Sei sulla pagina 1di 60
INTEGRAINTEGRAINTEGRAINTEGRAÇÃOINTEGRAINTEGRAINTEGRAINTEGRAÇÃOÇÃOÇÃOÇÃOÇÃOÇÃOÇÃO DEDEDEDEDEDEDEDE
INTEGRAINTEGRAINTEGRAINTEGRAÇÃOINTEGRAINTEGRAINTEGRAINTEGRAÇÃOÇÃOÇÃOÇÃOÇÃOÇÃOÇÃO DEDEDEDEDEDEDEDE BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA NONONONONONONONO
TRATAMENTOTRATAMENTOTRATAMENTOTRATAMENTOTRATAMENTOTRATAMENTOTRATAMENTOTRATAMENTO DODODODODODODODO CANCROCANCROCANCROCANCROCANCROCANCROCANCROCANCRO DODODODODODODODO RECTORECTORECTORECTORECTORECTORECTORECTO
Dra.Dra. SilviaSilvia RodríguezRodríguez
IINSTITUTONSTITUTO TTRATAMIENTORATAMIENTO IINTEGRALNTEGRAL CCÁNCERÁNCER
HOSPITALHOSPITAL CLINICACLINICA BENIDORMBENIDORM
OportoOporto 28/1/201128/1/2011
RACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓN
HECHOSHECHOSHECHOSHECHOSHECHOSHECHOSHECHOSHECHOS ⇒⇒⇒⇒⇒⇒⇒⇒ NEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIA
DOWNSTAGINGDOWNSTAGINGDOWNSTAGINGDOWNSTAGINGDOWNSTAGINGDOWNSTAGINGDOWNSTAGINGDOWNSTAGING ⇒⇒⇒⇒⇒⇒⇒⇒↑↑↑↑↑↑↑↑ ControlControlControlControlControlControlControlControl LocalLocalLocalLocalLocalLocalLocalLocal ⇒⇒⇒⇒⇒⇒⇒⇒↑↑↑↑↑↑↑↑ SupervivenciaSupervivenciaSupervivenciaSupervivenciaSupervivenciaSupervivenciaSupervivenciaSupervivencia
CONSERVACIONCONSERVACIONCONSERVACIONCONSERVACIONCONSERVACIONCONSERVACIONCONSERVACIONCONSERVACION DELDELDELDELDELDELDELDEL ESFÍNTERESFÍNTERESFÍNTERESFÍNTERESFÍNTERESFÍNTERESFÍNTERESFÍNTER
INTENSIDADINTENSIDADINTENSIDADINTENSIDADINTENSIDADINTENSIDADINTENSIDADINTENSIDAD DEDEDEDEDEDEDEDE TRATAMIENTOTRATAMIENTOTRATAMIENTOTRATAMIENTOTRATAMIENTOTRATAMIENTOTRATAMIENTOTRATAMIENTO
QUIMIOTERAPIAQUIMIOTERAPIAQUIMIOTERAPIAQUIMIOTERAPIAQUIMIOTERAPIAQUIMIOTERAPIAQUIMIOTERAPIAQUIMIOTERAPIA
RADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIA
RTRTRTRT.RTRTRTRT EXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNA ⇒⇒⇒⇒⇒⇒⇒⇒ 3333D/IMRT3333D/IMRTD/IMRTD/IMRTD/IMRTD/IMRTD/IMRTD/IMRT
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIA ENEN CA.CA. RECTORECTO 66 AÑOSAÑOS
BRAQUITERAPIABRAQUITERAPIA ENEN CA.CA. RECTORECTO
66 AÑOSAÑOS
RACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓN
NCCNNCCNNCCNNCCNNCCNNCCNNCCNNCCN GUIDELINESGUIDELINESGUIDELINESGUIDELINESGUIDELINESGUIDELINESGUIDELINESGUIDELINES (2.2011(2.2011(2.2011(2.2011(2.2011(2.2011(2.2011(2.2011 UPDATE)UPDATE)UPDATE)UPDATE)UPDATE)UPDATE)UPDATE)UPDATE)
•• RT.RT.RT.RT.RT.RT.RT.RT. NEOADYUVANTE:NEOADYUVANTE:NEOADYUVANTE:NEOADYUVANTE:NEOADYUVANTE:NEOADYUVANTE:NEOADYUVANTE:NEOADYUVANTE: 4545454545454545 –––––––– 5050505050505050 GyGyGyGyGyGyGyGy
OR:OR:OR:OR:OR:OR:OR:OR: INTESTINOINTESTINOINTESTINOINTESTINOINTESTINOINTESTINOINTESTINOINTESTINO DELGADODELGADODELGADODELGADODELGADODELGADODELGADODELGADO
RACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓN
RADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIA NEONEONEONEO-NEONEONEONEO----ADYUVANTE---ADYUVANTEADYUVANTEADYUVANTEADYUVANTEADYUVANTEADYUVANTEADYUVANTE
DOWNSTAGINGDOWNSTAGING
>>>>>>>> pT0pT0pT0pT0pT0pT0pT0pT0 ⇒⇒⇒⇒⇒⇒⇒⇒ >>>>>>>> SUPERVIVENCIASUPERVIVENCIASUPERVIVENCIASUPERVIVENCIASUPERVIVENCIASUPERVIVENCIASUPERVIVENCIASUPERVIVENCIA LIBRELIBRELIBRELIBRELIBRELIBRELIBRELIBRE DEDEDEDEDEDEDEDE ENFERMEDADENFERMEDADENFERMEDADENFERMEDADENFERMEDADENFERMEDADENFERMEDADENFERMEDAD
Rodel C et al. J Clin Oncol 2005; 23(34):8688-8698
Stipa F et al. Ann Surg Oncol 2006; 13(8): 1047-1053
Chan AK et al. Int J Radiat Oncol Biol Phys 2005; 61(3): 665-667
RACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓN
RADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIA NEONEONEONEO-NEONEONEONEO----ADYUVANTE---ADYUVANTEADYUVANTEADYUVANTEADYUVANTEADYUVANTEADYUVANTEADYUVANTE
RECTORECTORECTORECTORECTORECTORECTORECTO INFERIORINFERIORINFERIORINFERIORINFERIORINFERIORINFERIORINFERIOR
PRESERVACIÓNPRESERVACIÓN DELDEL ESFÍNTERESFÍNTER
LITERATURALITERATURA NONO
CONCLUYENTECONCLUYENTE
CA.CA.CA.CA.CA.CA.CA.CA. DEDEDEDEDEDEDEDE RECTORECTORECTORECTORECTORECTORECTORECTO
CA.CA.CA.CA.CA.CA.CA.CA. DEDEDEDEDEDEDEDE RECTORECTORECTORECTORECTORECTORECTORECTO INFERIORINFERIORINFERIORINFERIORINFERIORINFERIORINFERIORINFERIOR
PRESERVACIÓNPRESERVACIÓNPRESERVACIÓNPRESERVACIÓNPRESERVACIÓNPRESERVACIÓNPRESERVACIÓNPRESERVACIÓN DELDELDELDELDELDELDELDEL ESFINTERESFINTERESFINTERESFINTERESFINTERESFINTERESFINTERESFINTER
•FUNCIONALIDAD•FUNCIONALIDADFUNCIONALIDADFUNCIONALIDADFUNCIONALIDADFUNCIONALIDADFUNCIONALIDADFUNCIONALIDAD
•CALIDAD•CALIDADCALIDADCALIDADCALIDADCALIDADCALIDADCALIDAD DEDEDEDEDEDEDEDE VIDAVIDAVIDAVIDAVIDAVIDAVIDAVIDA
•CONTROL•CONTROLCONTROLCONTROLCONTROLCONTROLCONTROLCONTROL LOCAL/SUPERVIVENCIALOCAL/SUPERVIVENCIALOCAL/SUPERVIVENCIALOCAL/SUPERVIVENCIALOCAL/SUPERVIVENCIALOCAL/SUPERVIVENCIALOCAL/SUPERVIVENCIALOCAL/SUPERVIVENCIA
CA.CA.CA.CA.CA.CA.CA.CA. DEDEDEDEDEDEDEDE RECTORECTORECTORECTORECTORECTORECTORECTO
CA.CA.CA.CA.CA.CA.CA.CA. DEDEDEDEDEDEDEDE RECTORECTORECTORECTORECTORECTORECTORECTO INFERIORINFERIORINFERIORINFERIORINFERIORINFERIORINFERIORINFERIOR
PRESERVACIÓNPRESERVACIÓNPRESERVACIÓNPRESERVACIÓNPRESERVACIÓNPRESERVACIÓNPRESERVACIÓNPRESERVACIÓN DELDELDELDELDELDELDELDEL ESFINTERESFINTERESFINTERESFINTERESFINTERESFINTERESFINTERESFINTER
•PACIENTE•PACIENTEPACIENTEPACIENTEPACIENTEPACIENTEPACIENTEPACIENTE
•Edad,•Edad,Edad,Edad,Edad,Edad,Edad,Edad, sexosexosexosexosexosexosexosexo
•Pérfil•PérfilPérfilPérfilPérfilPérfilPérfilPérfil psicológicopsicológicopsicológicopsicológicopsicológicopsicológicopsicológicopsicológico
•Diferencias•DiferenciasDiferenciasDiferenciasDiferenciasDiferenciasDiferenciasDiferencias culturalesculturalesculturalesculturalesculturalesculturalesculturalesculturales
•TUMOR•TUMORTUMORTUMORTUMORTUMORTUMORTUMOR
••DDDDDDDDiiiiiiiistancstancstancstancstancstancstancstanciiiiiiiiaaaaaaaa aaaaaaaallllllll márgenmmárgenmmmárgenmmárgenáááárgenrgenrgenrgen anaanaanaanaanaanaanaanallllllll
•Estadio•EstadioEstadioEstadioEstadioEstadioEstadioEstadio
•Extensión•ExtensiónExtensiónExtensiónExtensiónExtensiónExtensiónExtensión circunferencialcircunferencialcircunferencialcircunferencialcircunferencialcircunferencialcircunferencialcircunferencial
•Afectación•AfectaciónAfectaciónAfectaciónAfectaciónAfectaciónAfectaciónAfectación deldeldeldeldeldeldeldel suelosuelosuelosuelosuelosuelosuelosuelo pélvicopélvicopélvicopélvicopélvicopélvicopélvicopélvico
•Sensibilidad•SensibilidadSensibilidadSensibilidadSensibilidadSensibilidadSensibilidadSensibilidad
radioradioradioradio-radioradioradioradio----quimioterapia---quimioterapiaquimioterapiaquimioterapiaquimioterapiaquimioterapiaquimioterapiaquimioterapia
CIRUJANOCIRUJANOCIRUJANOCIRUJANOCIRUJANOCIRUJANOCIRUJANOCIRUJANO
RACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓN
ESCALADAESCALADA DEDE DOSISDOSIS
RADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIA EXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNA (3D(3D(3D(3D(3D(3D(3D(3D ÓÓÓÓÓÓÓÓ IMRT)IMRT)IMRT)IMRT)IMRT)IMRT)IMRT)IMRT) ????????????????
(movilidad(movilidad(movilidad(movilidad(movilidad(movilidad(movilidad(movilidad deldeldeldeldeldeldeldel recto,recto,recto,recto,recto,recto,recto,recto, difícildifícildifícildifícildifícildifícildifícildifícil localizaciónlocalizaciónlocalizaciónlocalizaciónlocalizaciónlocalizaciónlocalizaciónlocalización deldeldeldeldeldeldeldel tumotumotumotumotumotumotumotumor)r)r)r)r)r)r)r)
TOXICIDADTOXICIDADTOXICIDADTOXICIDADTOXICIDADTOXICIDADTOXICIDADTOXICIDAD
COMPROMISOCOMPROMISOCOMPROMISOCOMPROMISOCOMPROMISOCOMPROMISOCOMPROMISOCOMPROMISO QUIRÚRGICOQUIRÚRGICOQUIRÚRGICOQUIRÚRGICOQUIRÚRGICOQUIRÚRGICOQUIRÚRGICOQUIRÚRGICO
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO ESCALADAESCALADA DEDE DOSISDOSIS RXRXRXRXRXRXRXRX
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO
ESCALADAESCALADA DEDE DOSISDOSIS
RXRXRXRXRXRXRXRX ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA DEDEDEDEDEDEDEDE CONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTO
PAPILLONPAPILLONPAPILLONPAPILLONPAPILLONPAPILLONPAPILLONPAPILLON
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO RXRXRXRXRXRXRXRX DEDEDEDEDEDEDEDE
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO
RXRXRXRXRXRXRXRX DEDEDEDEDEDEDEDE CONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTO
(1940).(1940).(1940).(1940).(1940).(1940).(1940).(1940). 1970s1970s1970s1970s1970s1970s1970s1970s (Lyon.(Lyon.(Lyon.(Lyon.(Lyon.(Lyon.(Lyon.(Lyon. France)France)France)France)France)France)France)France)
•KILOVOLTAJE•KILOVOLTAJEKILOVOLTAJEKILOVOLTAJEKILOVOLTAJEKILOVOLTAJEKILOVOLTAJEKILOVOLTAJE (50(50(50(50-(50(50(50(50----KV)---KV)KV)KV)KV)KV)KV)KV)
••
••
••
••
LesionesLesionesLesionesLesionesLesionesLesionesLesionesLesiones exofíticasexofíticasexofíticasexofíticasexofíticasexofíticasexofíticasexofíticas yyyyyyyy móvilesmóvilesmóvilesmóvilesmóvilesmóvilesmóvilesmóviles
T1T1T1T1T1T1T1T1 óóóóóóóó T2T2T2T2T2T2T2T2
G1G1G1G1G1G1G1G1 óóóóóóóó G2G2G2G2G2G2G2G2
LesionesLesionesLesionesLesionesLesionesLesionesLesionesLesiones <<<<<<<< 33333333 cmcmcmcmcmcmcmcm dededededededede diámetrodiámetrodiámetrodiámetrodiámetrodiámetrodiámetrodiámetro
••
N0N0N0N0N0N0N0N0
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO RXRXRXRXRXRXRXRX DEDEDEDEDEDEDEDE
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO
RXRXRXRXRXRXRXRX DEDEDEDEDEDEDEDE CONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTO
••
EXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVA
••
T1T1T1T1T1T1T1T1 <<<<<<<< dededededededede 22222222 cm:cm:cm:cm:cm:cm:cm:cm: trastrastrastrastrastrastrastras excisiónexcisiónexcisiónexcisiónexcisiónexcisiónexcisiónexcisión locallocallocallocallocallocallocallocal
••
T2T2T2T2T2T2T2T2 N0N0N0N0N0N0N0N0 óóóóóóóó T1T1T1T1T1T1T1T1 ≥≥≥≥≥≥≥≥ 22222222 cmcmcmcmcmcmcmcm óóóóóóóó próximaspróximaspróximaspróximaspróximaspróximaspróximaspróximas alalalalalalalal esfinter:esfinter:esfinter:esfinter:esfinter:esfinter:esfinter:esfinter: ++++++++
RT.RT.RT.RT.RT.RT.RT.RT. ExternaExternaExternaExternaExternaExternaExternaExterna (+/(+/(+/(+/-(+/(+/(+/(+/------- quimioterapia)quimioterapia)quimioterapia)quimioterapia)quimioterapia)quimioterapia)quimioterapia)quimioterapia) ++++++++ cirugíacirugíacirugíacirugíacirugíacirugíacirugíacirugía
(resección(resección(resección(resección(resección(resección(resección(resección anterioranterioranterioranterioranterioranterioranterioranterior óóóóóóóó excisiónexcisiónexcisiónexcisiónexcisiónexcisiónexcisiónexcisión local)local)local)local)local)local)local)local)
SiSiSiSiSiSiSiSi cirugíacirugíacirugíacirugíacirugíacirugíacirugíacirugía ⇒⇒⇒⇒⇒⇒⇒⇒ MáximaMáximaMáximaMáximaMáximaMáximaMáximaMáxima respuestarespuestarespuestarespuestarespuestarespuestarespuestarespuesta trastrastrastrastrastrastrastras 5555-5555----6---6666666 semanassemanassemanassemanassemanassemanassemanassemanas
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO RXRXRXRXRXRXRXRX DEDEDEDEDEDEDEDE
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO
RXRXRXRXRXRXRXRX DEDEDEDEDEDEDEDE CONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTO
•DOSIS•DOSISDOSISDOSISDOSISDOSISDOSISDOSIS ENENENENENENENEN PROFUNDIDAD:PROFUNDIDAD:PROFUNDIDAD:PROFUNDIDAD:PROFUNDIDAD:PROFUNDIDAD:PROFUNDIDAD:PROFUNDIDAD:
•• 100100100100100100100100 %%%%%%%% aaaaaaaa 00000000 mmmmmmmmmmmmmmmm
•• 44444444-44444444----54---54545454545454 %%%%%%%% aaaaaaaa 55555555 mmmmmmmmmmmmmmmm
•• 2323232323232323--------3333333333333333 %%%%%%%% aaaaaaaa 1010101010101010 mmmmmmmmmmmmmmmm
•• 99999999 %%%%%%%% aaaaaaaa 2020202020202020
mmmmmmmmmmmmmmmm
INFILTRACIÓNINFILTRACIÓNINFILTRACIÓNINFILTRACIÓNINFILTRACIÓNINFILTRACIÓNINFILTRACIÓNINFILTRACIÓN TUMORALTUMORALTUMORALTUMORALTUMORALTUMORALTUMORALTUMORAL
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO RXRXRXRXRXRXRXRX DEDEDEDEDEDEDEDE
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO
RXRXRXRXRXRXRXRX DEDEDEDEDEDEDEDE CONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTO
DOSISDOSISDOSISDOSISDOSISDOSISDOSISDOSIS
•EXCLUSIVA•EXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVA ::::::::
•Tumor•TumorTumorTumorTumorTumorTumorTumor <<<<<<<< 22222222 cmcmcmcmcmcmcmcm :::::::: 8080808080808080 GyGyGyGyGyGyGyGy (4(4(4(4(4(4(4(4 fracciones/fracciones/fracciones/fracciones/fracciones/fracciones/fracciones/fracciones/
semana)semana)semana)semana)semana)semana)semana)semana)
••TumorTumorTumorTumorTumorTumorTumorTumor ≥≥≥≥≥≥≥≥ 22222222 cmcmcmcmcmcmcmcm :::::::: 9090909090909090 -------- 120120120120120120120120 GyGyGyGyGyGyGyGy (4(4(4(4(4(4(4(4--------55555555
fraccionesfraccionesfraccionesfraccionesfraccionesfraccionesfraccionesfracciones /1/1/1/1-/1/1/1/1----2---2222222 semanas)semanas)semanas)semanas)semanas)semanas)semanas)semanas)
•COMBINADA•COMBINADACOMBINADACOMBINADACOMBINADACOMBINADACOMBINADACOMBINADA ::::::::
6060606060606060 GyGyGyGyGyGyGyGy (2(2(2(2(2(2(2(2 fraccionesfraccionesfraccionesfraccionesfraccionesfraccionesfraccionesfracciones /1/1/1/1-/1/1/1/1----2---2222222 semanas)semanas)semanas)semanas)semanas)semanas)semanas)semanas)
FRACCIONES:FRACCIONES:FRACCIONES:FRACCIONES:FRACCIONES:FRACCIONES:FRACCIONES:FRACCIONES: 20202020-20202020----30---30303030303030 GyGyGyGyGyGyGyGy enenenenenenenen superficiesuperficiesuperficiesuperficiesuperficiesuperficiesuperficiesuperficie
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO RXRXRXRXRXRXRXRX DEDEDEDEDEDEDEDE
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO
RXRXRXRXRXRXRXRX DEDEDEDEDEDEDEDE CONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTOCONTACTO
RESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOS
•RESPUESTAS•RESPUESTASRESPUESTASRESPUESTASRESPUESTASRESPUESTASRESPUESTASRESPUESTAS COMPLETASCOMPLETASCOMPLETASCOMPLETASCOMPLETASCOMPLETASCOMPLETASCOMPLETAS >>>>>>>> 90%90%90%90%90%90%90%90%
•FRACASO•FRACASOFRACASOFRACASOFRACASOFRACASOFRACASOFRACASO LOCALLOCALLOCALLOCALLOCALLOCALLOCALLOCAL 5555-5555----28%---28%28%28%28%28%28%28% (rescatable(rescatable(rescatable(rescatable(rescatable(rescatable(rescatable(rescatable 98%)98%)98%)98%)98%)98%)98%)98%)
••CONSERVACIÓNCONSERVACIÓNCONSERVACIÓNCONSERVACIÓNCONSERVACIÓNCONSERVACIÓNCONSERVACIÓNCONSERVACIÓN DEDEDEDEDEDEDEDE ESFINTERESFINTERESFINTERESFINTERESFINTERESFINTERESFINTERESFINTER -------- 84%84%84%84%84%84%84%84%
RT.RT.RT.RT.RT.RT.RT.RT.
RT.RT.RT.RT.RT.RT.RT.RT. PREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIA
RXRX DEDE CONTACTOCONTACTO
•• THETHETHETHETHETHETHETHE LYONLYONLYONLYONLYONLYONLYONLYON R96R96R96R96-R96R96R96R96-------0202020202020202 RANDOMIZEDRANDOMIZEDRANDOMIZEDRANDOMIZEDRANDOMIZEDRANDOMIZEDRANDOMIZEDRANDOMIZED TRIALTRIALTRIALTRIALTRIALTRIALTRIALTRIAL
((((RECTO((((RECTORECTORECTORECTORECTORECTORECTO BAJOBAJOBAJOBAJOBAJOBAJOBAJOBAJO (≤(≤(≤(≤(≤(≤(≤(≤ 66666666 cmcmcmcmcmcmcmcm deldeldeldeldeldeldeldel márgenmárgenmárgenmárgenmárgenmárgenmárgenmárgen anal.anal.anal.anal.anal.anal.anal.anal. T2T2T2T2-T2T2T2T2----T3)---T3)T3)T3)T3)T3)T3)T3)
NEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIA
RT.RT.RT.RT.RT.RT.RT.RT. EXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNA
3939393939393939 GyGyGyGyGyGyGyGy (13(13(13(13(13(13(13(13 fr)fr)fr)fr)fr)fr)fr)fr)
ExclusivaExclusivaExclusivaExclusivaExclusivaExclusivaExclusivaExclusiva
++++++++
RayosRayosRayosRayosRayosRayosRayosRayos XXXXXXXX contactocontactocontactocontactocontactocontactocontactocontacto
(85(85(85(85(85(85(85(85 GyGyGyGyGyGyGyGy enenenenenenenen 33333333 frac)frac)frac)frac)frac)frac)frac)frac)
pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0
22222222 %%%%%%%%
2929292929292929 %%%%%%%%
((((((((0.001)0.001)0.001)0.001)0.001)0.001)0.001)0.001)
PRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACION
4444444444444444 %%%%%%%%
7676767676767676 %%%%%%%%
((((((((0.0040.0040.0040.0040.0040.0040.0040.004))))))))
NONONONONONONONO DIFERENCIASDIFERENCIASDIFERENCIASDIFERENCIASDIFERENCIASDIFERENCIASDIFERENCIASDIFERENCIAS ENENENENENENENEN TOXICIDAD,TOXICIDAD,TOXICIDAD,TOXICIDAD,TOXICIDAD,TOXICIDAD,TOXICIDAD,TOXICIDAD, CLCLCLCLCLCLCLCL óóóóóóóó SGSGSGSGSGSGSGSG AAAAAAAA 22222222 AÑOSAÑOSAÑOSAÑOSAÑOSAÑOSAÑOSAÑOS
J CLIN ONCOL 2004; 22: 2404-2409
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO ESCALADAESCALADA DEDE DOSISDOSIS
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO
ESCALADAESCALADA DEDE DOSISDOSIS
BRAQUITERAPIABRAQUITERAPIA
CA.CA. RECTORECTO BRAQUITERAPIABRAQUITERAPIA ““““ BRAKIOS“BRAKIOS“BRAKIOS“BRAKIOS“ ⇒⇒⇒⇒
CA.CA. RECTORECTO
BRAQUITERAPIABRAQUITERAPIA
““““ BRAKIOS“BRAKIOS“BRAKIOS“BRAKIOS“ ⇒⇒⇒⇒ CortoCortoCortoCorto
ColocaciónColocaciónColocaciónColocación deldeldeldel materialmaterialmaterialmaterial radiactivoradiactivoradiactivoradiactivo enenenen elelelel
áreaáreaáreaárea aaaa tratartratartratartratar
CaídaCaídaCaídaCaída rápidarápidarápidarápida dededede lalalala dosisdosisdosisdosis enenenen elelelel tejidotejidotejidotejido dededede
alrededoralrededoralrededoralrededor
BRAQUITERAPIABRAQUITERAPIA DEDE ALTAALTA TASATASA (High(High dosedose raterate Brachytherapy.Brachytherapy. HDR)HDR)
BRAQUITERAPIABRAQUITERAPIA DEDE ALTAALTA TASATASA
(High(High dosedose raterate Brachytherapy.Brachytherapy. HDR)HDR)
FuenteFuenteFuenteFuenteFuenteFuenteFuenteFuente únicaúnicaúnicaúnicaúnicaúnicaúnicaúnica IridioIridioIridioIridioIridioIridioIridioIridio 192192192192192192192192 (1.1(1.1(1.1(1.1(1.1(1.1(1.1(1.1 xxxxxxxx 55555555
mm)mm)mm)mm)mm)mm)mm)mm)
VidaVidaVidaVidaVidaVidaVidaVida media:media:media:media:media:media:media:media: 74.274.274.274.274.274.274.274.2 díasdíasdíasdíasdíasdíasdíasdías
Actividad:Actividad:Actividad:Actividad:Actividad:Actividad:Actividad:Actividad: 1010101010101010 CiCiCiCiCiCiCiCi
CargaCargaCargaCargaCargaCargaCargaCarga diferidadiferidadiferidadiferidadiferidadiferidadiferidadiferida
1818181818181818 -------- 4040404040404040 canales:canales:canales:canales:canales:canales:canales:canales: MúltiplesMúltiplesMúltiplesMúltiplesMúltiplesMúltiplesMúltiplesMúltiples
posicionesposicionesposicionesposicionesposicionesposicionesposicionesposiciones porporporporporporporpor canalcanalcanalcanalcanalcanalcanalcanal (>(>(>(>(>(>(>(> 40)40)40)40)40)40)40)40)
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA DEDEDEDEDEDEDEDE
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA DEDEDEDEDEDEDEDE ALTAALTAALTAALTAALTAALTAALTAALTA TASATASATASATASATASATASATASATASA
(High(High(High(High(High(High(High(High dosedosedosedosedosedosedosedose raterateraterateraterateraterate brachytherapy.brachytherapy.brachytherapy.brachytherapy.brachytherapy.brachytherapy.brachytherapy.brachytherapy. HDR)HDR)HDR)HDR)HDR)HDR)HDR)HDR)
Vector/AplicadorVector/AplicadorVector/AplicadorVector/Aplicador
CableCableCableCable
FuenteFuenteFuenteFuente dededede IrIrIrIr 192192192192
PosicionesPosicionesPosicionesPosiciones dededede lalalala fuentefuentefuentefuente
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ALTAALTAALTAALTAALTAALTAALTAALTA TASATASATASATASATASATASATASATASA
OPTIMIZACIONOPTIMIZACIONOPTIMIZACIONOPTIMIZACIONOPTIMIZACIONOPTIMIZACIONOPTIMIZACIONOPTIMIZACION
"Modificaci"Modificaci"Modificaci"Modificaci"Modificaci"Modificaci"Modificaci"Modificacióóóóóóóónnnnnnnn dededededededede diferentesdiferentesdiferentesdiferentesdiferentesdiferentesdiferentesdiferentes parparparparparparparparáááááááámetrosmetrosmetrosmetrosmetrosmetrosmetrosmetros conconconconconconconcon elelelelelelelel finfinfinfinfinfinfinfin dededededededede
adaptaradaptaradaptaradaptaradaptaradaptaradaptaradaptar lalalalalalalala distribucidistribucidistribucidistribucidistribucidistribucidistribucidistribucióóóóóóóónnnnnnnn dededededededede dosisdosisdosisdosisdosisdosisdosisdosis lolololololololo mmmmmmmmááááááááximoximoximoximoximoximoximoximo posibleposibleposibleposibleposibleposibleposibleposible alalalalalalalal
volumenvolumenvolumenvolumenvolumenvolumenvolumenvolumen dededededededede tratamiento"tratamiento"tratamiento"tratamiento"tratamiento"tratamiento"tratamiento"tratamiento"
••POSICIONESPOSICIONESPOSICIONESPOSICIONESPOSICIONESPOSICIONESPOSICIONESPOSICIONES DEDEDEDEDEDEDEDE LALALALALALALALA FUENTE:FUENTE:FUENTE:FUENTE:FUENTE:FUENTE:FUENTE:FUENTE: 2.52.52.52.52.52.52.52.5 –––––––– 55555555 mmmmmmmmmmmmmmmm
•TIEMPO•TIEMPOTIEMPOTIEMPOTIEMPOTIEMPOTIEMPOTIEMPO ENENENENENENENEN CADACADACADACADACADACADACADACADA POSICION:POSICION:POSICION:POSICION:POSICION:POSICION:POSICION:POSICION: 0.10.10.10.10.10.10.10.1 –––––––– 999999999999999999999999 sgsgsgsgsgsgsgsg
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA
o INCONVENIENTESINCONVENIENTES:INCONVENIENTESINCONVENIENTES:::
RIGIDEZRIGIDEZRIGIDEZRIGIDEZ
LONGITUDLONGITUDLONGITUDLONGITUD
1111 FUENTEFUENTEFUENTEFUENTE ÚNICAÚNICAÚNICAÚNICA CENTRALCENTRALCENTRALCENTRAL
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA
FUENTESFUENTESFUENTESFUENTES ENENENEN SUPERFICIESUPERFICIESUPERFICIESUPERFICIE ((4((44-4--6-66)6)))
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA
•• AplicadorAplicadorAplicadorAplicadorAplicadorAplicadorAplicadorAplicador flexibleflexibleflexibleflexibleflexibleflexibleflexibleflexible
•• 2828282828282828 cmcmcmcmcmcmcmcm dededededededede longitudlongitudlongitudlongitudlongitudlongitudlongitudlongitud
•• 88888888 catéterescatéterescatéterescatéterescatéterescatéterescatéterescatéteres
oo VENTAJASVENTAJASVENTAJASVENTAJAS:VENTAJASVENTAJASVENTAJASVENTAJAS:::
“COMODIDAD”“COMODIDAD”“COMODIDAD”“COMODIDAD”
LONGITUDLONGITUDLONGITUDLONGITUD
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA
PRESCRIPCIÓNPRESCRIPCIÓNPRESCRIPCIÓNPRESCRIPCIÓNPRESCRIPCIÓNPRESCRIPCIÓNPRESCRIPCIÓNPRESCRIPCIÓN DEDEDEDEDEDEDEDE DOSISDOSISDOSISDOSISDOSISDOSISDOSISDOSIS
•UNA•UNAUNAUNAUNAUNAUNAUNA UNICAUNICAUNICAUNICAUNICAUNICAUNICAUNICA FUENTE:FUENTE:FUENTE:FUENTE:FUENTE:FUENTE:FUENTE:FUENTE:
•0.5•0.50.50.50.50.50.50.5 CMCMCMCMCMCMCMCM DEDEDEDEDEDEDEDE SUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIE
•FUENTES•FUENTESFUENTESFUENTESFUENTESFUENTESFUENTESFUENTES ENENENENENENENEN SUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIE DELDELDELDELDELDELDELDEL APLICADORAPLICADORAPLICADORAPLICADORAPLICADORAPLICADORAPLICADORAPLICADOR
•1•1111111 CMCMCMCMCMCMCMCM DEDEDEDEDEDEDEDE LALALALALALALALA SUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIE
•• OPTIMIZACIÓNOPTIMIZACIÓNOPTIMIZACIÓNOPTIMIZACIÓNOPTIMIZACIÓNOPTIMIZACIÓNOPTIMIZACIÓNOPTIMIZACIÓN
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA
ASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOS DOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOS
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA
ASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOS DOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOS
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA
TÉCNICATÉCNICATÉCNICATÉCNICATÉCNICATÉCNICATÉCNICATÉCNICA
•• NONONONONONONONO ANESTESIAANESTESIAANESTESIAANESTESIAANESTESIAANESTESIAANESTESIAANESTESIA NINININININININI SEDACIÓNSEDACIÓNSEDACIÓNSEDACIÓNSEDACIÓNSEDACIÓNSEDACIÓNSEDACIÓN
•• AMBULATORIOAMBULATORIOAMBULATORIOAMBULATORIOAMBULATORIOAMBULATORIOAMBULATORIOAMBULATORIO
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA
ASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOS DOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOS
•• MÁRGENMÁRGENMÁRGENMÁRGENMÁRGENMÁRGENMÁRGENMÁRGEN SUPERIORSUPERIORSUPERIORSUPERIORSUPERIORSUPERIORSUPERIORSUPERIOR EEEEEEEE INFERIORINFERIORINFERIORINFERIORINFERIORINFERIORINFERIORINFERIOR DEDEDEDEDEDEDEDE 22222222 CMCMCMCMCMCMCMCM
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA
ASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOS DOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOS
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA
ASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOSASPECTOS DOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOSDOSIMETRICOS
SUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIESUPERFICIE
55555555 mmmmmmmmmmmmmmmm
1010101010101010 mmmmmmmmmmmmmmmm
1515151515151515 mmmmmmmmmmmmmmmm
2020202020202020 mmmmmmmmmmmmmmmm
ÚNICAÚNICAÚNICAÚNICAÚNICAÚNICAÚNICAÚNICA
150150150150%150150150150%%%%%%%
100100100100%100100100100%%%%%%%
70707070%70707070%%%%%%%
50505050%50505050%%%%%%%
40404040%40404040%%%%%%%
44444444
CCCCCCCC
150150150150%150150150150%%%%%%%
100100100100%100100100100%%%%%%%
80808080%80808080%%%%%%%
55555555%55555555%%%%%%%
42424242%42424242%%%%%%%
66666666
CCCCCCCC
200200200200%200200200200%%%%%%%
150150150150%150150150150%%%%%%%
100100100100%100100100100%%%%%%%
72727272%72727272%%%%%%%
53535353%53535353%%%%%%%
KILOVOLTAJEKILOVOLTAJEKILOVOLTAJEKILOVOLTAJEKILOVOLTAJEKILOVOLTAJEKILOVOLTAJEKILOVOLTAJE 100100100100%100100100100%%%%%%%
44444444%44444444%%%%%%%
23232323%23232323%%%%%%%
------------------------
9999%9999%%%%%%%
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECTALRECTALRECTALRECTALRECTALRECTALRECTALRECTAL
¿CÚANDO?¿CÚANDO?¿CÚANDO?¿CÚANDO?¿CÚANDO?¿CÚANDO?¿CÚANDO?¿CÚANDO?
>>>>>>>> TIEMPOTIEMPOTIEMPOTIEMPOTIEMPOTIEMPOTIEMPOTIEMPO ⇒⇒⇒⇒⇒⇒⇒⇒ >>>>>>>> RESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTA
55555555--------1010101010101010 SEMANASSEMANASSEMANASSEMANASSEMANASSEMANASSEMANASSEMANAS
•• INCONVENIENTESINCONVENIENTESINCONVENIENTESINCONVENIENTESINCONVENIENTESINCONVENIENTESINCONVENIENTESINCONVENIENTES retrasoretrasoretrasoretrasoretrasoretrasoretrasoretraso
•CIRUGÍA•CIRUGÍACIRUGÍACIRUGÍACIRUGÍACIRUGÍACIRUGÍACIRUGÍA⇒⇒⇒⇒⇒⇒⇒⇒ TOXICIDADTOXICIDADTOXICIDADTOXICIDADTOXICIDADTOXICIDADTOXICIDADTOXICIDAD
•RT.•RT.RT.RT.RT.RT.RT.RT. EXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVA ⇒⇒⇒⇒⇒⇒⇒⇒ EFECTOEFECTOEFECTOEFECTOEFECTOEFECTOEFECTOEFECTO
RADIOBIOLÓGICORADIOBIOLÓGICORADIOBIOLÓGICORADIOBIOLÓGICORADIOBIOLÓGICORADIOBIOLÓGICORADIOBIOLÓGICORADIOBIOLÓGICO
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECRECRECRECRECRECRECREC TALTALTALTALTALTALTALTAL
DOSISDOSISDOSISDOSISDOSISDOSISDOSISDOSIS
NEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIA
•• EXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVA
••44444444 frfrfrfrfrfrfrfr xxxxxxxx 650650650650650650650650 cGycGycGycGycGycGycGycGy (días(días(días(días(días(días(días(días consecutivos)consecutivos)consecutivos)consecutivos)consecutivos)consecutivos)consecutivos)consecutivos)
•• COMBINADACOMBINADACOMBINADACOMBINADACOMBINADACOMBINADACOMBINADACOMBINADA conconconconconconconcon RT.RT.RT.RT.RT.RT.RT.RT. ExternaExternaExternaExternaExternaExternaExternaExterna
•1•1111111 xxxxxxxx 500500500500500500500500 cGycGycGycGycGycGycGycGy
•2•2222222 XXXXXXXX 400400400400400400400400 cGycGycGycGycGycGycGycGy
•2•2222222 xxxxxxxx 550550550550550550550550 cGycGycGycGycGycGycGycGy
•1•1111111 xxxxxxxx 10001000100010001000100010001000 cGycGycGycGycGycGycGycGy
BT.BT.BT.BT.BT.BT.BT.BT.
BT.BT.BT.BT.BT.BT.BT.BT. PREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIA (HDR)(HDR)(HDR)(HDR)(HDR)(HDR)(HDR)(HDR)
BT.BT.BT.BT.BT.BT.BT.BT. EXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVA
UNIVERSIDADUNIVERSIDADUNIVERSIDADUNIVERSIDADUNIVERSIDADUNIVERSIDADUNIVERSIDADUNIVERSIDAD DEDEDEDEDEDEDEDE McGILLMcGILLMcGILLMcGILLMcGILLMcGILLMcGILLMcGILL (CANADA)(CANADA)(CANADA)(CANADA)(CANADA)(CANADA)(CANADA)(CANADA)
•100•100100100100100100100 pppppppp
T2T2T2T2-T2T2T2T2----T4---T4T4T4T4T4T4T4
>>>>>>>> 2.52.52.52.52.52.52.52.5 dededededededede márgenmárgenmárgenmárgenmárgenmárgenmárgenmárgen analanalanalanalanalanalanalanal
>>>>>>>> 44444444 cmcmcmcmcmcmcmcm dededededededede mucosamucosamucosamucosamucosamucosamucosamucosa
•BRAQUITERAPIA•BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ⇒⇒⇒⇒⇒⇒⇒⇒ 44444444 XXXXXXXX 650650650650650650650650 cGycGycGycGycGycGycGycGy
(CTV=(CTV=(CTV=(CTV=(CTV=(CTV=(CTV=(CTV= GTVGTVGTVGTVGTVGTVGTVGTV ++++++++ depósitosdepósitosdepósitosdepósitosdepósitosdepósitosdepósitosdepósitos intramesorectalesintramesorectalesintramesorectalesintramesorectalesintramesorectalesintramesorectalesintramesorectalesintramesorectales vistosvistosvistosvistosvistosvistosvistosvistos enenenenenenenen RRRRRRRRMN)MN)MN)MN)MN)MN)MN)MN)
pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0
32%32%32%32%32%32%32%32%
PRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACION
----------------
DIS COLUM RECTUM 2002; 45(11): 1486-93
BT.BT.BT.BT.BT.BT.BT.BT.
BT.BT.BT.BT.BT.BT.BT.BT. PREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIAPREOPERATORIA (HDR)(HDR)(HDR)(HDR)(HDR)(HDR)(HDR)(HDR)
BT.BT.BT.BT.BT.BT.BT.BT. EXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVA
UNIVERSIDADUNIVERSIDADUNIVERSIDADUNIVERSIDADUNIVERSIDADUNIVERSIDADUNIVERSIDADUNIVERSIDAD DEDEDEDEDEDEDEDE McGILLMcGILLMcGILLMcGILLMcGILLMcGILLMcGILLMcGILL (CANADA)(CANADA)(CANADA)(CANADA)(CANADA)(CANADA)(CANADA)(CANADA)
pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0
PRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACION
27%27%27%27%27%27%27%27% -------- 35%35%35%35%35%35%35%35%
7777777777777777 %%%%%%%%
RTRTRTRTRTRTRTRT ++++++++
RTRTRTRTRTRTRTRT ++++++++ BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA (HDR)(HDR)(HDR)(HDR)(HDR)(HDR)(HDR)(HDR)
DANISHDANISHDANISHDANISHDANISHDANISHDANISHDANISH COLORECTALCOLORECTALCOLORECTALCOLORECTALCOLORECTALCOLORECTALCOLORECTALCOLORECTAL CANCERCANCERCANCERCANCERCANCERCANCERCANCERCANCER GROUPGROUPGROUPGROUPGROUPGROUPGROUPGROUP SOUTHSOUTHSOUTHSOUTHSOUTHSOUTHSOUTHSOUTH
•• 5050505050505050 pppppppp
AdenocarcinomaAdenocarcinomaAdenocarcinomaAdenocarcinomaAdenocarcinomaAdenocarcinomaAdenocarcinomaAdenocarcinoma rectalrectalrectalrectalrectalrectalrectalrectal ≤≤≤≤≤≤≤≤ 1010101010101010 cmcmcmcmcmcmcmcm dededededededede márgenmárgenmárgenmárgenmárgenmárgenmárgenmárgen analanalanalanalanalanalanalanal
T3T3T3T3T3T3T3T3 conconconconconconconcon ≤≤≤≤≤≤≤≤ 55555555 mmmmmmmmmmmmmmmm dededededededede espesorespesorespesorespesorespesorespesorespesorespesor (RMN)(RMN)(RMN)(RMN)(RMN)(RMN)(RMN)(RMN)
••RTRTRTRTRTRTRTRT EXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNA ++++++++ QTQTQTQTQTQTQTQT
PelvisPelvisPelvisPelvisPelvisPelvisPelvisPelvis posteriorposteriorposteriorposteriorposteriorposteriorposteriorposterior ⇒⇒⇒⇒⇒⇒⇒⇒ 48.648.648.648.648.648.648.648.6 GyGyGyGyGyGyGyGy (1.8(1.8(1.8(1.8(1.8(1.8(1.8(1.8 Gy)Gy)Gy)Gy)Gy)Gy)Gy)Gy)
TumorTumorTumorTumorTumorTumorTumorTumor ++++++++ 11111111 cmcmcmcmcmcmcmcm ⇒⇒⇒⇒⇒⇒⇒⇒ 6060606060606060 GyGyGyGyGyGyGyGy
•BRAQUITERAPIA•BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA ⇒⇒⇒⇒⇒⇒⇒⇒ 500500500500500500500500 cGycGycGycGycGycGycGycGy (1(1(1(1(1(1(1(1 frfrfrfrfrfrfrfr aaaaaaaa 1010101010101010 mm)mm)mm)mm)mm)mm)mm)mm)
pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0pT0N0
27%27%27%27%27%27%27%27%
PRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACIONPRESERVACION
38%38%38%38%38%38%38%38%
INT J RADIAT ONCOL 2006; 64(2): 461-465
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO RT.RT.RT.RT.RT.RT.RT.RT.
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO
RT.RT.RT.RT.RT.RT.RT.RT. EXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNA ++++++++ BTBTBTBTBTBTBTBT NEOADYUVANTENEOADYUVANTENEOADYUVANTENEOADYUVANTENEOADYUVANTENEOADYUVANTENEOADYUVANTENEOADYUVANTE
RESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOS
•pT0•pT0pT0pT0pT0pT0pT0pT0 2525252525252525 -------- 60%60%60%60%60%60%60%60%
•FRACASO•FRACASOFRACASOFRACASOFRACASOFRACASOFRACASOFRACASO LOCALLOCALLOCALLOCALLOCALLOCALLOCALLOCAL 3333-3333----25%---25%25%25%25%25%25%25%
••CONSERVACIÓNCONSERVACIÓNCONSERVACIÓNCONSERVACIÓNCONSERVACIÓNCONSERVACIÓNCONSERVACIÓNCONSERVACIÓN DEDEDEDEDEDEDEDE ESFINTERESFINTERESFINTERESFINTERESFINTERESFINTERESFINTERESFINTER -------- 67%67%67%67%67%67%67%67%
•TOXICIDAD•TOXICIDADTOXICIDADTOXICIDADTOXICIDADTOXICIDADTOXICIDADTOXICIDAD
•-•------- 90%90%90%90%90%90%90%90% PROCTITISPROCTITISPROCTITISPROCTITISPROCTITISPROCTITISPROCTITISPROCTITIS G2G2G2G2G2G2G2G2
“An“An“An“An“An“An“An“An
“An“An“An“An“An“An“An“An unsatisfactoryunsatisfactoryunsatisfactoryunsatisfactoryunsatisfactoryunsatisfactoryunsatisfactoryunsatisfactory applicationapplicationapplicationapplicationapplicationapplicationapplicationapplication forforforforforforforfor brachytherapybrachytherapybrachytherapybrachytherapy-brachytherapybrachytherapybrachytherapybrachytherapy--not-----notnotnotnotnotnotnot takingtakingtakingtakingtakingtakingtakingtaking intointointointointointointointo
accountaccountaccountaccountaccountaccountaccountaccount thethethethethethethethe basicbasicbasicbasicbasicbasicbasicbasic principlesprinciplesprinciplesprinciplesprinciplesprinciplesprinciplesprinciples ofofofofofofofof brachytherapybrachytherapy-brachytherapybrachytherapybrachytherapybrachytherapybrachytherapybrachytherapy------- cancancancancancancancan nevernevernevernevernevernevernevernever bebebebebebebebe
transformedtransformedtransformedtransformedtransformedtransformedtransformedtransformed intointointointointointointointo aaaaaaaa satisfactorysatisfactorysatisfactorysatisfactorysatisfactorysatisfactorysatisfactorysatisfactory applicationapplicationapplicationapplicationapplicationapplicationapplicationapplication bybybybybybybyby anyanyanyanyanyanyanyany formformformformformformformform ofofofofofofofof
sophisticatedsophisticatedsophisticatedsophisticatedsophisticatedsophisticatedsophisticatedsophisticated computercomputercomputercomputercomputercomputercomputercomputer assistedassistedassistedassistedassistedassistedassistedassisted treatmenttreatmenttreatmenttreatmenttreatmenttreatmenttreatmenttreatment planningplanningplanningplanningplanningplanningplanningplanning onononononononon sophisticatedsophisticatedsophisticatedsophisticatedsophisticatedsophisticatedsophisticatedsophisticated
3333D3333DDDDDDD imaging”imaging”imaging”imaging”imaging”imaging”imaging”imaging”
TheThe GECGEC--ESTROESTRO HandbookHandbook ofof Brachytherapy.Brachytherapy. GerboauletGerboaulet etet colcol
NINGUNANINGUNANINGUNANINGUNANINGUNANINGUNANINGUNANINGUNA PLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓN
(OPTIMIZACIÓN)(OPTIMIZACIÓN)(OPTIMIZACIÓN)(OPTIMIZACIÓN)(OPTIMIZACIÓN)(OPTIMIZACIÓN)(OPTIMIZACIÓN)(OPTIMIZACIÓN) SUSTITUYESUSTITUYESUSTITUYESUSTITUYESUSTITUYESUSTITUYESUSTITUYESUSTITUYE AAAAAAAA
UNUNUNUNUNUNUNUN IMPLANTEIMPLANTEIMPLANTEIMPLANTEIMPLANTEIMPLANTEIMPLANTEIMPLANTE INADECUADOINADECUADOINADECUADOINADECUADOINADECUADOINADECUADOINADECUADOINADECUADO
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECTALRECTALRECTALRECTALRECTALRECTALRECTALRECTAL
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECTALRECTALRECTALRECTALRECTALRECTALRECTALRECTAL
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECTALRECTALRECTALRECTALRECTALRECTALRECTALRECTAL
>>>>>>>> 11111111 CMCMCMCMCMCMCMCM
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECTALRECTALRECTALRECTALRECTALRECTALRECTALRECTAL
TÉCNICATÉCNICATÉCNICATÉCNICATÉCNICATÉCNICATÉCNICATÉCNICA
ADECUADAADECUADAADECUADAADECUADAADECUADAADECUADAADECUADAADECUADA SESELECCIÓNSESELECCIÓNSELECCIÓNSESELECCIÓNSELLLLECCIÓECCIÓECCIÓECCIÓNNNN DEDEDEDEDEDEDEDE PACIEPACIENTESPACIEPACIENTESPACIENTESPACIEPACIENTESPACIENNNNTESTESTESTES
•BRAQUITERAPIA•BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
•OBJETIVO•OBJETIVOOBJETIVOOBJETIVOOBJETIVOOBJETIVOOBJETIVOOBJETIVO
•TÉCNICA•TÉCNICATÉCNICATÉCNICATÉCNICATÉCNICATÉCNICATÉCNICA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECTALRECTALRECTALRECTALRECTALRECTALRECTALRECTAL
IMAGENIMAGENIMAGENIMAGENIMAGENIMAGENIMAGENIMAGEN ALALALALALALALAL DIAGNÓSTICODIAGNÓSTICODIAGNÓSTICODIAGNÓSTICODIAGNÓSTICODIAGNÓSTICODIAGNÓSTICODIAGNÓSTICO
ECOECOECOECO-ECOECOECOECO-------
RMNRMNRMNRMNRMNRMNRMNRMN
ENDOSCOPIAENDOSCOPIAENDOSCOPIAENDOSCOPIAENDOSCOPIAENDOSCOPIAENDOSCOPIAENDOSCOPIA
COLONOSCOPIACOLONOSCOPIACOLONOSCOPIACOLONOSCOPIACOLONOSCOPIACOLONOSCOPIACOLONOSCOPIACOLONOSCOPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECTALRECTALRECTALRECTALRECTALRECTALRECTALRECTAL
VALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓN RESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECTALRECTALRECTALRECTALRECTALRECTALRECTALRECTAL
VALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓN RESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECTALRECTALRECTALRECTALRECTALRECTALRECTALRECTAL
VALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓNVALORACIÓN RESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTA
RACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓN
RADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIARADIOTERAPIA
•• PACIENTESPACIENTESPACIENTESPACIENTESPACIENTESPACIENTESPACIENTESPACIENTES INOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLES
•• RECIDIVASRECIDIVASRECIDIVASRECIDIVASRECIDIVASRECIDIVASRECIDIVASRECIDIVAS
•• TrasTrasTrasTrasTrasTrasTrasTras RT.RT.RT.RT.RT.RT.RT.RT. ExternaExternaExternaExternaExternaExternaExternaExterna exclusivaexclusivaexclusivaexclusivaexclusivaexclusivaexclusivaexclusiva
•• EnEnEnEnEnEnEnEn anastomosisanastomosisanastomosisanastomosisanastomosisanastomosisanastomosisanastomosis
•• EnEnEnEnEnEnEnEn muñónmuñónmuñónmuñónmuñónmuñónmuñónmuñón
RACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓNRACIONALIZACIÓN
NCCNNCCNNCCNNCCNNCCNNCCNNCCNNCCN GUIDELINESGUIDELINESGUIDELINESGUIDELINESGUIDELINESGUIDELINESGUIDELINESGUIDELINES (2.2011(2.2011(2.2011(2.2011(2.2011(2.2011(2.2011(2.2011 UPDATE)UPDATE)UPDATE)UPDATE)UPDATE)UPDATE)UPDATE)UPDATE)
•• RT.RT.RT.RT.RT.RT.RT.RT. EXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNAEXTERNA ENENENENENENENEN TUMORESTUMORESTUMORESTUMORESTUMORESTUMORESTUMORESTUMORES
IRRESECABLESIRRESECABLESIRRESECABLESIRRESECABLESIRRESECABLESIRRESECABLESIRRESECABLESIRRESECABLES
MáximoMáximoMáximoMáximoMáximoMáximoMáximoMáximo 5454545454545454 GyGyGyGyGyGyGyGy
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO ESCALADAESCALADA DEDE DOSISDOSIS
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO
ESCALADAESCALADA DEDE DOSISDOSIS
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
ENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIAENDOCAVITARIA (≤(≤(≤(≤(≤(≤(≤(≤ 11111111 cm)cm)cm)cm)cm)cm)cm)cm)
INTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIAL (>(>(>(>(>(>(>(> 11111111 cm)cm)cm)cm)cm)cm)cm)cm)
INFILTRACIÓNINFILTRACIÓN ENEN
PROFUNDIDADPROFUNDIDAD
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECTALRECTALRECTALRECTALRECTALRECTALRECTALRECTAL
DOSISDOSISDOSISDOSISDOSISDOSISDOSISDOSIS
PACIENTESPACIENTESPACIENTESPACIENTESPACIENTESPACIENTESPACIENTESPACIENTES INOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLES
•EXCLUSIVA•EXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVA
•6•6666666 XXXXXXXX 600600600600600600600600 cGycGycGycGycGycGycGycGy (2(2(2(2-(2(2(2(2----3---3333333 vecesvecesvecesvecesvecesvecesvecesveces enenenenenenenen semana)semana)semana)semana)semana)semana)semana)semana)
••1010101010101010 xxxxxxxx 500500500500500500500500 cGycGycGycGycGycGycGycGy
•COMBINADA•COMBINADACOMBINADACOMBINADACOMBINADACOMBINADACOMBINADACOMBINADA conconconconconconconcon RT.RT.RT.RT.RT.RT.RT.RT. ExternaExternaExternaExternaExternaExternaExternaExterna (45(45(45(45(45(45(45(45 –––––––– 5050505050505050 Gy)Gy)Gy)Gy)Gy)Gy)Gy)Gy)
•4•4444444 xxxxxxxx 400400400400400400400400 cGycGycGycGycGycGycGycGy
•6•6666666 XXXXXXXX 500500500500500500500500 cGycGycGycGycGycGycGycGy
•2•2222222 xxxxxxxx 600600600600600600600600 cGycGycGycGycGycGycGycGy
•3•3333333 xxxxxxxx 10001000100010001000100010001000 cGycGycGycGycGycGycGycGy
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA INTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIAL
IMPLANTESIMPLANTESIMPLANTESIMPLANTESIMPLANTESIMPLANTESIMPLANTESIMPLANTES PERINEALES.PERINEALES.PERINEALES.PERINEALES.PERINEALES.PERINEALES.PERINEALES.PERINEALES. MUPITMUPITMUPITMUPITMUPITMUPITMUPITMUPIT
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA INTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIAL
TÉCNICATÉCNICATÉCNICATÉCNICATÉCNICATÉCNICATÉCNICATÉCNICA
•• ANESTESIAANESTESIAANESTESIAANESTESIAANESTESIAANESTESIAANESTESIAANESTESIA EPIDURAL/GENERALEPIDURAL/GENERALEPIDURAL/GENERALEPIDURAL/GENERALEPIDURAL/GENERALEPIDURAL/GENERALEPIDURAL/GENERALEPIDURAL/GENERAL
•• INGRESOINGRESOINGRESOINGRESOINGRESOINGRESOINGRESOINGRESO
•ANALGESIA•ANALGESIAANALGESIAANALGESIAANALGESIAANALGESIAANALGESIAANALGESIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA INTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIAL
PLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓNPLANIFICACIÓN
TACTACTACTACTACTACTACTAC
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA RECTALRECTALRECTALRECTALRECTALRECTALRECTALRECTAL
DOSISDOSISDOSISDOSISDOSISDOSISDOSISDOSIS
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA INTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIALINTERSTICIAL
•EXCLUSIVA•EXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVAEXCLUSIVA
1010101010101010 xxxxxxxx 500500500500500500500500 cGycGycGycGycGycGycGycGy
99999999 xxxxxxxx 600600600600600600600600 cGycGycGycGycGycGycGycGy
•COMBINADA•COMBINADACOMBINADACOMBINADACOMBINADACOMBINADACOMBINADACOMBINADA conconconconconconconcon RT.RT.RT.RT.RT.RT.RT.RT. ExternaExternaExternaExternaExternaExternaExternaExterna (45(45(45(45(45(45(45(45 –––––––– 5050505050505050 Gy)Gy)Gy)Gy)Gy)Gy)Gy)Gy)
44444444 xxxxxxxx 600600600600600600600600 cGycGycGycGycGycGycGycGy
22222222 fraccionesfraccionesfraccionesfraccionesfraccionesfraccionesfraccionesfracciones diariasdiariasdiariasdiariasdiariasdiariasdiariasdiarias separadasseparadasseparadasseparadasseparadasseparadasseparadasseparadas 66666666 horashorashorashorashorashorashorashoras
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO
CA.CA.CA.CA.CA.CA.CA.CA. RECTORECTORECTORECTORECTORECTORECTORECTO
PACIENTESPACIENTESPACIENTESPACIENTESPACIENTESPACIENTESPACIENTESPACIENTES INOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLESINOPERABLES
RESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOSRESULTADOS
•RESPUESTA•RESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTARESPUESTA CLINICACLINICACLINICACLINICACLINICACLINICACLINICACLINICA COMPLETACOMPLETACOMPLETACOMPLETACOMPLETACOMPLETACOMPLETACOMPLETA 58%58%58%58%58%58%58%58% -------- 73%73%73%73%73%73%73%73%
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA INTRAOPERATORIAINTRAOPERATORIAINTRAOPERATORIAINTRAOPERATORIAINTRAOPERATORIAINTRAOPERATORIAINTRAOPERATORIAINTRAOPERATORIA
•T3•T3T3T3T3-T3T3T3------- T4T4T4T4T4T4T4T4
•1x•1x1x1x1x1x1x1x 1010101010101010 GyGyGyGyGyGyGyGy prescritasprescritasprescritasprescritasprescritasprescritasprescritasprescritas aaaaaaaa 0,50,50,50,50,50,50,50,5 cmcmcmcmcmcmcmcm
•CL:•CL:CL:CL:CL:CL:CL:CL: 82%82%82%82%82%82%82%82% aaaaaaaa loslosloslosloslosloslos 22222222 añosañosañosañosañosañosañosaños
REFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONES
REFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONES
NEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIANEOADYUVANCIA
EnEnEnEnEnEnEnEn pacientespacientespacientespacientespacientespacientespacientespacientes seleccionadosseleccionadosseleccionadosseleccionadosseleccionadosseleccionadosseleccionadosseleccionados susususususususu usousousousousousousouso comocomocomocomocomocomocomocomo complementocomplementocomplementocomplementocomplementocomplementocomplementocomplemento
aaaaaaaa RTRTRTRTRTRTRTRT externa,externa,externa,externa,externa,externa,externa,externa, incrementaincrementaincrementaincrementaincrementaincrementaincrementaincrementa elelelelelelelel “downstaging”“downstaging”“downstaging”“downstaging”“downstaging”“downstaging”“downstaging”“downstaging” yyyyyyyy
obteniéndoseobteniéndoseobteniéndoseobteniéndoseobteniéndoseobteniéndoseobteniéndoseobteniéndose unaunaunaunaunaunaunauna mayormayormayormayormayormayormayormayor supervivenciasupervivenciasupervivenciasupervivencia.supervivenciasupervivenciasupervivenciasupervivencia
AsíAsíAsíAsíAsíAsíAsíAsí mismomismomismomismomismomismomismomismo incrementaincrementaincrementaincrementaincrementaincrementaincrementaincrementa dededededededede modomodomodomodomodomodomodomodo significativosignificativosignificativosignificativosignificativosignificativosignificativosignificativo enenenenenenenen manosmanosmanosmanosmanosmanosmanosmanos
expertas,expertas,expertas,expertas,expertas,expertas,expertas,expertas, lalalalalalalala tasatasatasatasatasatasatasatasa dededededededede preservaciónpreservaciónpreservaciónpreservaciónpreservaciónpreservaciónpreservaciónpreservación esfinteriana,esfinteriana,esfinteriana,esfinteriana,esfinteriana,esfinteriana,esfinteriana,esfinteriana, conconconconconconconcon lolololololololo
quequequequequequequeque conllevaconllevaconllevaconllevaconllevaconllevaconllevaconlleva unaunaunaunaunaunaunauna mejoramejoramejoramejoramejoramejoramejoramejora enenenenenenenen lalalalalalalala calidadcalidadcalidadcalidadcalidadcalidadcalidadcalidad dededededededede vidavidavidavida.vidavidavidavida
SuSuSuSuSuSuSuSu usousousousousousousouso exclusivoexclusivoexclusivoexclusivoexclusivoexclusivoexclusivoexclusivo neoadyuvante,neoadyuvante,neoadyuvante,neoadyuvante,neoadyuvante,neoadyuvante,neoadyuvante,neoadyuvante, enenenenenenenen pacientespacientespacientespacientespacientespacientespacientespacientes
seleccionados,seleccionados,seleccionados,seleccionados,seleccionados,seleccionados,seleccionados,seleccionados, aúnaúnaúnaúnaúnaúnaúnaún enenenenenenenen desarrollo,desarrollo,desarrollo,desarrollo,desarrollo,desarrollo,desarrollo,desarrollo, alcanzaalcanzaalcanzaalcanzaalcanzaalcanzaalcanzaalcanza unaunaunaunaunaunaunauna tasatasatasatasatasatasatasatasa dededededededede
respuestasrespuestasrespuestasrespuestasrespuestasrespuestasrespuestasrespuestas semejantesemejantesemejantesemejantesemejantesemejantesemejantesemejante aaaaaaaa lalalalalalalala obtenidaobtenidaobtenidaobtenidaobtenidaobtenidaobtenidaobtenida porporporporporporporpor abordajesabordajesabordajesabordajesabordajesabordajesabordajesabordajes
convencionales,convencionales,convencionales,convencionales,convencionales,convencionales,convencionales,convencionales, aportandoaportandoaportandoaportandoaportandoaportandoaportandoaportando unaunaunaunaunaunaunauna menormenormenormenormenormenormenormenor morbilidadmorbilidadmorbilidadmorbilidadmorbilidadmorbilidadmorbilidadmorbilidad
perioperatoriaperioperatoriaperioperatoriaperioperatoria.perioperatoriaperioperatoriaperioperatoriaperioperatoria
REFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONES
REFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONESREFLEXIONES
RESCATERESCATERESCATERESCATERESCATERESCATERESCATERESCATE
EsEsEsEsEsEsEsEs unaunaunaunaunaunaunauna técnicatécnicatécnicatécnicatécnicatécnicatécnicatécnica efectivaefectivaefectivaefectivaefectivaefectivaefectivaefectiva enenenenenenenen elelelelelelelel controlcontrolcontrolcontrolcontrolcontrolcontrolcontrol dededededededede recaídarecaídarecaídarecaídarecaídarecaídarecaídarecaída local,local,local,local,local,local,local,local, tantotantotantotantotantotantotantotanto enenenenenenenen
abordajesabordajesabordajesabordajesabordajesabordajesabordajesabordajes endocavitarios,endocavitarios,endocavitarios,endocavitarios,endocavitarios,endocavitarios,endocavitarios,endocavitarios,
abordajesabordajesabordajesabordajesabordajesabordajesabordajesabordajes intersticialesintersticialesintersticialesintersticiales.intersticialesintersticialesintersticialesintersticiales
comocomocomocomocomocomocomocomo cuandocuandocuandocuandocuandocuandocuandocuando esteesteesteesteesteesteesteeste nononononononono eseseseseseseses posible,posible,posible,posible,posible,posible,posible,posible, enenenenenenenen
BRAQUITERAPIABRAQUITERAPIABRAQUITERAPIABRAQUITERAPIA INTRAOPERATORIAINTRAOPERATORIA:INTRAOPERATORIAINTRAOPERATORIA::: IOHDRIOHDRIOHDRIOHDR
ElElElElElElElEl usousousousousousousouso dededededededede RadioterapiaRadioterapiaRadioterapiaRadioterapiaRadioterapiaRadioterapiaRadioterapiaRadioterapia IntraoperatoriaIntraoperatoriaIntraoperatoriaIntraoperatoriaIntraoperatoriaIntraoperatoriaIntraoperatoriaIntraoperatoria conconconconconconconcon electrones,electrones,electrones,electrones,electrones,electrones,electrones,electrones, estaestaestaestaestaestaestaesta bienbienbienbienbienbienbienbien
establecidoestablecidoestablecidoestablecidoestablecidoestablecidoestablecidoestablecido comocomocomocomocomocomocomocomo capazcapazcapazcapazcapazcapazcapazcapaz dededededededede incrementarincrementarincrementarincrementarincrementarincrementarincrementarincrementar controlcontrolcontrolcontrolcontrolcontrolcontrolcontrol locallocallocallocallocallocallocallocal yyyyyyyy dededededededede
complementarcomplementarcomplementarcomplementarcomplementarcomplementarcomplementarcomplementar aaaaaaaa lalalalalalalala cirugíacirugíacirugíacirugíacirugíacirugíacirugíacirugía subóptimasubóptimasubóptimasubóptimasubóptimasubóptimasubóptimasubóptima enenenenenenenen casoscasoscasoscasoscasoscasoscasoscasos dededededededede rescaterescaterescaterescate.rescaterescaterescaterescate ElElElElElElElEl usousousousousousousouso
dededededededede IOHDRIOHDRIOHDRIOHDRIOHDRIOHDRIOHDRIOHDR representarepresentarepresentarepresentarepresentarepresentarepresentarepresenta unaunaunaunaunaunaunauna alternativaalternativaalternativaalternativaalternativaalternativaalternativaalternativa vávávávávávávávállllllllidaidaidaidaidaidaidaida aaaaaaaa loslosloslosloslosloslos electrones,electrones,electrones,electrones,electrones,electrones,electrones,electrones, conconconconconconconcon
unununununununun mayormayormayormayormayormayormayormayor potencialpotencialpotencialpotencialpotencialpotencialpotencialpotencial dededededededede adaptabilidadadaptabilidadadaptabilidadadaptabilidadadaptabilidadadaptabilidadadaptabilidadadaptabilidad aaaaaaaa situacionessituacionessituacionessituacionessituacionessituacionessituacionessituaciones inhomogéneasinhomogéneasinhomogéneasinhomogéneasinhomogéneasinhomogéneasinhomogéneasinhomogéneas
yyyyyyyy capacidadcapacidadcapacidadcapacidadcapacidadcapacidadcapacidadcapacidad paraparaparaparaparaparaparapara explorarexplorarexplorarexplorarexplorarexplorarexplorarexplorar alternativasalternativasalternativasalternativasalternativasalternativasalternativasalternativas enenenenenenenen fraccionamientofraccionamientofraccionamientofraccionamientofraccionamientofraccionamientofraccionamientofraccionamiento
IMPORTANTEIMPORTANTEIMPORTANTEIMPORTANTE:IMPORTANTEIMPORTANTEIMPORTANTEIMPORTANTE:::::::
TécnicaTécnicaTécnicaTécnicaTécnicaTécnicaTécnicaTécnica dependientedependientedependientedependientedependientedependientedependientedependiente dededededededede entrenamientoentrenamientoentrenamientoentrenamiento:entrenamientoentrenamientoentrenamientoentrenamiento::::::: curvacurvacurvacurvacurvacurvacurvacurva dededededededede aprendizajeaprendizajeaprendizajeaprendizajeaprendizajeaprendizajeaprendizajeaprendizaje