Embrionii somatici obţinuţi pot fi transformaţi în
“seminţe artificiale” prin încapsularea lor în materiale specifice,
degradabile în sol, putând fi apoi uşor de păstrat (în bănci de gene),
transportat, semănat mecanizat.
2. Plantele rezultate din embrionii somatici sunt identice din punct de
vedere genetic cu planta donatoare.

3. Plantele primei generaţii obţinute din embrioni somatici sunt libere de


agenţi fitopatogeni, uniforme, viguroase şi cu însuşiri calitative
deosebite.

4. Embrionii somatici pot reprezenta un tip de biomasă necesară obţinerii


unor produşi secundari valoroşi.

5. Utilizarea embrionilor somatici în ameliorarea plantelor:


• mutageneză
• obţinerea formelor haploide (n)
• obţinerea liniilor izogene homozigote (monohaploizi din diploizi,
dihaploizi din tetraploizi, trihaploizi din hexaploizi), pure din punct
1. Latenţa embrionilor somatici nu este controlată încă suficient, respectând
specificul donatorului;
2. Procentul embrionilor somatici rezultaţi „in vitro” dintr-un explant (inocul) este
destul de redus (< 50%);
3. Preţul de realizare a propagulelor este, adesea, foarte ridicat;
4. În unele cazuri, sunt necesare metode particulare de multiplicare pentru fiecare
specie sau chiar pentru anumite genotipuri în cadrul speciei;
5. Propagulele au, cel mai adesea, o vigoare redusă, ceea ce creează probleme la
înrădăcinare;
6. Faza “in vitro” poate prelungi o perioadă de repaus germinativ sau vegetativ;
7. Pot apărea selectii de compuşi toxici;
8. Stabilitatea genetică este, uneori, prea scazută (insuficientă) pentru ameliorare;
9. Regenerarea este, adesea, dificilă;
10. Ţesuturile răspund în mod diferit la manipularea “in vivo”;
11. Speciile agricole prezintă, în mod frecvent, o ridicată “rezistenţă” la manipularea
“in vitro”
Embriogeneza somaticǎ - Intrebari

?
gaburi@uaiasi.ro
LP7: Hibridarea somatica
Fuzionarea protoplastilor
Embriogeneza somatica ?

Hibridarea somatica ?

2
Embriogeneza somatica :

Embriogeneza somatică „in vitro” presupune regenerarea de embrioni


somatici (sau adventivi) din fragmente de ţesuturi, calus, din celule izolate sau
agregate celulare în suspensii.

Hibridarea somatica = contopirea a două celule somatice (fuziunea de protoplaşti)

3
Denumire/definiţii

prōtóplastos = first-formed (în greaca veche),

În biologia modernă:
Termen introdus de Hanstein în 1880

Celulă vegetală, bacteriană sau fungică, al


cărui perete celular a fost îndepărtat total sau
parţial prin metode mecanice sau enzimatice.

• Shoot regeneration from Arabidopsis thaliana protoplast


Unitate biologică vie, sferică, compusă din: derived calli
 plasmalemă
 citoplasmă
 nucleu
 vacuolă
 organite citoplasmatice
 cloroplaste
 mitocondrii

4
 Lipsa peretelui celular

 Semipermeabilitate selectivă

 Formă sferică

 Sensibilitate la presiunea osmotică

 Capacitate de creştere şi diviziune

 Capacitate de a fuziona

 Capacitate de regenerare a
peretelui celular (totipotenţă)

 Pot fi izolaţi dintr-o gamă largă de


• Protoplast fusion: Cells of Petunia sp. leaves (with chloroplasts).
ţesuturi şi organe vegetale tinere Left cell was merged with a protoplast from Impatiens neuguinea
petals (with coloured vacuole).
Photo was taken through the eye-piece of a microscope (10x
object lense, 10x ocular),
• http://en.wikipedia.org/wiki/File:Protoplast_fusion.jpg

5
W.P. Armstrong, 2012
http://waynesword.palomar.edu/lmexer1.htm#elodea

6
1. Izolarea protoplaştilor
mecanică enzimatic
ă

2. Purificarea protoplaştilor
Filtra Purifica Spăla
re re re

3. Fuziunea protoplaştilor

4. Identificarea şi selecţia protoplaştilor hibrizi

5. Cultura de protoplaşti hibrizi

6. Regenerarea şi caracterizarea plantelor hibride


7
http://nptel.ac.in/courses/102103016/13
Fuzionarea protoplastilor – Surse de material biologic

• frunze tinere
• apexuri
• rădăcini
• fructe
• petale
• coleoptile
• cotiledoane
• noduri rădăcini
• meristeme embrionare
• suspensii celulare embriogene

9
Klercker, 1892, citat de Cocking, 1972 Protoplast isolation flowchart for the cutting method
- http://www.slideshare.net/shivam_hayabusa/protoplast- (upper) and the Tape-Arabidopsis Sandwich method (lower).
culture Wu et al. Plant Methods 2009 5:16 doi:10.1186/1746-4811-5-
- http://nptel.ac.in/courses/102103016/module1/lec12/10.html 16

10
Bazată pe principiul plasmolizei în
soluţie hipertonică
-În anul 1892, Klercker izolează pentru prima dată protoplaşti,
prin metoda mecanică;
PLASMOLÍZĂ, plasmolize, s.f. (Bot.)
Fenomen de contracţie si de - Limbul frunzei a fost imersat într-o soluţie hipertonică de
desfacere a citoplasmei, provocat de manitol (13%), ce a indus plasmoliza;
pierderea apei din ţesutul vegetal viu.
(Din fr. Plasmolyse, dex98) - Limbul frunzei, rămas în continuare în soluţie, după
plasmoliza completă, a fost secţionat cu un bisturiu foarte bine
ascuţit;
Dezavantaje
- Aplicabilă doar ţesuturilor cu - Unor celule le-a fost secţionat doar peretele celular, rezultând
celule puternic vacuolate protoplaşti integri; multor celule le-a fost afectat întreg
conţinutul, în încercarea de a secţiona peretele celular;
- Rezultă un număr redus de
protoplasti - Protoplaştii prinşi în celule au fost “încurajaţi” să iasă în afară
prin reducerea uşoară a osmolarităţii (concentraţiei soluţiei), ce
- Este un proces laborios şi
a forţat protoplaştii să se umfle (să-şi mărească volumul) şi să
foarte meticulos (chiar plicticos)
iasă la suprafaţa limbului secţionat;
- Protoplaştii obţinuţi au o
-Protoplaştii obţinuţi au fost separaţi de cei distruşi şi de
viabilitate scăzută
rămăşiţele de ţesut vegetal
11
- Utilizată pentru
variate ţesuturi şi
organe

- Sursa cea mai utilizată


este mezofilul

- Rezultă un număr
ridicat de protoplaşti

- Este uşor de utilizat

- Viabilitate ridicată a
protoplaştilor
12
• In 1960, E.C. Cocking demonstrează posibilitatea izolării
enzimatice a unui număr ridicat de protoplaşti din celulele
plantelor superioare, după următoarea metodă:
- sterilizarea frunzelor
- desprinderea epidermei inferioare a frunzelor
- introducerea frunzelor în soluţie cu un amestec de enzime
pentru plasmoliză
- izolarea/recoltarea protoplaştilor
A. Hidroliza enzimatică secvenţială , cu mai multe
etape, sequential isolation):
1. Soluţie cu o enzimă de macerare (pectinază , macerozină,
pectolyase)
2. Spălare cu soluţie CPW liberă de
enzime 3.Centrifugare uşoară, 100 g
4. Separarea peleţilor şi resuspendarea într-o soluţie cu o enzimă
care hidrolizează resturile pereţilor celulari (celulază sau
hemicelulază)
5. Spălarea cu CPW pentru eliminarea resturilor.
B. Hidroliza enzimatică mixtă , cu o singură etapă,
mixed enzymatic approach)
• 1. Ţesutul vegetal este plasmolizat în prezenţa unui amestec
de două enzime, pectinază şi celulază, astfel că au loc simultan
procesele de separare a celulelor şi de degradare a peretelui
celular

Protoplasts
CPW-Cocking, Peberdy and White –Cell Washing and 13% mannitol
13
Protoplast Isolation and Regeneration
http://nptel.ac.in/courses/102103016/module1/lec12/1.html
Fuzionarea protoplastilor – PURIFICAREA PROTOPLAŞTILOR

Filtrare
Centrifugare
Spălare
• 6-18 ore de incubare a materialului
vegetal în soluţia enzimatică;

• filtrarea suspensiei rezultate printr-o


sită metalică sau o plasă fină de plastic (cu
ochiuri de 50-100 µm), pentru îndepărtarea
resturilor nedigerate conţine
protoplaşti, se amestecă cu un volum
adecvat de soluţie osmotică

(H)
separarea protoplaştilor

(I)
soluţie osmotică cu o concentraţie identică celei din
soluţia

(J)
(solidă, în partea superioară = peleţi de protoplaşti)

(K)
cu o pipetă şi centrifugat din

(L)
de cultură, cu o anume densitate a protoplaştilor
(după o prealabilă analiză a densităţii cu
Protoplast Isolation and Regeneration
http://nptel.ac.in/courses/102103016/module1/lec12/1.html
Hemocitometru

http://bpsstaging.com/bitesizebio/13687/cell-counting-with-a-
hemocytometer-easy-as-1-2-3/ http://www.appstate.edu/~rosea/pmb.html
• HIBRIDĂRI SOMATICE ÎNTRE SPECII ÎNDEPĂRTATE = HIBRIZI SOMATICI (fertili
sau sterili, poliploizi) şi CIBRIZI

• Regenerarea de plante sau organogeneza din calusuri originare din protoplaşti

• Obţinerea de organisme cu grad mărit de ploidie (autopoliploizi, alopoliploizi,


amphiploizi)

• Îmbunătăţirea unor caractere (vigoare) şi însuşiri (rezistenţă la agenţii fitopatogeni,


precocitate, calitate, aspect)

• Obţinerea de organisme noi, cu noi recombinări ale caracterelor (condiţionate de


informaţia genetică din nucle, cloroplaste, mitocondrii)

• Posibilitatea aplicării altor metode ale bitehnologiilor vegetale asupra culturilor de


protoplaşti (ex. transformare genetică)
• HIBRIDĂRI SOMATICE ÎNTRE SPECII ÎNDEPĂRTATE = HIBRIZI SOMATICI (fertili sau sterili, poliploizi)

Protoplast fusion for production of tetraploids and triploids: applications for scion and rootstock breeding in citrus. Jude W.
Grosser • Fred G. Gmitter Jr, Published online: September 2010, Springer Science+Business Media B.V. 2010

Fruits from allotetraploid somatic hybrids.


Left: ‘Valencia’ sweet orange + ‘Robinson’ x ’Temple’;
Middle: ‘Nova’ + ‘Osceola’;
Right: ‘Rohde Red Valencia’ + ‘Dancy’

Plant Cell Tiss Organ Cult (2011) 104:343–357,


http://www.hos.ufl.edu/sites/default/files/courses/hos6735c/Grosser%20and%20Gmitter%202011.pdf
Fuzionarea protoplastilor – Hibridarea somatică
Fuzionarea protoplastilor – Tipuri

A. Spontană (pe parcursul izolării lor):


• se formează homokarioni sau homocariocite, fiecare cu 2 sau > nuclei
• procesul este mai frecvent când protoplaştii s-au obţinut din calus în curs de diviziune sau din cultura
de suspensii celulare
• produşii obţinuţi nu prezintă intreres practic

B. Indusă prin diferite metode, cu scopul obţinerii de heterokarioni sau hibrizi somatici:
• 1. mecanice
• 2. chimice: NaNO3, high Ca2+, polyethylene glycol (PEG),
• 3. fizice: stimuli electrici

Tratamentul cu polyethylene glycol :


• Polyethylene glycol (PEG) este cel mai folosit agent fusogen
• Rezultă o frecvenţă ridicată a heterokarionilor binucleaţi
• Are o citotoxicitate redusă
• Protoplaştii proaspăt izolaţi ai celor doi părinţi sunt amestecaţi în proporţii egale şi trataţi cu o soluţie
PEG 15-45 %, timp de 15-30 min
• Amestecul este spălat gradual pentru îndepărtarea soluţiei PEG, timp în care are loc fuziunea
protoplaştilor
• Soluţia de spălare trebuie să fie alcalină (pH 9-10) şi cu o concentraţie ridicată a ionilor de Ca++(50 mM)
• PEG este încărcat negativ şi se poate lega de cationii de Ca, care, la rândul lor, se aliniază pentru a se
lega de moleculele încărcate negativ din plasmalemă şi din membrana plasmatică
• În timpul spălării, moleculele de PEG îndepărtează componentele din plasmalemă de care sunt legate
• Procesul poate modifica organizarea plasmalemei şi poate conduce la fuziunea protoplaştilor apropiaţi
• Tehnica este neselectivă şi induce fuziunea dintre oricare doi sau mai mulţi protoplaşti
Fuzionarea protoplastilor
Fuzionarea protoplastilor
Produşii fuziunii protoplaştilor

Nucleii a doi protoplaşti pot sau


nu să fuzioneze după fuziunea
citoplasmei:

a.Celule binucleate =
heterokarioni sau heterocite

b.Nuclei fuzionaţi = hibrizi sau


synkariocite

c.Un nucleu pierdut = cibrid


sau hibrid citoplasmatic sau
heteroplast
Produşii fuziunii protoplaştilor
1. Izolarea protoplaştilor din explantele potrivite
2. Amestecarea protoplaştilor în tuburi de centrifugă, în amestec cu agenţi
chimici (ex. PEG sau NaNO3, la pH = 10,5 şi temperatura de 370C)
3. Regenerarea pereţilor celulari la celulele de tip heterokarioni
4. Fuziunea nucleilor heterokarionilor cu formarea de celule hibride
5. Cultivarea celulelor hibride pe mediu de cultură şi producerea de colonii
de celule hibride (calus)
6. Selecţia hibrizilor, subcultura şi inducerea organogenezei în calusul
hibrid (plantule in vitro)
7. Transferul în sol a plantelor mature obţinute din regenerarea calusului
 Singura modalitate prin care două genomuri parentale diferite pot fi recombinate, la
speciile care nu se pot reproduce sexuat (sterile sau asexuate)

 Calea de obţinere a diploizilor şi poliploizilor fertili la speciile cu reproducere sexuată,


dar sterile

 Depăşirea barierelor de incompatibilitate sexuală; hibrizii somatici dintre


specii incompatibile sexual pot fi utilizaţi la diverse aplicaţii din industrie şi
agricultură

 Studiul genelor citoplasmatice şi a activităţii lor, cu aplicaţii în lucrările de ameliorare


a plantelor

 Creşterea variabilităţii genotipice a materialului iniţial de ameliorare, prin recombinări


ale caracterelor determinate de genele nucleare şi extranucleare (mitocondrii, cloroplaste)
în hibrizii somatici sau cibrizi

 Posibilitatea intervenţiei altor metode de inducere a variabilităţii genotipice in


vitro (mutageneză in vitro, transformare genetică etc)

 Posibilitatea transferului unor gene de rezistenţă de la forme sălbatice la cele cultivate


Terminologie

• Protoplast vegetal
• Izolare protoplaşti vegetali
• Cultură de protoplaşti
• Fuziunea protoplaştilor sau hibridarea somatică
• Hibrid somatic simetric
• Hibrid somatic asimetric (cybrid)
?
gaburi@uaiasi.ro
LP8: Inginerie genetică (I)
1. ETAPA PREŞTIINŢIFICĂ( . -> 1865)
• primele observaţii corecte privind agregarea familială şi transmiterea ereditară a unor boli
(hemofilie, polidactilie, albinism);
• numeroase interpretări erau însă eronate. Se caracterizează prin lipsa cunoştinţelor privind
procesele debază (concepţie, reproducere etc), eludarea analizei şi absenţa unei teorii generale,
convingătoare, care să explice fenomenele ereditare.

2. ETAPA FUNDAMENTĂRII GENETICII CA STIINŢĂ ŞI INTRODUCERII SALE ÎN MEDICINĂ (1865-1960)
• Gregor Mendel (1865): conceptul genei şi formulează legile eredităţii;
• T. H. Morgan: teoria cromosomică a eredităţii; Lucrari stiintifice: Mecanismul Eredității
Mendeliene (1915), Teoria Genelor (1926);
• F. Galton (1890): introduce conceptul interacţiunii dintre ereditate şi mediu;
• Era geneticii moleculare: demonstrarea rolului genetic al ADN (Avery et al. 1944) şi descoperirea
modelului structurii ADN (Watson şi Crick, 1953).

Gregor Mendel T.H.Morgan F. Galton Watson şi Crick 2


3. DEZVOLTAREA GENETICII MEDICALE (1960-1970)
• “deceniul de aur”: se acumulează numeroase dovezi privind rolul factorilor genetici
în producerea bolilor umane.
• s-au amplificat aplicaţiile practice ale geneticii: perfecţionarea diagnosticului
bolilor metabolice şi a depistării sistematice la nou născuţI a unor boli frecvente şi
tratabile (fenilcetonuria, hipotiroidia congenitală); ameliorarea tehnicilor de
analiză cromosomică, prin metode noi de marcaj în benzi, care permit identificarea
precisă a unor anomalii structurale minime; dezvoltarea sfatului genetic (evaluarea
riscului de apariţie a unor boli genetice în familii); introducerea şi amplificarea
diagnosticului prenatal; optimizarea tratamentului simptomatic şI pathogenic în
diferite boli genetice, care încetează să mai fie "fără speranţe terapeutice".

4. INGINERIA GENETICĂ ŞI MEDICINĂ MOLECULARĂ - ERA GENOMICA (1980 -> )


• 1980: analiză directă a AND-ului, a genei;
• identificarea şi localizarea unor gene; izolarea şi clonarea lor;
descifrarea"mesajului" genelor (prin secvenţializarea ADN) şi, eventual, expresia lor
în diferite celule"gazdă", în care se obţin proteinele codificate de genă. Aceste
tehnici de "manipulare genetică" sau "ADN recombinant” reprezintă o veritabilă”
inginerie genetică”;
• 1980-2005: Proiectul genom uman - 2001: schita secvenţei întregului genom
uman; 2005: 30.000-40.000 de gene au fost identificate şi analizate.
Lista laureaţilor Premiilor Nobel pentru descoperiri în domeniul
geneticii
Metode indirecte – TRANSFORMAREA MEDIATA

1. Transformarea mediata de bacterii


Agrobacterium
tumefaciens
Agrobacterium rhizogenes
2. Transformarea mediate de virusuri

Metode directe

1. Metoda “biolistics”
2. Transformarea protoplastelor
a. Microinjectarea
b. Electroporarea
c. sonicarea
3. Electroforeza
4. Utilizarea fibrelor de carbora de siliciu
Metode indirecte – TRANSFORMAREA MEDIATA

1. Transformarea mediata de bacterii


Agrobacterium
tumefaciens
Agrobacterium rhizogenes
2. Transformarea mediate de virusuri
ADN-ul recombinant se referă la combinaţiile noi de ADN obţinute între anumite secvenţe de
ADN dintr-un organism şi molecule de ADN bacterian (sau de la alte specii), capabile să se
replice indefinit (formând clone moleculare) sau să exprime, într-o celulă gazdă, informaţia
genetică pe care o conţin.
1. Clonarea ADN sau amplificarea selectivă a unei gene / secvenţe de ADN, bazată
în esenţă pe multiple runde de replicare a ADN, care vor produce un număr mare
de copii ale fragmentului respectiv;

2. Analiza ADN sau detecţia specifică a unei secvenţe de AND/ARN, bazată pe


hibridizarea moleculară (prin complementaritate) a unei sonde marcate de acid
nucleic, cu secvenţa respectivă.
Clonarea poate fi:

- celulară, in vivo, când se foloseşte mecanismul natural al replicării ADN

- acelulară, in vitro, bazată pe reacţia de polimerizare în lanţ (PCR).


Clonarea poate fi:

- celulară, in vivo, când se foloseşte mecanismul natural al replicării ADN


Clonarea ADN in vivo utilizează mecanismul natural de replicare al ADN în celule şi
implică patru etape majore:

• formarea ADN recombinant, prin ataşarea in vitro a fragmentelor de


ADN la ”un vector sau replicon” capabil de replicare independentă;

• transformarea: moleculele de ADN recombinant sunt transferate în


celule gazdă in care vectorul recombinant se replică independent de
cromosomul celulei gazdă;

• amplificarea sau producerea de clone celulare multiple;

• izolarea clonelor de ADN recombinant prin oprirea culturilor şi


izolarea selectivă a ADN recombinant.
Clonarea ADN in vivo utilizează mecanismul natural de replicare al ADN în celule şi
implică patru etape majore:

• formarea ADN recombinant, prin ataşarea in vitro a fragmentelor de


ADN la ”un vector sau replicon” capabil de replicare independentă;

Metode:

1. secţionarea ADN genomic, cu ajutorul enzimelor de restricţie;

2. formarea unei copii de ADN complementară unei molecule de ARN


mesager extras din citoplasmă, utilizându-se transcriptaza inversă;

3. sinteza artificială (chimică) prin polimerizarea nucleotidelor după o


secvenţă prestabilită, cu ajutorul ADN polimerazei.
Enzimele de rectricţie sunt mijloace naturale de apărare ale unor bacterii contra
infecţiilor cu virusuri; bacteriile reuşesc să limiteze (în engleză, "to restrict") creşterea
virusului infectant, printr-un proces în care ADN fagic este selectiv recunoscut şi
degradat enzimatic, în timp ce ADN-ul bacterian rămâne protejat de această acţiune
distructivă.
https://www.khanacademy.org/science/biology/biotech-dna-technology/dna-cloning-tutorial/a/restriction-enzymes-dna-ligase
Două fragmente de ADN cu origini diferite dar produse de aceiaşi enzimă de restricţie se pot
uni pe bază de complementaritate producând o moleculă hibridă de ADN recombinant!

1. Design-ul unei gene de interes


(ADNt)

2. Identificarea situs de recunoaştere


şi clivare sau situs de restricţie.

3. Secţionarea moleculei de ADN la sau


lângă situsul de restricţie (de ex. Eco
RI)

4. Transferul genei

https://www.khanacademy.org/science/biology/biotech-dna-technology/dna- 15
cloning-tutorial/a/restriction-enzymes-dna-ligase
Molecula monocatenară de ARN mesager serveşte ca matriţă pentru sinteza unei
catene de ADN complementar (ADNc) realizată de enzima transcriptază inversă.
Astfel se obţine o moleculă ADNc bicatenar care va corespunde genei (mai exact
exonilor din genă) care în celulă a produs (prin transcripţie) ARNm ce a servit ca
matriţă pentru ADNc. În acest mod s-a sintetizat pentru prima dată gena pentru beta
globină.
Metoda se bazează pe polimerizarea
deoxiribonucleotidelor ce alcătuiesc o
catenă de ADN, într-o ordine prestabilita
̆/determinată anterior. Ea se deduce pe
baza secvenţei de aminoacizi a proteinei
codificată de genă, cu ajutorul codului
genetic, care stabileşte pentru fiecare
aminoacid codonul (trinucleotidul)
corespunzător. Alteori, secvenţa de
nucleotide a genei ce va fi sintetizată se
stabileşte prin alte metode. Această
tehnică se foloseşte mai des pentru
obţinerea unor oligonucleotide
corespunzătoare unei părţi din genă,
utilizate fie ca sonde fie ca amorse, în alte
tehnici de analiză moleculară.
Clonarea ADN in vivo utilizează mecanismul natural de replicare al ADN în celule şi
implică patru etape majore:

• formarea ADN recombinant, prin ataşarea in vitro a fragmentelor de


ADN la ”un vector sau replicon” capabil de replicare independentă;

• transformarea: moleculele de ADN recombinant sunt transferate în


celule gazdă in care vectorul recombinant se replică independent de
cromosomul celulei gazdă;
Moleculele de ADN recombinant sunt transferate (încorporate) în celule gazdă (de
obicei bacterii nepatogene modificate) în care vectorii recombinanţi se vor
multiplica independent (autonom) de cromosomul bacterian, formând mai multe
exemplare identice. Introducerea unui vector într-o celulă bacteriană se numeşte
transformare.
Genele se inseră într-un replicon sau vector si cu ajutorul lui sunt introduse într-o
celulă gazdă (bacterii, levuri etc), unde vor fi multiplicate.
Genele se inseră într-un replicon sau vector si cu ajutorul lui sunt introduse într-o
celulă gazdă (bacterii, levuri etc), unde vor fi multiplicate.

Vectorii
- un vector este o moleculă naturală de ADN utilizată pentru transportul
secvenţelor de ADN exogen într-o celulă gazdă. El trebuie să fie capabil să se
replice activ şi independent de genomul gazdei (de aceea se mai numeşte şI
replicon), din care apoi va fi izolat în formă pură.
(1) Plasmidele - se găsesc natural în bacterii, cărora le conferă rezistenţa la diferite antibiotice şi metale grele. Ele suntalcătuite dintr-o
moleculă mică (de circa 2-5 Kb) de ADN bicatenar circular extracromosomial, care se replicăcomplet independent de cromosomul
bacterian. Prezintă un situs de iniţiere a replicării (origine) şi unul sau maimulţi markeri de selecţie (de obicei gene care conferă rezistenţă
la antibiotice). Au un situs unic de restricţie (situatîntr-o genă de"selecţie") unde poate fi inserat un fragment de ADN exogen (de la circa
1 Kb, până la maximum 10kb) rezultând unplasmid recombinant.
(2) Bacteriofagii (sau pe scurt fagii) sunt virusuri care infectează şi distrug bacteriile. Ei posedă un sistem de penetrarea bacteriei în care
îşi introduc ADN; se se replică autonom, rapid şi intens (circa un milion de copii). Multiplicareafagului în bacterie16se traduce după un
timp, prin liza ei. În tehnicile de ADN recombinant se folosesc în specialfagii lambda (λ) ce atacă E. coli. ADN fagic bicatenar şi linear, de
aproximativ 45 Kb, este"împachetat" în capsula virusului. El posedă două extremităţi coezive /adezive, numitecos(care
permitcircularizarea ADN fagic pătruns în bacterie) şi un "fragment intern", neesenţial pentru replicare, care poate fidecupat şi înlocuit cu
o moleculă de ADN exogen (10-20 Kb), formând fagi recombinanţi. Pe culturide geloză fagii recombinaţi se recunosc prin plaje de liză, pe
un "covor" bacterian.
(3) Cosmidele sunt vectori artificiali constituiţi dintr-un plasmid clasic la care s-au adăugat secvenţele cos ale faguluilambda, secvenţe
care permit împachetarea unor segmente de ADN exogen mai lungi decât în fagi. Cosmidele funcţionează iniţial ca nişte fagi şi după
infecţia bacteriei aceşti pseudofagi se recircularizează şi sereplică ca un plasmid, dar mult mai lent, fiind şi mult mai mari. Avantajul
cosmidelor este că permit inserţia şiclonarea unor fragmente foarte lungi de ADN (până la 50 Kb).
(4) "Cromosomii artificiali bacterieni (BACs)” derivă din plasmidul de fertilitate din E.Coli şi este capabil să incorporeze fragmente de
ADN până la 300 kb.
(5) " Cromosomii artificiali de levuri (YACs de la yeast artificial chromosomes) sunt plasmide care posedă centromerul şi telomerele
originale, elementele necesare replicării şi segregării mitotice a cromosomilor în celedouă celule fiice de Saccharomyces cereviseae
(drojdia folosită în brutării). În rest cromatidele YAC vor fi alcătuitedin ADN exogen. După "fabricare" cromosomii artificiali sunt introduşi
în levuri şi se comportă ca şicromosomii normali. YAC poate încorpora fragmente foarte mari de ADN (până la 1000 Kb) şi permite
replicarea ADN de eucariote cu secvenţe repetitive de ADN. Totuşi multe gene umane au mărimi de 2-3 Mb şi în acestecazuri analiza lor cu
vectorii convenţionali necesită clonarea unor fragmente suprapuse de genă, din care să se reconstituie ulterior secevnţa originală şi
integrală a genei.
(6) Alţi vectori. În afara celor patru tipuri principale de vectori de clonare, în cazuri speciale, se folosesc şi alte tipuride vectori.Vectorii
"navetă", destinaţi a fi utilizaţi şi la procariote şi la eucariote. Ei pot introduce o secvenţă de ADN în celulele eucariote (transfecţie), care
ulterior va fi recuperată prin clonaj într-o bacterie, în scopul studieiimodificările pe care le-a suferit în celula eucariotă."Vectori de
expresie". Unii vectori sunt prelucraţi într-un modparticular adăugându-li-se, în vecinătatea situsului de inserţie a ADN exogen,
semnalele necesare transcripţiei.Aceşti vectori pot funcţiona în bacterii sau drojdii determinând sinteza proteinei corespunzătoare genei
pe care oconţin."Vectorii virali"pentru celulele eucariote sunt retrovirusurile, adenovirusurile, virusul SV 40 şi virusurile detip Herpes.
Sunt folosiţi în experienţe de introducere (încorporare) a ADN în celule eucariote numite generic transfecţie.
Clonarea ADN in vivo utilizează mecanismul natural de replicare al ADN în celule şi
implică patru etape majore:

• formarea ADN recombinant, prin ataşarea in vitro a fragmentelor de


ADN la ”un vector sau replicon” capabil de replicare independentă;

• transformarea: moleculele de ADN recombinant sunt transferate în


celule gazdă in care vectorul recombinant se replică independent de
cromosomul celulei gazdă;

• amplificarea sau producerea de clone celulare multiple;


În cazul clonării cu vectori plasmidici celulele bacteriene sunt însămânţate pe suprafaţa unei plăci
cu agar, unde cresc şi formează colonii sau clone (populaţii de celule identice, descendente
dintr-o singură celulă) distincte. Apoi, coloniile sunt prelevate şi cultivate individual într-un
flacon cu mediu lichid, unde se produce o nouă expansiune a numărului de celule. Dacă celula
iniţială conţinea un vector recombinant atunci - prin multiplicarea lui precum şi a celulelor ce-l
conţin - se realizează o amplificare enormă a fragmentului de ADN ataşat vectorului.
Clonarea ADN in vivo utilizează mecanismul natural de replicare al ADN în celule şi
implică patru etape majore:

• formarea ADN recombinant, prin ataşarea in vitro a fragmentelor de


ADN la ”un vector sau replicon” capabil de replicare independentă;

• transformarea: moleculele de ADN recombinant sunt transferate în


celule gazdă in care vectorul recombinant se replică independent de
cromosomul celulei gazdă;

• amplificarea sau producerea de clone celulare multiple;

• izolarea clonelor de ADN recombinant prin oprirea culturilor şi


izolarea selectivă a ADN recombinant.
Clonarea celulară a ADN - IZOLAREA CLONELOR DE ADN
RECOMBINANT
Clonarea poate fi:

- celulară, in vivo, când se foloseşte mecanismul natural al replicării ADN

- acelulară, in vitro, bazată pe reacţia de polimerizare în lanţ (PCR).


Descoperita in anul 1985 : reacţia de polimerizare în lanţ "polymerase chain reaction"
(Mullis şi Smith; Pr. Nobel, 1993)

Utilizare: clonarea genelor


se poate amplifica selectiv o secvenţă scurtă de ADN sau ARN, a cărei structură
nucleotidică este parţial cunoscută.

Principiul metodei: amplificarea selectivă in vitro a unui fragment de ADN cu secvenţă


cunoscută se realizează pe baza extensiei unei amorse ("primer sau amplimer"). Tehnica
foloseşte două oligonucleotide de sinteză care reproduc o secvenţă de 15-25 nucleotide
situate la capătul 3' a celor două catene ale segmentului de ADN; ele sunt numite amorse
deoarece declanşează sinteza ADN, după "matriţa" fragmentului ADN iniţial (de
amplificat); reacţia necesită, evident, prezenţa ADN-polimerazei.
1. denaturare, 1 minut, la 94 oC;

2. ataşarea primerilor, 1 minut, la 36


o
C (cu o creştere de 5 oC/minut);

3. extensie, 2 minute, la 72 oC.


Alte utilizări:

• Detectarea ADN-ului specific patogen

• Detectarea genelor de rezistență și selectarea variantelor rezistente

• Diferențierea organismelor și a individului

• Detectarea polimorfismelor ADN legate de factori abiotici si biotici


Clustered, Regularly Interspaced, Short Palindromic Repeat CRISPR –
Cas9 technology
Nature Biotechnology volume 32, pages 347–355 (2014)

http://med.stanford.edu/allergyandasthma/news/news-from-our-center/crispr.html
Metode indirecte – TRANSFORMAREA MEDIATA

1. Transformarea mediata de bacterii


Agrobacterium
tumefaciens
Agrobacterium rhizogenes
2. Transformarea mediate de virusuri

Metode directe

1. Metoda “biolistics”
2. Transformarea protoplastelor
a. Microinjectarea
b. Electroporarea
c. sonicarea
3. Electroforeza
4. Utilizarea fibrelor de carbora de siliciu
Metoda biolistică (“biolistics”) sau “particle gun”, de împuşcare directă a ADN în
ţesuturi ţintă este o metodă de transformare genetică a plantelor foarte rapida.

BioRad Particle Gun


Protoplastele, celulele vegetale lipsite de perete celular, reprezintă limita de expresie
a totipotenţialităţii.

a. Microinjectarea – constă în introducerea cu a.


ajutorul unei micropipete a ADN direct în
protoplaste, acestea fiind fixate cu o altă
micropipetă.

b. Electroporarea – implică permeabilizarea


reversibilă a membranei plasmatice în
prezenţaunor pulsuri de curent continuu având
amplitudine crescută şi durată foarte scurtă, porii
formaţi înmembrană permiţând intrarea ADN
străin în citoplasmă .
Protoplastele, celulele vegetale lipsite de perete celular, reprezintă limita de expresie
a totipotenţialităţii.

a. Microinjectarea – constă în introducerea cu a.


ajutorul unei micropipete a ADN direct în
protoplaste, acestea fiind fixate cu o altă
micropipetă.

b. Electroporarea – implică permeabilizarea


reversibilă a membranei plasmatice în
prezenţaunor pulsuri de curent continuu având
amplitudine crescută şi durată foarte scurtă, porii b.
formaţi înmembrană permiţând intrarea ADN
străin în citoplasmă .
Migrarea ADN printr-un ţesut vegetal ţintă a fost o altă idee interesantă pentru
transferul de gene şi a fost aplicată pentru prima oară embrionilor intacţi de orz
(Ahokas, 1989). Ulterior s-a imaginat un sistem simplu pentru realizarea
electroforezei folosind embrioni zigotici (Songstad şi colab., 1995)

37
după Songstad şi colab., 1995
Transformarea genetică prin această tehnologie este relativ simplă, constând în
vortexarea (agitarea) ţesuturilor împreună cu ADN şi fibre de carbură de siliciu.
Astfel, fibrele penetreaza ̆ pereţii celulari
permiţând ADN sa ̆ pătrunda ̆ în citoplasmă.
Organismele modificate genetic (OMG)
www.ucsusa.org/.../
pharmcorn_plate.jpg http://www.sathguru.com/images/agri-
and-food-biotechnology.jpg
Ameliorarea conventionala vs Organisme modificate genetic (OMG)

SIGUR NESIGUR
Ameliorarea conventionala vs Organisme modificate genetic (OMG)
HibridareMutagenezaIncrucisari
Poliploidizareinterspecifice
OMG CRISPR

Gene
afectate

3
Ameliorarea conventionala vs Organisme modificate genetic (OMG)

Ex: inlocuirea sistemul radio/audio

Ameliorarea conventionala:
Desmembrez ambele masini, pana la ultima piesa, si le reansamblez amestecand totul.
Dupa SELECTIE aleg masina care are sistemul radio/audio.

OMG:
Iau sistemul radio/audio din masina veche si il instalez in masina noua.
Ameliorarea conventionala vs Organisme modificate genetic (OMG)

Ex: inlocuirea sistemul radio/audio

Daca inlocuim sistemul radio/audio (din masina) cu un radiocasetofon


provenit de la un avion, noua masina poate zbura?
Organisme Modificate Genetic (OMG)

Cateva exemple de plante transgenice purtand gene cu importanţă


economică:

• Tomatele FLAVR SAVR – gena antisens pentru poligalacturonaza


• Garoafe cu viaţă prelungită in vază – modificarea metabolismului etilenei
• Garoafe mov – “Moondust”, “Moonshadow”
• Petunii portocali (purtand gena dfr de la porumb)
• Plante rezistente la erbicide
• Plante rezistente la insecte (gena pentru endotoxina Bt)
• Plante rezistente la virusuri – gene pentru “coat protein”
• Modificări ale metaboliţilor primari
• Proteine
• Uleiuri
• Amidon
• Vitamina A (“golden rice”), vitamina E
• Plante bioreactoare (vaccinuri, anticorpi, proteine din lapte
uman, proteina din fibra pânzei de paianjen)
• Fitoremediere – plante rezistente sau care acumulează agenţi poluanţi
Exemple de OMG: Golden Rice

Deficienta vitaminei A afecteaza peste 800 million de oameni


(aprox. 15 milioane de copii din 2002 pana in prezent)

bob.usuhs.mil/biochem/nutrition/ images/keratomalacia-1.jpg
Exemple de OMG: Golden Rice

Orezul nu produce vitamina A, dar


contine geranylgeranyl diphosphate
(GGDP), un precursor natural al
vitaminei A.

GGDP  vitamin-A

2 gene de la daffodils (Narcissus pseudonarcissus)


1 gena bacteriana Erwinia uredovora

Cele 3 gene sunt exprimate in endosperm


Golden Rice schematic
Provitamin A biosynthesis pathway

GGPP
Phytoene synthase (psy)
(daffodil)

Phytoene Problem:
Rice Phytoene desaturase (crtl)
lacks
Program these enzymes
Funding:
Rockefeller Lycopene
Foundation,
Swiss Federal
Institute
Of Technology,
European
Community beta-Carotene
Biotech
= (bacteria)

prov
Lycopene ß-cyclase (lcy)
itam
in A (daffodil)
Exemple de OMG: Tomatele FLAVR SAVR

Problema:

1. degradarea fructelor (pereții celulelor


sunt degradați de enzime specifice)
2. etilenă care declanșează și accelereaza
procesul de coacere

Solutie: cercetatorii au blocat sinteza uneia


dintre enzime - poligalacturonaza (PG)

Evident, dacă se suprimă sinteza acestui


hormone - sinteza în care sunt implicate tot
două enzime - întregul proces de coacere
este întârziat. Mai precis, se folosesc genele
care codifică una sau alta dintre cele două
enzime implicate în sinteza etilenei, dar
orientate în sens invers. Transferate la
tomate, aceste transgene antisens
determină reducerea cu 95% a cantității
de etilenă sintetizate și prelungirea duratei
coacerii de la una la patru săptămâni.

Meli VS, Ghosh S, Prabha TN, Chakraborty N, Chakraborty S, Datta A. (2010)


Enhancement of fruit shelf life by suppressing N-glycan processing enzymes. Proceedings
of the National Academy of Sciences 107 (6) 2413-2418;
DOI:10.1073/pnas.090932911107
Tomato anti-softening gene
(FlavrSavr gene)

FlavrSavr is discontinued
as gene has been inserted to cultivar that lacked
consistent production qualities
Exemple de OMG: PLANTE TRANSGENICE TOLERANTE LA ERBICIDE
Erbicide non-selective
(Roundup Ultra si Liberty)
Roundup® (chemical name: glyphosate)

Breaks down quickly in the soil,


eliminating residue carry-over problems
and reducing environmental impact.

Liberty® (glufosinate).
Roundup Ready® and
Liberty Link®
transgenic varieties
of common crops
are completely resistant
to those herbicides
(Finale, Basta, Ignite)
Exemple de OMG: PLANTE TRANSGENICE TOLERANTE LA ERBICIDE
RoundUP

Strategii privitoare la obtinerea OMG tolerante la actiunea erbicidelor:


-modificarea tintei erbicidului (cantitativ si calitativ)
-introducerea in plantele cultivate a unui sistem de degradare a erbicidului

I. Erbicidele sikimice (care au ca substanta active glifosatul –


cunoscut sub denumirea comerciala de Roundup)
Are ca tinta o enzima din calea metabolica ce duce la sinteza
aminoacizilor aromatici.

II. A doua strategie – aplicata in cazul erbicidului glufosinat de


amoniu (fosfinotricin) – care inhiba o enzima cheie in procesul de
asimilare a azotului, rezultand concentratii letale de amoniac la
numai cateva ore de la aplicarea pe plante.

Gena – izolata de la o actinomiceta din genul Streptomyces a fost


transferata cu Agrobacterium.

Culturi:
Soia Roundup Ready (RR) poseda o gena transferata de la E. coli
Porumbul RR poseda o gena EPSP transferata la porumb

Roundup (glifosat) – erbicid aprobat in Romania de peste 40 de ani


15
Cazul 1: Plante sensibile la Roundup
Shikimic acid + Phosphoenol pyruvate

+ Glyphosate

X
Plant
EPSP
synthase

Fara
X
3-Enolpyruvyl shikimic acid-5-phosphate
(EPSP)

nuaminoacizi, planta
supravetuieste
X
X
Ar omatic
Cazul 2: Plante rezistente la Roundup
Shikimic acid + Phosphoenol pyruvate

+ Glyphosate

Bacterial RoundUp nu are efect;


EPSP Enzyma e rezistenta la erbicid
synthase

3-enolpyruvyl shikimic acid-5-phosphate


(EPSP)
Cu aminoacizi, planta
supravetuieste
Aromatic
Toleranta la erbicide
Exemple de OMG: Porumbul Bt

Alte culturi: Bt-cartof, Bt- bumbac Bt-porumb dulce

Daunator: Lepidoptera larvae (fluturii/larve)


Exemple de OMG: Porumbul Bt

Pierderile globale cauzate de insecte s-ar putea ridica anual la 4000 de md. dolari (daca nu s-ar
aplica nici o masura de combatere) actualmente fiind de aprox. 100 md.

Strategia: gene din bacteria de sol Bacillus thuringiensis (Bt). In conditii de stres bacteria formeaza
un endospor. Celula bacteriana se degradeaza eliberandu-se sporul si cristalul. Insectele ingereaza
cristalele proteice, iar proteina este fragmentata in doua de enzimele din aparatul digestiv.
Endotoxina formeaza un complex cu receptori specifici cu membrane epiteliului intestinal.
Exemple de OMG: Bumbac Bt

Source: USDA

Normal Transgenic

Rezistenta la insecte – toxina produsa de gena transferata din


Bacillus thuringiensis (Bt) cauzeaza resistenta

transgene = Bt protein
Exemple de OMG: tomate transgenice la Sclerotinia

wheat germin protein

Transgenic Wild-type
Exemple de OMG: Banana afectate de Xanthomonas Wilt (BXW)

Xanthomonas campestris

- 2001 in Ethiopia
- 2010 toata regiunea Great Lakes (East Africa)

Gene resistente la Xanthomonas identificate in


ardei iute (Capsicum annuum)

Genele Hrap si Pflp

Tripathi, L., Mwaka, H., Tripathi, J.N. and Tushemereirwe, W. 2010. Expression of sweet
pepper Hrap gene in banana enhances resistance to Xanthomonas campestris pv.
musacearum. Molecular Plant Pathology.

Mediawatch on the first results of a field trial of Xanthomonas wilt resistant GM bananas,
published 26 September 2014.
OMG: Argumente impotriva cultivarii

Reactii alergice
Unii oameni cred că alimentele cu OMG au un potențial mai mare de a declanșa reacții alergice. Acest lucru se datorează faptului că
acestea pot conține gene de la un alergen - un aliment care provoacă o reacție alergică.

Organizația Mondială a Sănătății (OMS) descurajează inginerii genetici să utilizeze ADN-ul de la alergen, cu excepția cazului în care pot
dovedi că genele însăși nu provoacă această problemă.

Este de remarcat faptul că nu au existat rapoarte privind efectele alergice ale oricărui produs alimentar modificat genetic prezent în
prezent pe piață.

Cancer
Unii cercetători cred OMG pot contribui la dezvoltarea cancerului. Ei susțin că, deoarece boala este cauzată de mutații în ADN, este
periculoasă introducerea de noi gene în organism.

Societatea Americana pentru Cancer (ACS) a spus ca nu exista nici o dovada pentru aceasta. Cu toate acestea, aceștia observă că nici o
dovadă de vătămare nu este aceeași cu dovada siguranței și că obținerea unei concluzii necesită mai multă cercetare.

Rezistență antibacteriană
Există îngrijorarea că modificarea genetică, care poate stimula rezistența culturii la boală sau poate face mai tolerantă la erbicide, ar
putea afecta capacitatea oamenilor de a se apăra împotriva bolilor.

Există o mică șansă ca genele din produsele alimentare să poată transfera în celule celulele sau bacteriile din intestin. Unele plante OMG
conțin gene care le fac rezistente la anumite antibiotice. Această rezistență ar putea fi transmisă oamenilor.

Există o îngrijorare crescândă la nivel global că oamenii devin tot mai rezistenți la antibiotice. Există șanse ca alimentele modificate
genetic să contribuie la această criză.

OMS au spus că riscul transferului de gene este scăzut. Cu toate acestea, ca măsură de precauție, acesta a stabilit orientări pentru
producătorii de alimente cu OMG.
Majoritatea vegetalelor au
continut ridicat de pesticide
LP10. Extracția ADN-ului genomic
Science 2018, Vol 362, Issue 6413
Genotip = totalitatea materialului genetic al unui organism.

Fenotip = totalitatea trasaturilor observabile ale unui organism, determinate de


materialul genetic si de mediul inconjurator.

Acidului dezoxiribonucleic (ADN)


• ADN este format din nucleotide (A, G, C, T).
• Molecula ADN este formata din 2 lanturi polinucleotidice ale caror nucleotide sunt
unite intre ele, 2 cate 2, prin legaturi de hidrogen.

Acidul ribonucleic (ARN) este implicat în decodificarea informației ereditare stocate in


ADN.

Gena = secventa de nucleotide care contine informatia necesara sintezei unei proteine
sau a unei molecule de ARN.

Codon = o succesiune de 3 nucleotide sau baze azotate (ex. ATG, CGT etc) care codifica
un aminoacid (64 codoni).

Aminoacid = sunt constituentii fundamentali ai proteinelor (20 de aminoacizi).


1869 Johann Friedrich Miescher
• identifică o substanță slab acidă cu o funcție necunoscută în nucleele celulelor albe
din sânge. Această substanță va fi numită ulterior acid dezoxiribonucleic, sau ADN.

1912 Fizicianul Sir William Henry Bragg, și fiul său, Sir William Lawrence Bragg
• descoperă că pot deduce structura atomică a cristalelor din modelele lor de
difracție cu raze X.

Pholo courtesy of Cold Spring Harhor Lahoratory


Archives.

1949 Erwin Chargaff


• un biochimist, raportează compoziția ADN-ului;
• ADN și bazele sale azotate variază de la o specie la alta.
• constată continut similar de adenină/timină si guanină/citozină 4
1953 James Watson și Francis Crick
• descoperă structura moleculară a ADN-ului.

1962 Francis Crick, James Watson și Maurice Wilkins


• primesc premiul Nobel pentru determinarea
structurii moleculare a ADN-ului.
a)

b) Transcriptia si translatia ADN-ului

ADN

ARN

Proteina
!!!!! 4 nucleotide (ATCG) => 64 codoni (serie de 3 nucleotide) => 20 aminoacizi

STOP

START
Gena = secventa de nucleotide care contine informatia necesara sintezei unei proteine

• Codon START (ATG)

• Exoni (secventa codificatoare) - secvente transcrise, pastrate in ARNm si traduse in proteina

• Introni (secvente eliminate, absente din ARNmesager) – incepe cu GT si se termina cu AG

• Codon STOP (TAA, TAG, TGA)


START STOP
ATG….exon.…AAAGT-intron-AGGTT…exon…AATGT-intron-AGCGT…exon….TAA
START STOP
ATG….exon.…AAAGT-intron-AGGTT…exon…AATGT-intron-AGCGT…exon….TAA

ATG….exon.…AAAGTT…exon…AATCGT…exon….TAA
START STOP
ATG….exon.…AAAGT-intron-AGGTT…exon…AATGT-intron-AGCGT…exon….TAA

ATG….exon.…AAAGTT…exon…AATCGT…exon….TAA

Proteina
In general, la eucariote 1-2% din genom este alcatuit din gene.
Ex: La H. sapiens, 98% din genom contine secvente non-codificatoare.
>BnaA01g00030D

ATGGCGGAGGAAGACGTGTCGCGCAATTTCCGAGCCCTGGTGGAGAACGCGGACCGCAAGTTCGCGAGAGTCCG
CGATCTCCCGGCCTTCGGGCGAGCGCAGAGCCACTACTTCCACAAGGTCTTCAAGGCCTACATGAAGCTCTGGAAT
TACCAGCAGTCCCACCGGCCCAAGCTCGTCGCGTCGGGGCTGAACCGGTGGGAGATCGGCGAGATCGCGAGCCG
GATTGGGCAGCTCTACTTCAGCCAGTACATGAGGACCAGCGAGGCTCGCTTCCTCCTCGAGTCCTACGTCTTCTAC
GAGGCCATTCTCAAGCGGAGGTACTTCGAGGAAGGGGAGGAGAGGAAGGATCTCAGCGCGAGGTCCAAGGAGCT
GAGGTTCTACGCGAGGTTCTTGCTCGTTGCGTTGATTGTTGATCGGAGGGAGATGGTTTTGCACTTGGCTGAGAAG
CTTAGGGCTTTGGTTGATGACAGCAAGTCTAATTTTAGGGTAAAAGATTTAATCTTTTTGATTTGAGGCTTTTGAGAAT
TGAGCCTCTGGTTGAATAAAGTTTTGATCTTTTGGTGCAGGAGACCAACTTTAAGGAGTGGAGGATAGTTGTGCAAG
AGATCACTCGGTTTACTAAAGCTGACGTGGACTTAACTTATGTCAGGCCGCTTCGTTACTGCGCTATGCTTGATTCCT
ATCCAGCTTCTCACACGTACCTAGCGAGGTTCCACGCTAAGAAGCTCTTCAAGTTTCGTGATGCTCTATTAGCTAGCT
ATCACCGTAACGAGGTAAGCATTAAACAAGCAGTGTTTTGTTTTTATTGAACCTAAGATTCATACGCTGTGGCCTTTGT
AATCATTTAGGTGAAATACGCTGAAGTGACGTTGGATACGTATAGAATGATGCAGTGTTTAGAGTGGGAGCCTAGTGG
GTCTTTTTACCAGAAGCGGCCTGTTGAGACGAAAGAGAATGGCTTTGTGGTTGATCATACGCTGACTTCTGGGATTA
TAGATATGAAATTGGCTGCTGATATGGCTGATCCGTCGTTACCTCCTAATCCTAGGAAGGCAGTTCTTTATCGTCCCAC
AGTCTCTCACTTGCTTGCGGTGAGTTTTTTTTTTATCTGTTTCATATAGGAAAATAATCTTTAGGAGTTTCTGATTTTTTT
TTCCTTTATATATGTTCAGGTCTTGGCGATGATCTGTGATGAGCTCTCTCCAGAGTGTGTGATGCTGATATATCTATCG
GCTTCAGGTTTAGTTTTTTTTTTGTTGTCACTTTGGAACTTCTTGATGTTAACATGGTGACGGTTATCCAGGTGGTCCT
GCTGCTCGTGAGAATGTTGCGCAACCGGAGAACGCTGTCGGTTCAAGCAGAACATCAAAAAGCAAGCTGCTTGGC
CGAGCTTCCCAAGAGCAGAAGAGTTACAAGTCAGAACCTCTTAGCAACGGACACAAATCTTCTGGGGGTTATTATGA
TGATTATCTTTGGTTAGGTCCTAGAGGAGGCTCTGGTAAGTTGTTTTCCTCGGATTTACATTGTTATATGTCTCCAGTG
GGCAGTGAATGAGCAGACTTTTCTCGCTCACTGTCTTGTTTTTTTTTGTTTTCAGGTTCAAACAACCTTTACCCTGGT
GATCTAATACCTTTTACAAGGAAACCGCTTTTCTTGGTCATTGATAGCGACACTAGCCGAGCATTCAAGGCAGGTTTG
TCCTAACTTAGTCTTATCATTCTCTCAGGAGATTCTTATAGTTGTTCTTTGTCACTGTGCGATATTGGCTAACGGATTGT
GAGCTTCAGGTTTTGAATGGTGCAGAGAGAGGGGAGCCTGTTGCTCTACTTCTTTCTCCTCTGAAGCCATCTCTGGA
GAACCCATCTGCTGATGATACAGCAGCAGCATTAAACGGAAGCCAGTTTACTTTTTTCTTGACAGCTCCTTTACAAGC
ATTCTGTCAAATGCTGGGCCTCTCGAACTCGGATCCCGAACCTGTAAGTACCTTAAATGAAGCAAAGCATATGTTATC
ATGATGTGGTGGCATTGCTTCTTACCATCTTGATCACATATCTTCAGGAGGTTTATGATGAAGCAGAGAGCATACTATC
TGCTTCTTTCTCTGAGTGGGAAACGATCCTCCTGACTTCCAAAGTGTTGAATCTTGTCTGGGCTCAGGTCTTGCCTG
13
ATCAGTTCTTGAGACGGCTGATTCTCAGTAA
MATERIALE

Tesut vegetal: banană, tomate, altele

• 10 ml apă distilată
• sare (10%)
• 10 ml săpun sau lichid de spălat vase
• Iso-propanol sau Et-OH 96%
• filtru
• plăci Petri
• pipetă
• tuburi Eppendorf (1.5 ml)
• tuburi Falcon (10/50ml)
• vas Erlinmeyer (50ml)
• pungă resigilabilă
Etape (1/2):

 Zdrobește țesutul vegetal din punga resigilabilă (aprox. un minut)

 Pregătiți soluția cu dH2O și sare

 Turnați amestecul de apă sărată în pungă (30-45 secunde)


Închideți punga și strângeți foarte ușor și deplasați apa sărată și țesut vegetal împreună.

 Adăugați săpunul de spălat vase în pungă și amestecați ușor conținutul.


Încercați să evitați să faceți prea multă spumă.

 Puneți filtrul într-un vas Erlinmeyer (50ml) cu sticlă limpede, fixând partea
superioară a filtrului în jurul cupei.

 Turnați amestecul în filtru și lăsați-l să stea până când tot lichidul se


scurge în cupă.
Etape (2/2):

 Scoateți și indepărtați filtrul folosit.

 Transferați 3 ml soluție in tuburile Falcon

 Înclinați tubul Falcon și adăugați încet isopropanol/Et-OH rece pe partea


superioară.
Alcoolul trebuie să formeze un strat deasupra amestecului de tesut vegetal, rămânând separat, așa
că aveți grijă să nu îl turnați prea repede. Faceți un strat de alcool care are 0,5-1cm.

 După ce stratul de alcool este configurat, așteptați 10 minute.


Este posibil să vedeți niște bule și material tulbure care se mișcă în alcool. Este vorba despre
molecule de ADN care se strâng.

 Folosiți agitatorul pentru a începe să trageți moleculele tulburi din stratul


de alcool.
Rotiți agitatorul în loc pentru a începe să adunați lucrurile tulbure. După ce ați terminat, aruncați o
privire mai atentă asupra lucrurilor de pe agitator.

16
 Te uiți la ADN!
https://askabiologist.asu.edu/activities/banana-dna 17
1. Distrugerea (liza) celulelor: prin mojarare sau sonicare și tratament cu
soluții tampon specifice (cu săruri minerale)

2. Îndepărtarea membranelor lipidice: folosind detergenți

3. Îndepărtarea proteinelor: folosind enzime - proteaze

4. Precipitarea ADN-ului folosind alcooli (etanol, izopropanol, etc.)


• Apă sărată – țesutul vegetal este amestecat cu o soluție salină care are
rolul sa stimuleze coagularea și lipirea moleculelor de ADN în ciorchine
suficient de mari.

• Săpunul lichid– degradează lipide și ajută la difuzia ADN-ului in soluție.


Așadar, când se adaugă săpunul lichid, membrana celulară și nucleele sunt
rupte, eliberând ADN-ul.

• Alcool - moleculele de ADN sunt solubile (pot fi dizolvate) în unele lichide,


dar nu și în alcool. Prin urmare, adăugarea de alcool ajută la formarea unor
ciorchine mari de ADN, vizibile.
• Incercati protocolul in bucataria d-voastra! Respectati
pasii prezentati in video si fotografiati rezultatul. Puteti
folosi orice fel de tesut vegetal. Astept fotografii pe
gaburi@uaiasi.ro

• Distractie placuta!

gaburi@uaiasi.ro
LP11. Polymerase Chain Reaction (Reacţia de
Polimerizare în Lanţ)
• Descoperita de către K. Mullis şi echipa sa. Nu se foloseau ADN polimeraze
termostabile şi nici aparate automate pentru reproducerea ciclurilor de
temperatură.

• Publicarea cercetărilor se face în 1985.

• În 1991 apare primul număr dintr-o revistă consacrată în întregime tehnicii


PCR (PCR -Methods and Applications).

• În 1993, Mullis primeşte


Premiul Nobel pentru Chimie.

2
Are loc amplificarea unui fragment de ADN utilizând primeri (markeri moleculari) sintetici
desemnaţi pe bază de complementaritate.

Amplificare
Termocicler Sistem pentru preluarea imaginilor

Sistem de electroforeză în Sistem de electroforeză în Fluorospectrometru


gel orizontal gel vertical
1. denaturare, 1 minut, la 94 oC;

2. ataşarea primerilor, 1 minut,


la 36 oC
(cu o creştere de 5 oC/minut);

3. extensie, 2 minute, la 72 oC.

6
ADN
ADN
ADN
ADN
Diagnostic medical

Genotipare Medicina
personalizata

Agricultura Evolutie

Criminalistica
1. ADN cu un grad înalt de puritate – verificare spectrofotometrică (A260/A280).

2. ADN polimeraza

3. Amestec de nucleotide - soluţii stoc de dATP, dCTP, dGTPşi dTTP

4. Soluţie tampon – conţine TRIS, HCl, KCl şi are pH 8,3.

5. MgCl2 - ionii de magneziu sunt activatori ai polimerazelor.

6. Apă ultrapură–NucleaseFree

7. Primeri – markeri moleculari


https://www.jenabioscience.com/about-us/news-blog/3177-preventing-unspecific-pcr-products
Imperi, M., Pataracchia, M., Alfarone, G., Baldassarri, L., Orefici, G., & Creti, R. (2010). A
multiplex PCR assay for the direct identification of the capsular type (Ia to IX) of Streptococcus
agalactiae. Journal of microbiological methods, 80 2, 212-4 .
Vizualizarea unui marker co-dominant cu ajutorul unei electroforezei într-un gel de agaroză
gaburi@uaiasi.ro
LP12: Determinarea diversității genetice cu markeri
moleculari (I)
Selected ‘loci’ in the history of genetics
1842 First observation of chromosomes
1865 Mendel’s theory of inheritance
1900 Rediscovery of Mendel
1905 First coining of the term ‘genetics’ by Bateson
1900s Discovery of linkage by Bateson and Punnett
1913 First linkage map (of Drosophila by M organ)

1935 First linkage maps of plant species (m aize & tomato)

1953 Discovery of the structure of DNA

1986 First molecular marker linkage map of

2000 Arabidopsis thaliana genome sequen crop species


2002 First crop genome sequenced (rice) ced
2004 First livestock genome sequenced (ch
Ce este un marker genetic ?

Markerii genetici sunt secvente ADN cu locații fizice cunoscute pe


cromozomi.
Ce este un marker genetic ?

Markerii genetici sunt secvente ADN cu locații fizice cunoscute pe


cromozomi.

Reprezintă puncte de variație care pot fi folosite pentru a identifica


indivizi/specii sau pot fi utilizate pentru a asocia o caracteristică fenotipică
moștenită cu un locus prin legătura genetică cu genele din apropiere.
Ce este un marker genetic ?

Markerii genetici sunt secvente ADN cu locații fizice cunoscute pe


cromozomi.

Reprezintă puncte de variație care pot fi folosite pentru a identifica


indivizi/specii sau pot fi utilizate pentru a asocia o caracteristică fenotipică
moștenită cu un locus prin legătura genetică cu genele din apropiere.

Exemple:
• izoenzime
• RFLP (Restriction Fragment Length Polymorphisms),
• RAPD (Random Amplified Polymorphic DNA),
• AFLP (Amplified Fragment Length Polymorphisms),
• STS (Sequence Tagged Site),
• SSR (Simple Sequence Repeat),
• SNP (Single Nucleotide Polymorphisms),
• KASP (Kompetitive Allele Specific PCR),
etc. 5
Primii markeri?
Primii markeri? Fenotipul
Primii markeri? Fenotipul

Cum poate fenotipul fi un marker molecular?


Primii markeri? Fenotipul

Cum poate fenotipul fi un marker molecular?

Gena Y/y (culoare)


Gena Y/y (culoare)
Marker molecular
Marker molecular

Gena R/r (forma)


Izoenzimele
Izoenzimele
• bazate pe variația de pliere a proteinelor
• număr limitat de markeri și polimorfism

P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11
Markeri genetici

1. RFLP (Restriction Fragment Length Polymorphisms)


• o enzimă taie ADN-ul la o locatie specifica pentru recunoașterea
enzimei (de exemplu AATTCC)

• polimorfismul este determinat de numărul de astfel de site-uri din


genom, care modifică numărul de benzi ADN

(Nelson and Lydiate, 2005) 16


Metode bazate pe utilizarea PCR (Polymerase Chain Reaction = Reacţie de Polimerizare în Lanţ)

RAPD, AFLP, SSR, SNP şi KASP sunt cateva metode ce


utilizează PCR, în scopul determinării diversităţii genetice a
genotipurilor vegetale.

• RAPD (Random Amplified Polymorphic DNA),


• AFLP (Amplified Fragment Length Polymorphisms),
• SSR (Simple Sequence Repeat),
• SNP (Single Nucleotide Polymorphisms),
• KASP (Kompetitive Allele Specific PCR),
Utilizări:

• Detectarea ADN-ului specific patogen

• Detectarea genelor de rezistență și selectarea variantelor rezistente

• Diferențierea organismelor și a individului

• Detectarea polimorfismelor ADN legate de factori biotici

• Clonarea genelor și caracteristica funcțiilor genei