SCREENING BUFFELGRASS (Cenchrus ciliaris) FROM SELECTED

PASTURE SEED FARMS IN TANZANIA FOR SEED-BORNE

MICROORGANISMS: PATHOGENICITY AND EFFECT ON

GERMINATION

JOHN ALOYCE MLAY

A DISSERTATION SUBMITTED IN PARTIAL FULFILMENT OF THE

REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN

TROPICAL ANIMAL PRODUCTION OF SOKOINE UNIVERSITY OF

AGRICULTURE, MOROGORO, TANZANIA.

2013
 i

ABSTRACT

Buffelgrass (Cenchrus ciliaris) is one of the important perennial grasses in the

pasture industry in Tanzania. It is drought tolerant, nutritious and has rapid growth

characteristics. Three hundred sixty grams of seed samples of C. ciliaris collected

from six selected pasture seed farms were screened for seedborne microorganisms at

the African Seed Health Centre, Sokoine University of Agriculture, Morogoro

Tanzania. The Blotter method, the direct plating and the Top of Paper methods were

used for fungal, bacterial and seed germination tests, respectively. Fungal and

bacteria pathogens of economic importance that were detected included; Phoma spp

(28.5 %), Curvularia lunata (17.34 %), Alternaria alternata (14.09 %) Bipolaris spp.

(12.2 %), Acidovorax, Xanthomonas and Pseudomonas spp. Characterization using

morphological and biochemical tests including molecular techniques and

pathogenicity of fungal and bacteria strains were done on buffelgrass seedlings.

Results indicated that seed germination decreased (<50%) with an increase in fungal

infection. Seed samples from LITI Tengeru had the lowest seed germination (8 %)

and high fungal (37.8 %) incidence on their caryopses. Pathogenicity of Bipolaris

spp., Phoma spp., Pyricularia grisea, Fusarium pallidoroseum, Exserohilum

rostratum, Nigrospora oryzae and Acidovorax, Pseudomonas and Xanthomonas

bacterial strains were confirmed on C. ciliaris seedlings. Some species of the

detected fungi were found in both spikelets and caryopses. Further research is needed

on losses caused by fungal infection in buffelgrass seeds.

 ii

DECLARATION

I, John Aloyce Mlay, do hereby declare to the Senate of Sokoine University of

Agriculture that, this dissertation is my own original work and has neither been

submitted nor concurrently been submitted for higher degree award in any other

institution.

Signature ………………………………. Date ………………………….

John Aloyce Mlay

(MSc. Tropical Animal Production Candidate)

The above declaration is confirmed by;

Signature …………………… Date……………………………

1. Prof. R. B. Mabagala

(Supervisor)

Signature ………………….. Date ……………………………

2. Prof. E.J. Mtengeti

(Supervisor)
 iii

COPYRIGHT

No part of this dissertation may be produced, stored in any retrieval system or

transmitted in any form or by any means without prior written permission of the

author or Sokoine University of Agriculture in that behalf.

 iv

ACKNOWLEDGEMENTS

My sincere credit is first to the Almighty God.

Special thanks are given to my supervisors Prof. R. B. Mabagala and Prof. E. J.

Mtengeti for their effective suggestions and positive critiques which altogether led to

the successful completion of this work.

I am highly indebted to the Ministry of Livestock and Fisheries Development for

providing me this study leave, Commission for Science Technology COSTECH for

financial support during my study and lecturers in the Department of Animal Science

and Production (DASP) for instructions during coursework training. Prof. Katule, in

particular is acknowledged for his lectures on the use of Statistical Analysis System

(SAS) programs.

I am also grateful to Dr. E. R. Mbega for his comments and suggestions during this

study, technicians Mary Njala and Nashon Jackson for their unlimited guidance in

the laboratory, all staff at the African Seed Health Centre (AfSHC) and DASP for

their unlimited support.

I am also obligated to my classmates and my friends for their hearts giving which led

to successful completion of my study. Special thanks also go to my lab mates Stella

Chirimi and Hashim Ibrahim for their assistance in the laboratory and screenhouse

experiments. The encouragements and full support from my postgraduate colleagues,

my sisters and brothers are unforgettable.

 v

Finally, I would like to express my deep heart gratitude to my wife Dafrosa John, for

her unlimited moral and material support.

 vi

DEDICATION

This work is dedicated to my beloved wife Dafrosa John Tarimo, my children

Venitha, Magnus, Joel and Innocent. I always love you.

My mother, the late Yohana Aloyce Mlay and my brother, the late Michael F. Mlay;

whose support and guidance laid the foundation of my education. I will always miss

you.
 vii

TABLE OF CONTENTS

ABSTRACT i

DECLARATION ii

COPYRIGHT iii

ACKNOWLEDGEMENTS iv

DEDICATION vi

TABLE OF CONTENTS vii

LIST OF TABLES xi

LIST OF FIGURES xiii

LIST OF PLATES xiv

LIST OF APPENDICES xvi

LIST OF ABBREVIATIONS AND SYMBOLS xvii

CHAPTER ONE 1

1.0 INTRODUCTION 1

1.1 Background Information 1

1.2 Justification

…………………………………………………………………….5

1.3 Objectives………… 6

1.3.1 Specific objectives 6

CHAPTER TWO 7

2.0 LITERATURE REVIEW 7

2.1 Description of Buffelgrass Plant 7

 viii

2.1.1 Feeding value 8

2.1.2 Characteristics 8

2.2 Overview on Pasture Production in Tanzania9

2.3 Seed Quality 10

2.4 Seed Health

…………………………………………………………………...12

CHAPTER THREE 13

3.0 MATERIALS AND METHODS 13

3.1 Collection of Seed Samples 13

3.2 Seed Health Testing 14

3.3 Preparation of Working Seed Samples 14

3.4 Determination of Moisture Content 15

3.5 Purity Analysis 15

3.6 Caryopsis Determination 15

3.7 Determination of Seed Germination 16

3.8 Caryopsis Germination 16

3.9 Seed Health Testing for Fungal and Bacterial Pathogens 16

3.9.1 Detection and identification of fungal microorganisms 16

3.9.2 Detection of bacteria from buffelgrass seed samples 18

3.10 Purification of Bacterial Isolates 18

3.10.1 Gram staining reaction 18

3.10.2 Kovac’s oxidase test 19

3.10.3 Arginine dihydrolase 19

 ix

3.10.4 Gelatin liquefaction media 20

3.10.5 Starch hydrolysis 20

3.10.6 Nitrate reduction 21

3.10.7 Potato soft rot 21

3.10.8 Hypersensitivity reaction 22

3.10.9 Detection of bacteria in buffelgrass seeds using polymerase

chain reaction (PCR)22

3.11 Effect of Fungal Microorganisms on Seed Germination 23

3.11.1 Artificial inoculation of buffelgrass seeds with seedborne

pathogenic fungal conidia 23

3.12 Pathogenicity of Fungal and Bacterial Isolates on Buffelgrass Seedlings 24

3.12.1 Pathogenicity of fungal strains 24

3.12.1.1 Inoculum preparation 25

3.12.2 Pathogenicity tests for bacterial strains 27

3.12.3 Re-isolation of bacteria from infected buffelgrass leaves 28

3.13 Buffelgrass Seed Cost and Seeding Rate in Relation to Seed Quality from

Selected Pasture Seed Farms in Tanzania. 28

CHAPTER FOUR 29

4.0 RESULTS AND DISCUSSION 29

4.1 Seed Health Testing 29

4.1.1 Seedborne fungi detected in buffelgrass seed samples 29

4.1.2 Relative percentage of fungi in pasture seed farms 32

 x

4.1.3 Incidence of fungal and bacterial diseases under field conditions

34

4.2. Bacterial Species Detected on Buffelgrass Seeds 35

4.2.1 Hypersensitive reaction on tobacco and sweet pepper 38

4.2.2 Identification of bacteria using Polymerase Chain reaction

(PCR) 39

4.2 3 Pathogenicity of fungi and bacteria isolated from buffelgrass

seeds 41

4.3 Effect of Fungal Infection on Seed Germination 51

4.3.1 Germination percent of buffelgrass seeds 51

4.3.2 Caryopsis index of buffelgrass seeds 55

4.3.3 Purity of buffelgrass seed samples 56

4.3.4 Moisture content of buffelgrass seed samples 57

4.3.5 Germination of infected buffel grass seed caryopsis 58

4.3.6 Fungal species located on buffelgrass seed caryopsis and

spikelets 60

4.4 Buffelgrass Seed Cost and Seeding Rate in Relation to Seed Quality from

Selected Pasture Seed Farms in Tanzania 63

CHAPTER FIVE 65

5.0 CONCLUSIONS AND RECOMMENDATIONS 65

5.1 Conclusions 65

5.2 Recommendations 66
 xi

REFERENCES 68

APPENDICES 93
 xii

LIST OF TABLES

Table 1: Sources and dates of harvest of Cenchrus ciliaris seed

samples used in this study....................................................................13

Table 2: Incidence of fungal microorganisms in buffelgrass seeds

collected from pasture seed farms in Tanzania....................................31

Table 3: Other micro-organisms detected from pasture seed samples

used in this study..................................................................................34

Table 4: Biochemical and morphological characteristics of bacterial

isolates detected from pasture seed samples used in this study...........37

Table 5: Detection of bacteria using polymerase chain reaction (PCR)

on buffelgrass seed samples collected from selected pasture

seed farms in Tanzania.........................................................................40

Table 6: Frequency of occurrence of fungal disease on buffelgrass

seedlings at 7 to 28 days after inoculation from selected

pasture farms in Tanzania....................................................................42

Table 7: Fungal disease symptoms observed on buffelgrass seedlings

at 7 to 28 days after inoculation...........................................................44

Table 8: Disease symptoms observed on buffelgrass seedlings

inoculated with different fungi used in this study................................45

Table 9: Lesions length caused by bacterial blight isolates on

buffelgrass leaves at 7 to 28 days after inoculation using the

clip method...........................................................................................47
 xiii

Table 10: Disease lesions caused by bacterial streak isolates on

buffelgrass seedlings 7 to 28 days after inoculation using

spray method........................................................................................49

Table 11: Characteristics of re-isolated bacteria from inoculated

buffelgrass plants.................................................................................50

Table 12: Fungal microorganisms re-isolated from inoculated

buffelgrass plants following pathogenicity tests..................................51

Table 13: Percentage germination of buffelgrass seeds collected from

selected pasture seed farms in Tanzania..............................................52

Table 14: Caryopsis indices for buffelgrass seeds from selected pasture

farms in Tanzania.................................................................................56

Table 15: Percentage purity of buffelgrass seeds collected from selected

pasture seed farms in Tanzania............................................................57

Table 16: Moisture content (percentage) of buffelgrass seeds collected

from selected pasture seed farms in Tanzania.....................................58

Table 17: Buffelgrass caryopsis germination percent from selected

pasture seed farms in Tanzania............................................................60

Table 18: Frequency of occurrence of associated fungi on buffel grass

caryopsis from selected pasture farms in Tanzania.............................61

Table 19: Frequency of fungal microorganisms on buffel grass seed

spikelets from selected pasture farms in Tanzania...............................62

Table 20: Buffelgrass seed cost and seeding rate in relation to seed

quality values from selected pasture farms in Tanzania......................64

 xiv

LIST OF FIGURES

Figure 1: Buffelgrass seed germination and dormant percentage trends

over time................................................................................................9

Figure 2: Incidence (percentage) of fungi detected in the buffelgrass

seed sample collected from selected pasture farms in

Tanzania...............................................................................................32

Figure 3: Fungal infection levels (percentage) in pasture farms

surveyed in this study in Tanzania.......................................................33

Figure 4: Disease severity rating on buffelgrass leaves 7 to 28 days

after inoculation...................................................................................43
 xv

LIST OF PLATES

Plate 1: Conidia of fungi detected on buffelgrass seeds collected from

selected pasture seed farms in Tanzania..................................................30

Plate 2: Buffelgrass leaf infections as assessed from National

Livestock Research Institute Mpwapwa and Mazimbu pasture

farms in Tanzania;...................................................................................35

Plate 3: Mixed bacterial and fungal buffelgrass leaf infection (A and

B) from field samples collected from Vikuge and Livestock

Research Centre Mabuki pasture farms, respectively..............................35

Plate 4: Purified yellow bacterial colonies (A) grown on Nutrient Agar

medium from National Livestock Research Institute Mpwapwa

buffelgrass seeds using the Direct plating method...................................37

Plate 5: Purified cream bacteria colonies (B) on King B medium from

Mabuki buffel grass seeds tested using the Direct plating

method.....................................................................................................38

Plate 6: Gel electrophoresis products as amplified by the XanF7/R7

primer pair of bacteria isolated from buffelgrass seeds

collected selected pasture farms in Tanzania...........................................40

Plate 7: Disease symptoms caused by bacterial blight isolates on

buffelgrass seedlings two weeks after inoculation using the

clip method..............................................................................................46
 xvi

Plate 8: Disease symptoms caused by bacterial streak isolates using

Spray method on buffelgrass leaves two weeks after

inoculation...............................................................................................48

Plate 9: Different fungal species (A) growing on buffelgrass seed

collected from LRC Mabuki, detected using Blotter method..................54

Plate 10: Fungi (B) growing on buffelgrass seed collected from NLRI

Mpwapwa detected using Blotter method...............................................54

Plate 11: Fungal species detected on buffelgrass caryopsis from

Livestock Research Centre Mabuki using Blotter method......................62

 xvii

LIST OF APPENDICES

Appendix 1: ANOVA tables for buffelgrass seed Germination tests.....................93

Appendix 2: ANOVA tables for disease severity rating on buffelgrass

plants 7 to 28 days after inoculation..................................................94

Appendix 3: ANOVA tables for fungal disease symptoms observed on

buffelgrass seedlings at 7 to 28 days after inoculation......................95

Appendix 4: ANOVA tables for disease lesions length caused by

bacterial isolates on buffelgrass leaves at 7 to 28 days

after inoculation using clip method....................................................96

Appendix 5: ANOVA tables for disease lesions caused by bacterial

isolates on buffelgrass seedlings at 7 to 28 days after

inoculation using spay method...........................................................97

Appendix 6: ANOVA tables for buffelgrass Caryopsis germination

tests.....................................................................................................99
 xviii

LIST OF ABBREVIATIONS AND SYMBOLS

⁰C Degrees Centigrade
% Percentage
ABS Abnormal seedling
AfSHC African Seed Health Centre
ANOVA Analysis of Variance
cm Centimetre
CRD Completely Randomized Design
CV Coefficient of variation
DAI Days after inoculation
DASP Department of Animal Science and Production
DM Dry matter
DNA Deoxyribonucleic acid
dNTP Deoxy-ribonucleotide tri-phosphate
DS Dead seed
FAO Food and Agriculture Organization
H Hour
Ha Hectare
HR Hypersensitive Reaction
HS Hard seed
IM Inert Matter
ISTA International Seed Testing Association
KB King’s medium B
LITI Livestock Training Institute
LRC Livestock Research Centre
LU Livestock Unit
MC Moisture Content
MLFD Ministry of Livestock and Fisheries Development
MWLD Ministry of Water and Livestock Development
NA Nutrient Agar
NLP National Livestock Policy
NLRI National Livestock Research Institute
NUV Near Ultra Violet
PCR Polymerase Chain Reaction
PDA Potato Dextrose Agar
PLS Pure Live Seed
PS Pure Seed
RH Relative Humidity
S.E Standard Error
SD Standard Deviation
SUA Sokoine University of Agriculture
Xoc Xanthomonas oryzae pv. oryizicola
Xoo Xanthomonas oryza pv. oryzae
 1

CHAPTER ONE

1.0 INTRODUCTION

1.1 Background Information

Pasture is a major source of feed for livestock in many parts of the world. In

Tanzania, pasture provides over 90 percent of ruminants feed requirements (Sarwatt

and Mollel, 2002). However, cultivar development and improvement in most African

countries including, Tanzania is rare. Africa ranks last in the world’s pasture

production, cultivar improvement, seed quality control and distribution of pasture

seeds (Jutzi, 1986; Lwoga et al., 1984). In Tanzania, availability of high quality

pasture and pasture seeds is a major production constraint (NLP, 2006). Factors

known to influence pasture production include, plant species, soil fertility, weather,

plant diseases, and agronomic practices.

In Tanzania, where pasture production is mostly practised in semi-arid areas, the

former/early improved measures for pasture production included evaluation and

promotion of drought tolerant species such as Chloris gayana and Cenchrus ciliaris,

for high yields and nutritive value (Mero and Uden, 1998). However, their adoption

rate has remained very slow partly due to poor availability of quality seeds in the

country. Issoufou et al. (2008) also reported many of earlier studies by Mero and

Uden (1998) and others, on buffel grass to have concentrated on estimating the

nutritional value only, such as preference by animals through intake and in vitro

organic digestibility. Other studies focused on nitrogen use efficiency (Rudmanna et

al., 2001), variation and the relationship of several seed and spikelets related traits of

buffelgrass (M’Seddi et al., 2003).

 2

In areas where improved pasture measures are practiced, seed production is usually

intended to make quality seeds or vegetative material available to interested

farmers/producers (HSU, 1994). Key seed quality aspects include varietal purity,

high germination percentage, absence of disease conditions or their causative

organisms, proper moisture content and specific seed weight (Santos, 2010). At

recommended seed rates, such seeds should be capable of germinating, emerging,

and establishing uniformly under normal field conditions. With quality seeds,

farmers are more likely to achieve an even stand of the stated cultivar without

introducing weeds or diseases. This requires appropriate measurements and

assurance of quality in the market such that seeds sold are accurately described. Seed

quality assurance is an integral part of any effective seed supply system.

In Tanzania specialized systems for pasture seed production are lacking. Often,

pasture seed production is carried out with limited inputs and the crop is harvested

with limited attention to seed quality. In such cases, farmers or other opportunistic

seed gatherers may hand pluck pasture seeds from roadsides, plantations or around

food crop-fields. Seeds harvested in this manner are also processed, handled and

stored under different ways but pooled at selling. This usually characterises the

informal seed production sector in good seasons with plenty of rain that may lead to

excellent flowering and seed formation but of poor seed quality.

In this system, grass seed may be hand stripped into containers or flower stalks cut

with a reaping hook or sickle. Seed heads are then dried and threshed. At threshing,

seeds may be swept off the ground, a method that leads to high inert matter content
 3

(non-seed material), especially if seeds are in short supply and have a high market

value. Although it is possible through the opportunist system to produce seed of high

quality at low cost, it is often blended/mixed by a range of seed maturity, at harvest.

Quality depends on the skill of the grower and timeliness of harvesting operations.

Availability of good seed quality seeds has been listed among important factors

needed to improve ruminant nutrition in Tanzania (Mwilawa, 2005).

Buffelgrass is one of the perennial grasses considered to be useful pasture plants

(Grice and Martin 2005). Its rapid growth and reproduction allow it to spread and

establish quickly to out-compete many native species (Jackson, 2005). In Tanzania,

an increasing demand and interest on drought tolerant buffelgrass has been found to

raise (Ngota, J. Personal communication, 2010) probably due to the current climate

changes which seems not to affect the crop seriously. Jorge et al. (2008) also noted

the same increase in demand and interest in buffelgrass in Ethiopia. Buffelgrass is a

prolific seed producer, yielding between 490 to 2300 seeds m−2 Hacker and Ratcliff

(1989) or 150 to 500kg/ha (Cook, 2007). It is also high in forage yield, 13,800kg/ha

with no fertilizers (Ocumpaugh et al., 1994).

Poor seed germination has been reported by Bishaw (2003) in buffelgrass. The

author noted genetical and pathological aspects to be associated with poor

germination for most pasture seeds. This stresses the importance of seed health

aspects to agricultural development, both food and pasture crop production. Pasture

seed may be passive carrier for transmitting seed-borne pathogens which cause

partial or total loss of the pasture crop. Seed-borne pathogens may be pathogenic or
 4

non-pathogenic. Seedborne pathogens affect germination, plant vigour, and cause

disease in seedlings and plants if not properly managed (Wulff et al, 2011). Usually

seeds are said to be infected when they carry fungi, bacteria, virus or nematodes

which can hinder seed germination or be transmitted to infect the resulting crop

(Maude, 1996).

Fungi are considered the most important group of plant pathogens in agriculture,

causing losses in both quantity and quality (Fletcher et al, 2006; Hajihasani et al.,

2012). Furthermore, of all plant pathogens, fungi are reported to be responsible for

the greatest damage to plants in both agricultural and natural ecosystem (Fletcher et

al., 2010). In grasses, most of the pathogens found in seeds cause smut, false rust,

ergot, blight or leaf spot and inflorescence disease (Maritza et al., 2009). Important

plant fungal pathogens reported to be associated with buffelgrass include, Fusarium

oxysporum, Bipolaris spp., Pyricularia grisea, Clavisceps, F. moniliforme, F.

pallidoroseum, and Phoma spp. (Makiela et al; 2003, Mathur and Mahandhar, 2003;

Fridiel et al; 2006, Ndomba, 2009; Cameron, 2010). According to Perrot (2000)

buffelgrass blight caused by P. grisea and ergot (Claviceps spp.) affecting seed

production, are the most important diseases of buffelgrass. F. oxysporum has also

been found in association with buffel dieback (Makiela et al., 2003). Studies by

Campbell and Medd (2003) also showed that post-dispersal infection of mature seeds

(as would occur in seed banks) is possible and infection results in a temporary

reduction in seedling growth. Therefore, the effect of seed-borne microorganisms,

their effect on germination, seedling growth rate and seed pricing as related to seed

quality were studied in the current research.

 5

1.2 Justification

Poor seed germination has been observed in pasture seed farms in the country and

this has contributed to lack of progress in pasture production and scarcity of quality

pasture seeds. Studies on microorganisms associated with grass seeds (including

buffelgrass) have shown presence of fungal infection (4.5%) (Ndomba, 2009).

Attempts have been made to control fungal seed infection through treatment of seeds

with chemicals (such as copper sulphate) but did not improve germination (Rukiko,

2011). It was suspected that, the observed low germination percentage was due to

fungal infection. This has economic implication to farmers as they have to use high

seed rates to improve initial plant population. Although, there have been minimal

research on seed quality and seed health of buffelgrass in Tanzania, there is still a

scarcity of published reports. Furthermore, there is paucity of information on the

infection levels of seeds from various locations and their effect on yield of

buffelgrass.

In Tanzania, seed technology has mainly been focused on moisture content, purity

and germination percentage (William, 2006). Likewise, pasture producing farms

have based their seed quality evaluations on these aspects with very little/no

emphasis on seed health testing. The genera of pathogenic fungi that are most found

in grass seeds include Ustilago, Uromyces and Claviceps which cause smut, false

rusts, ergot and inflorescence diseases, respectively. Most of them reduce seed

viability and cause death of seedlings at the stage of pre-emergence and post-

emergence (Maritza et al., 2009). However, the location of these fungi on or within

buffelgrass seed structure has not been investigated. Understanding the nature of
 6

buffelgrass seed infection by these fungal pathogens may help to determine the

potential for seed transmission as well as the potential efficacy of seed treatment

techniques for eradication of the fungi in infected seed and/or prevention of seed

transmission. With increasing specialisation and intensification on grass seed

production, routine disease and insect control programmes should now increasingly

become part of grass seed management. Thus, detection, identification and control of

seedborne pathogens should now be an integral part of quality pasture seed

production. To address this information gap, buffelgrass seeds were screened for

seed-borne microorganisms and their effects on seed germination.

1.3 Objectives

The general objective of this study was to screen buffelgrass for seed-borne

microorganisms, their pathogenic potential and effect on seed germination.

1.3.1 Specific objectives

(i) To detect and identify seed-borne microorganisms in buffelgrass seeds

(ii) To determine the pathogenicity of the isolated microorganisms on

buffelgrass.

(iii) To determine the effect of isolated fungal microorganisms on

germination of buffelgrass seeds

 7

CHAPTER TWO

2.0 LITERATURE REVIEW

2.1 Description of Buffelgrass Plant

Buffelgrass (Cenchrus ciliaris) belongs to the family Poaceae (Gramineae). It is a

perennial tufted rhizomatous grass and one of the best forage grasses for semi-arid

areas in the subtropics and tropics (McIvor, 2005; Makiela and Harrower, 2008). The

species grows well with annual rainfall of 350-800 mm and an altitude of 1000 m

(Mushtaque et al., 2010). The seeding rate of 9 kg/ha has been reported by ISTA

(2005). It is bisexual, with bisexual spikelets and hermaphrodite florets. It has high

productivity and nutritive value which makes it a grass of choice for pastoral uses

(Farooq et al., 2003). It is considered excellent for pasture in hot, dry areas and

provides intermittent grazing during drought periods in the tropics (Singariya, et al.,

2011). It is also a promising grass for rehabilitation of arid rangeland and has

tolerance to heavy grazing and fires (Mushtaque et al., 2010; M’seddi et al., 2003).

The grass can be fed green, turned into silage, or made into hay and is said to

increase flow of milk in cattle and impart a sleek and glossy appearance (Singariya et

al., 2011). This grass has excellent soil binding capacity which helps to conserve soil

in desert areas (Sinha et al.;1996), and has also expressed maximum antibacterial and

antifungal activities in humans by suppressing the growth of certain microbes

(Singariya, et al., 2011).

 8

2.1.1 Feeding value

Buffelgrass withstands heavy grazing, it is also highly drought tolerant, well adapted

to arid and semi-arid areas (Batra and Kumar, 2003; Cameron, 2010). It is highly

palatable to all kinds of grazing animals, but the substantially high lignin content (3-

5 %) reduces its digestibility (Minson and Bray, 1986). The nutritive value of

buffelgrass is high with 10.7 % crude protein (Mushtaque et al., 2010), and

digestibility which ranges from 50 to 60 %, (Jacobs et al., 2004; Cook, 2007)

depending on stage of growth, cultivar, and soil fertility (incl. fertilizer use). The

grass, when fed green is said to increase flow of milk in cattle and imparting a sleek

and glossy appearance (Burton, 1993). Phosphorus levels are usually higher in

buffelgrass than other tropical grasses and ranges from 0.15 to 0.65% in the dry

matter (Cook, 2007; IF, 2010).

2.1.2 Characteristics

At least 20–25 mm of rain is required for seed germination and establishment, as

buffelgrass seeds need to be moist for about 3–5 days in order to germinate. Plants

can germinate from seed, mature and flower within 6 weeks of a significant less than

100 mm of rainfall (Issoufou et al., 2008). Germination trend of buffelgrass seed

increases with storage time while dormancy is very high at harvesting time (Cook,

2007; Ibarra et al., 2004; Fig. 1). Buffelgrass seed may survive for up to an estimated

4 years in the soil, but plants can live for many years (possibly up to about 20 years)

(CRC, 2008). It is very palatable when young, and remains fairly palatable at

maturity. Per 100 g, the fresh plant is reported to contain on a zero-moisture basis,

11.0 g protein, 2.6 g fat, 73.2 g total carbohydrate, 31.9 g fibre and 13.2 g ash at
 9

vegetative growth stage (Gohl, 1981). Per 100 g, hay is reported to contain, on a

zero-moisture basis, 7.4 g protein, 1.7 g fat, 79.2 g total carbohydrate, 35.2 g fibre,

and 11.7 g ash (Aganga and Tshwenyane, 2003). Kumar et al. (2005) reported

Buffelgrass seed yield of 97 kg/ha under fertilizer application, and other literature

reported the yield of 150-500 kg seed/ha on well established pasture depending on

growing conditions and variety (IF, 2010).

Buffel grass seed % Germination

10 20 30 40 50 60 70 80 90 100

% Germination
%

% Dormancy

0 2 4 6 8 10 12

Months from date of harvest

Figure 1: Buffelgrass seed germination and dormant percentage trends over

time

Source: The buffel grass seed company (BSC), (2001)

2.2 Overview on Pasture Production in Tanzania

The rangeland resource of Tanzania is estimated to cover about 60 million hectares,

of which about 40 million are devoted to grazing and 20 million to fallow and

forestland (NLP, 2006). This resource supports about 17 million livestock units

(LU). Proper range management and disease control (tsetse) would open up more
 10

grazing land that could support over 20 million LU (Kavana, et al., 2005). Attempts

to improve pasture management and the use of established forages in Tanzania

started in 1930s (MWLD, 2005). Major thrust has been on evaluation of different

pasture species for adaptability to different agro-ecological zones, forage

conservations techniques, use of browse species and the use of crop residues. In

Tanzania, pasture establishment mostly remained practiced in institutional and

parastatal farms; probably with very few or none in smallholder farms. Temu et al.

(2005) reported reliance on communal land tenure system on grazinglands to have

discouraged individual investment and unavailability of pasture seeds. Now,

challenges are still for policy makers to enact good land tenure systems to encourage

individual investment.

2.3 Seed Quality

Availability of high quality pure seeds in Tanzania has become a constraint in the

production of pasture and pasture seeds (NLP, 2006). Seed quality aspects include

genetics, species physical appearance, physiological properties (germination vigour),

freedom from seedborne pests (seed health) and sanitary quality (ISTA, 2005). Low

caryopsis index (30%), low germination (12%) and poor seed quality of buffelgrass

seeds was reported by Rukiko (2011) on pasture seeds collected from four pasture

seed producing farms in the country. The low seed quality observed imply that the

usual sowing rate of 2 to 5 kg seed/ha described by Cameron (2010) need to be

adjusted and/or can no longer be relied upon. Seeds are the primary means of

delivering the potential of plant genetic resources; thus, maintaining seed quality is

of utmost importance. Maintenance of seed quality in storage from the time of

 11

production until the seed is planted is imperative to assure its planting value and

avoid financial loss. The best alternative to avoid the risks associated with storage,

which is deterioration of the quality of seeds, is to avoid storing the seeds under

improper conditions. However, there are times when seed growers and dealers

carryover seed lots across years in anticipation for better market, insure adequate

supply in the following year, or other reasons. Under such circumstances the

question is how to manage the seeds to maintain their quality (viability and vigor)

throughout the storage period. In general, seeds maintain their quality under

favorable storage conditions longer than if stored under poor conditions, e.g., high

temperature and relative humidity.

A question that is frequently asked is whether good storage conditions enhance the

quality of the seed? The answer is no. However, the quality of seeds can be

maintained and the rate of seed deterioration can be slowed down by good storage

environment. Once seeds deteriorate, their physiological quality cannot be restored

because seed deterioration is inexorable and irreversible process, just like aging.

Even seed enhancement techniques may allow the maximum expression of seed

potential, but will not alter their basic physiological quality. Therefore, the extent and

speed of drop in seed quality is largely dependent on the storage temperature, relative

humidity (RH), seed moisture content, length of storage time, kind of seeds, and

initial seed quality.

 12

2.4 Seed Health

Seed health refers primarily to absence of disease causing organisms such as fungi,

bacteria and viruses, and animal pests such as eelworms and insects in seed (Mathur

and Kongsdal, 2003). It is an important step in the management of crop diseases

(Hajihasani et al., 2012). Little is known about the status of this group of pathogens

in buffelgrass growing regions of Tanzania. Beckstead et al. (2007) described the

infection process as a race for the endosperm reserves of the seed. Losses due to

infection include reduced seed germination leading to pre-emergence and post-

emergence seedling mortality and hence reduced seed yield and quality. According

to Singh and Agrawal (2005) infected seeds can be serious focal points for disease in

the field/growing crops. They also reported seedborne pathogens in general,

including Fusarium spp. being able to survive longer in seeds under cool, dry

condition than higher temperatures and relative humidity under storage.

Because of the occurrence of infected buffelgrass seed in different parts of the

country and persistence of the seed-borne diseases in seed producing farms, seed

health testing is increasingly becoming important in the management of seed-borne

pathogens. One of the important areas is to investigate the seedborne nature of

microorganism (fungi and bacteria) infecting buffelgrass. The current study focused

on the effect of buffelgrass seed infection on germination of buffelgrass and its

implication on pasture establishment in Tanzania.

 13

CHAPTER THREE

3.0 MATERIALS AND METHODS

3.1 Collection of Seed Samples

Cenchrus ciliaris seed samples used in the present study were collected from 6 farms

as shown in Table 1. A total of three hundred and sixty grams of buffelgrass seeds

samples were collected from six pasture seed farms in Tanzania. Each sample (60g)

used in the present study was from seeds harvested in the previous season (Table 1).

Seed samples were collected from November 2011 to January 2012. Each collected

seed sample was packed in a paper bag and labelled (variety name, collector, farm

area planted, date harvested, disease recorded (if any) and date collected). Seed

samples were transported to the African Seed Health Centre (AfSHC), Sokoine

University of Agriculture (SUA), Morogoro for analysis.

Table 1: Sources and dates of harvest of Cenchrus ciliaris seed samples used in
this study

Sample Farm Location Rainfall (mm) Date of Altitude

no. harvest (m.a.s.l)*
1 Vikuge Pasture Kibaha 900-1000 August 2011 124
2 LRC- Tanga Tanga 1230- 1400 August 2011 6
3 NLRI Mpwapwa < 700 May 2011 1280
4 LRC Mabuki Mwanza 350-850 May 2011 1166
5 LITI -Tengeru Arusha 900- 1000 August 2011 1250
6 Mazimbu (SUA) Morogoro < 800 July 2010 512
* m.a.s.l = metres above sea level, LRC = Livestock Research Centre, LITI = Livestock
Training Institute, NLRI = National Livestock Research Institute and SUA = Sokoine
University of Agriculture.

3.2 Seed Health Testing

 14

Seed health testing was conducted at the African Seed Health Centre, Sokoine

University of Agriculture (SUA), Morogoro, Tanzania. A Completely Randomized

Design (CRD), arranged in four replications was used. Experimental units were the

methods used to test the seed health, viz. blotter method for detecting fungal

pathogens, high constant temperature oven method for moisture content

determination, top of paper method for germination tests and direct plating on agar

substrate for detecting bacterial organisms. Treatments were buffelgrass seed

samples collected from selected pasture farms in Tanzania.

3.3. Preparation of Working Seed Samples

The working sample was obtained by hand-halving method following the procedures

described by the International Seed Testing Association (ISTA, 2005). Each of the

collected seed sample was poured on a smooth clean surface, mixed thoroughly in

mound with flat-edged spatula and finger. The mound was divided into two halves

and each half was halved again making four portions. Each of the four portions was

halved making eight portions, which were arranged into two rows of four. The

alternate portions were combined and retained to get four portions. The other four

portions were removed and poured back in to the original bag of the collected

sample. The retained mound of the alternate portions was divided again to obtain the

weight of the required working sample (6 g) as recommended by Mathur and

Kongsdal (2003) and ISTA (2005) using a weighing balance type Sartorius CP1200

1S.

3.4 Determination of Moisture Content

 15

The high constant temperature oven method (ISTA, 2005) was used to determine

moisture content (MC) of seed samples. Petri dishes were dried in the oven for one

Hour at 130°C and cooled. Ten grams of seeds from the submitted sample in four

replicates were evenly distributed over the surface of 8.5 cm diameter petri dishes.

The weight of petri dish and its cover were taken before and after filling it with

seeds. Petri dishes were placed in the oven maintained at 130 ± 1°C and dried for one

hour (ISTA, 2005), and after drying petri dishes were placed in a dessicator for 30

minutes to cool. Then MC (%) was calculated as (M2-M3) x 100/M2-M1; where M 1 =

weight of container with cover, M2 = weight of container with cover and seeds before

drying and M3 = weight of container after drying (ISTA, 2005).

3.5 Purity Analysis

The working sample for purity analysis for buffelgrass was 6 g. Each sub-sample

was analysed for the following categories: pure seed, inert matter, seed of other crops

and results were expressed in percentage (ISTA, 2005).

3.6 Caryopsis Determination

Thirty seeds were randomly picked from the working sample and with the aid of

magnifying lens glumes were removed using forceps/scalpels and seed grain

(caryopsis) squeezed out of the florets. The proportion of caryopsis (seed grain/units)

obtained from thirty buffelgrass seeds were determined to give caryopsis index in

percentage.

3.7 Determination of Seed Germination

 16

The Top of Paper method was used for germination test (ISTA, 2005; Rao et al.,

2006). Four hundred seeds of each buffelgrass sample representing four replications

(100 seeds per replicate) were spaced uniformly (100 seeds/container) and

adequately apart on three moist filter papers in well labelled plastic container with

height and diameter of 10 cm x 15cm, respectively. The containers were then

covered and incubated at 20 - 30°C and were checked for germination after 14 days.

Thereafter, percentages of normal (NS), abnormal (ABS) seedlings and dead seeds

(DS) were recorded as described by ISTA (2005). The data obtained in each category

were analysed in Completely Randomized Design using SAS computer package.

Least significant difference (P ≤ 0.05) based on the different sample tested for each

category were done using the General Linear Model (GLM) procedure of SAS.

3.8 Caryopsis Germination

Top of paper method and procedure for determination of caryopsis germination was

done as in section 3.7 above.

3.9 Seed Health Testing for Fungal and Bacterial Pathogens

3.9.1 Detection and identification of fungal microorganisms

The standard Blotter method as described by Mathur and Kongsdal (2003) was used

to detect and identify fungal microorganisms in the collected pasture seeds. Four

hundred untreated seeds of buffelgrass from each seed sample were plated on three

well moisten blotters in glass petri dishes (25 seeds per petri dish) in four replication

of 100 seeds each. The petri dishes with seeds were incubated for 7 days at 20-25 °C

under alternating cycle of 12 h near Ultra violet (NUV) light and 12h darkness
 17

(ISTA, 2005). After 7 days, individual seeds were examined for the presence or

absence of fungi (x 12, x 25 and x 50 magnification) under the stereomicroscope.

The mycelia of the fungi were placed in a sterile drop of water, covered by a glass

slip on a sterilized grass slide and placed on the compound microscope ((Leica® MS

5). The examinations of fungi that developed on each seed was confirmed by

examining mycelium and/or conidia under different magnifications (x 10 x 20 and x

40) under a compound microscope. The fungal species present on each seed were

recorded and the percentage incidence of each fungus per sample was computed.

Identification of fungi was based on the type of spore growth, colour and

morphological or “habit character” of fruiting bodies on seed (Habib et al., 2011;

Mathur and Kongsdal, 2003).

Subcultures on potato dextrose agar (PDA) slants were made for preservation of

isolated fungal cultures for further analysis. Incidence (%) of seedborne pathogens in

the 400 seeds per sample was calculated as described by Habib et al. (2011).

No. of infested seed

Incidence (%) = × 100 ….. (i)
Total number of seed assessed
The relative percentage of particular species within the genus of fungi was calculated

using the Ghiasian et al. (2004) formula;

Number of fungal species isolated

Relative percentage (%) = x 100 .... (ii)
Total number of fungi isolated
 18

3.9.2 Detection of bacteria from buffelgrass seed samples

Direct plating on Nutrient Agar (NA) was used for detection of bacteria from

buffelgrass seed (Mortensen, 2005). Two hundred seeds of buffelgrass were

aseptically plated in eight replicates (25 seeds/petri dish) onto NA in the lamina

Airflow chamber and incubated at 28.5°C for 72h. A sterile loop was used to transfer

different representative bacterial colonies from NA media and streaked in triplicate

onto NA (if yellow or orange) and King’s B (KB) medium (if cream and white) and

purified for further characterization and identification. The new plates were

incubated at 27-29 °C for 12-24 h.

3.10 Purification of Bacterial Isolates

Bacterial colonies from all pasture seeds were purified for characterisation and

identification by a series of single-colony transfers on King’s B medium (for

cream/white/gray colonies) (Kings et al., 1954) and NA (yellow colonies). Purified

colonies were further transferred to NA before preservation using Protect ® bacteria

preservers (Mortensen, 2005) for further analysis.

3.10.1 Gram staining reaction

The Gram-reaction of each isolate was determined following the staining procedure

described by Mortensen (2005). Bacteria cultures purified from buffelgrass and

stored at 5 ⁰C were reactivated on NA and well grown colonies were transferred by

using a sterile toothpick, mixed for at most ten seconds in a drop of 3 % KOH

aqueous solution on a glass slide. The tooth pick was then raised few centimetres

from the glass slide. If the strands of viscid material were observed, the tested
 19

bacterial strain was recorded as Gram-negative. Absence of strands of viscid material

was recorded as Gram-positive.

3.10.2 Kovac’s oxidase test

The oxidase test was done following procedures described by Kovac’s (1956) and

Hildebrand and Schroth (1972). A Whatman filter paper No.1 was placed in a petri

dish and 3-4 drops of fresh prepared 1% aqueous solution of tetramethyl -p-

Phenylenediamine dihydrochloride was added on the centre of the filter paper. Using

a platinum wire, a loopful of bacteria grown on NA or KB was streaked on the moist

filter paper. Isolates which developed purple color within 10 seconds were taken as

positive, purple color in 10-60 seconds were taken as slow positive and those with no

color for more than 60 seconds were taken as negative for Oxidase test (Dickey and

Kelman, 1988).

3.10.3 Arginine dihydrolase

The ability of pseudomonad to grow under anaerobic conditions was measured by

this test, where ammonia was evolved and therefore, caused the change in pH,

indicating positive reaction. The procedure described by Lelliot and Stead (1987)

were used. Twenty-four-hour old bacterial cultures grown on NA media were stab-

inoculated into the test tube containing 3 ml of Thornley’s medium (Mortensen,

2005). All tubes were covered with 2 ml of sterile mineral oil to create anaerobic

condition. Two test tubes (one without bacteria but sealed with mineral oil and the

other with bacteria but without being sealed) were also included for comparison. The

test tubes were incubated for three days at 27⁰C. The change of colour to red
 20

(alkaline) was recorded as positive for the presence of arginine dihydrolase enzyme,

and lack of colour change was recorded as negative.

3.10.4 Gelatin liquefaction media

The procedure described by Mortensen (2005) was used to prepare Gelatin media.

The media were stab inoculated with each bacterial isolate grown for 24-hour on NA

medium and incubated at 28 oC. After 7 and 14 days of incubation, each isolate was

evaluated for gelatin liquefaction. The isolates in test tubes were kept at 4 oC for 30

minutes and gently tipped immediately. The results were recorded as positive when

the gelatin remained liquid as the tube was gently tipped and negative when the

gelatin was solid (Dickey and Kelman, 1988; Egamberdiyeva, 2005).

3.10.5 Starch hydrolysis

Taxonomic characterization of certain bacteria with ability to hydrolyse starch was

used to differentiate bacteria in this test. The 24-hour –old-bacterial cultures grown

on NA were streaked on starch agar medium (starch soluble, 20g; Peptone, 5g; Beef

extract, 3g; agar, 20g in 1 liter distilled water with PH 7 and autoclaved at 121oC for

15 minutes) in a zig zag manner to evaluate their ability to hydrolyze starch (amylase

production). The plates were incubated at 28oC and for 3 days starch hydrolysis was

observed by flooding the plates with Lugol's iodine solution for 30 seconds. The

appearance of clear zone around the line of growth of each isolate indicated starch

hydrolysis (Aneja, 1996), and recorded as positive reaction. Appearance of reddish

colored zone indicated that there was a partial hydrolysis of starch to dextrin, while a

negative reaction gave starch staining blue-black.

 21

3.10.6 Nitrate reduction

Nitrate reduction test was used to determine the ability of the isolates to reduce

nitrate to nitrite. The procedure described by Fahy and Persley (1983) was used. A

heavy loopful of growth of 24 hour-old-pure culture was inoculated by stabbing and

sealed with 3 ml-sterilized molten agar to avoid false positives and incubated at 28
o
C. A non inoculated test tube was also included. Observations were made after 7

days of inoculation. Three drops of reagent A (starch iodide solution) together with

three drops of reagent B (hydrochloric acid solution) were added to each test tube

and results were recorded. A change of colour of the reagent to blue-black was an

indicator for nitrate reduction (positive), no change in colour was considered as a

negative reaction, implying that, nitrate was not reduced or was partly or totally

reduced beyond nitrite (Dickey and Kelman, 1988).

3.10.7 Potato soft rot

The test was done as described by Lelliot and Stead (1987). Washed round potato

tubers were surface disinfected in alcohol 75 % and briefly flamed. The disinfected

potato tubers were aseptically cut into slice of 7-8 mm thick. The slices were placed

in a sterile petri dish filled with 3-4 mm of distilled water. A small groove was made

in each potato slice and smeared with bacterial growth of 24 hour-old-culture grown

on NA medium. Un-inoculated control was included. The petri dishes were incubated

in darkness at 26°C for 24h. Symptoms were tested by drawing an inoculating wire

loop across the surface to determine whether the slice has rotten beyond the

inoculation point. Negative reaction was considered when slight or no rot at the

inoculating point was observed.

 22

3.10.8 Hypersensitivity reaction

Tobacco (Nicotiana tabacum) and sweet pepper (Capsicum annum) plants were used

in this test as procedures described by Mortensen (2005). An aqueous suspension of

24 hour-old-bacterial cultures were prepared in sterile distilled water. Sufficient

inoculum was injected and infiltrated with a syringe without a needle to the

intercellular space of leaf blade of respective plants. The injection was done in more

than one leaf and one section of a leaf and the control was arranged in opposite side

of the main vein. Labelling of the inoculated areas was done using adhesive labels.

The plants were incubated at 22-25 °C, with about 80-85 % relative humidity. Rapid

collapse and water-soaking of inoculated tobacco of host tissue in the infiltration area

within 24 hours or utmost 48 hours for inoculated pepper followed by a dry, light–

brown of localized necrosis within 3 days indicated positive reaction and the

bacterium was likely a pathogen for another host.

3.10.9 Detection of bacteria in buffelgrass seeds using polymerase chain

reaction (PCR)

Bacterial cultures on NA were harvested from the colonies of 48h as described by

Mbega et al. (2012) and DNA extraction was conducted using procedures described

in the DNeasy Blood and Tissue kit protocol handbook (Qiagen, 2006). The

extracted DNA was tested using PCR primers amplifying a 402bp fragment of

xanthan synthesis pathway gene, gumDPrimers: X-gumD-fw

5’GGCCGCGAGTTCTACATGTTCAA and X-gumD-rv

5’CACGATGATGCGGATATCCAGCCACAA) for spacer region of Xoo/Xoc,

respectively (Mbega et al., 2012). The amplification was performed in eppendorf

 23

mastercycler gradient PCR machine (GenAmp® 9700 PCR System); using procedures

described by Mbega et al.(2012). A 25-µl reaction mixture was used for the

multiplex PCR reaction (1.5 µl of DNA template, 24 µl of 10 mM dNTP, 9 µl of 25

mM MgC12, 30 µl of 10 xTaq polymerase buffer, 1.5 µl each primer (10 pmols each)

and 1.5 µl (0.5units) Taq DNA polymerase (Fermentas, inc.)). The reaction involved

an initial de-naturation of 5 min at 95 ⁰C followed by 30 cycles of de-naturation for

95 °C for 10s, annealing at 56 °C for 1sec, elongation at 72 °C for 10 sec. the final

extension was 72 °C for 3 min.

Eight microlitre of each amplified PCR product was fractionated on 1.5 % agarose

gel electrophoresis in 0.5X TBE (Tris-borate EDTA) buffer for 45 minutes. The

agarose gel was pre-stained with ethidium bromide (12 µl) and was visualized under

UV light then photographed with Kodak camera (Black and white).

3.11 Effect of Fungal Microorganisms on Seed Germination

3.11.1 Artificial inoculation of buffelgrass seeds with seedborne pathogenic

fungal conidia

Buffelgrass seeds were surface sterilized with 1% sodium hypochlorite for 10 min

and then rinsed twice with sterile distilled water. The conidia were harvested from

7days-old-culture of detected fungal species on PDA plates with sterile distilled

water. Conidial concentration in suspension was adjusted to 10 4 conidia/ml. The

disinfected seed units were immersed in suspension for 30 min and then spread on

tissue paper. The seed were air dried at room temperature. Plates incubated with

surface-sterilized seeds without an added test fungus served as control.

 24

The Top of Paper and Blotter methods as described above were used for germination

of the seed caryopses and fungal on spikelets, respectively. Germinated seeds were

retained for the full 14 days in the container with their coleoptiles unclipped to

evaluate infection levels on germinated seeds, as evidenced by the appearance of

pathogen stromata. The stereo microscope was used to examine presence of fungi on

all separated seed parts after seven days of incubation. Data on percentage

germination of normal, abnormal seedlings, hard seeds, dead seeds and fungal

infection load were recorded on both caryopses and spikelets.

Data collected were subjected to general linear modal (GLM) and Least Means of

observed parameters and Least Significance Difference (LSD) determined by using

SAS (2004) Statistical Package and P values ≤ 0.05 were considered statistically

significant.

3.12 Pathogenicity of Fungal and Bacterial Isolates on Buffelgrass Seedlings

Pathogenicity test was done to determine whether or not a suspected pathogen would

cause disease symptoms in the host from which it was isolated. This test was done to

confirm the initial presumptive diagnosis (Lelliot and Stead, 1987).

3.12.1 Pathogenicity of fungal strains

The buffelgrass plants used in this experiment were grown from NLRI Mpwapwa

seeds on sterilized soil in pots of 20 cm x 18.5 cm. Surface sterilized (1 % NaOHCl)

seeds were sown according to the procedure described by Campbell and Medd
 25

(2003). Five seeds per pot were used. Plants were thinned to four plants per pot 21

days after germination. All pots were placed on a greenhouse bench at 15 to 25°C

Watered and fertilized as required.

3.12.1.1 Inoculum preparation

A small mycelial plug from a stock culture was aseptically transferred to fresh

modified V8 agar (200 mL of V8 juice, 800 mL water and 14 g agar) (Dingha and

Sinclair, 1995). The plates were incubated for 10 days under 25 °C, 12 h/12 h

light/darkness, where adequate colony growth was observed. For each fungal isolate,

10-day-old culture on NA was added to 10 mL SDW and spores scrapped off using a

bent glass-rod. The resulting conidia suspensions were filtered using cheese cloth to

remove NA and spore suspension adjusted to desired concentration 1 x10 8cfu/mL by

using Haemocytometer.

Seedlings at four leaf growth stage in four replicates of 4 seedlings/pot were sprayed-

inoculated with the suspension till run off using a 1000 ml gun sprayer. Inoculated

plants were then covered with polyethylene sheets for 24 h to maintain humidity

(Jugah et al.,2007). Control plants were sprayed with SDW and maintained under the

same conditions. Disease incidences were recorded 7, 14, 21 and 28 days after

inoculation (DAI) using the methods of Kadir and Charudattan (2000).

Disease assessment was based on the number of plants affected among the total

inoculated (disease incidence), expressed as the percentage of diseased plants and

plant reaction to disease based on disease severity (area of plant tissue that is
 26

diseased) (Jugah et al., 2007). Disease progress was assessed on the inoculated plants

in each pot by estimating the disease development on 4 lower leaves. The disease

development was expressed as disease incidence using procedure developed by

Kleczewski and Flory (2010) of disease rating where: 0 = no disease, 1 = 1to 5 % of

leaf surface area with lesions; 2 = 6 to 10 %; 3 = 11 to 25 %; 4 = 26 to 50 % and 5 =

> 50 %. Disease severity was quantified by assigning a rating to each leaf of every

plant. Then to provide a single disease severity measurement for each plant, the

converted mean rating was arranged for all 4 leaves from each plant. In order to

calculate means and variance for these nonparametric data, rating values were

converted for each leaf to the midpoint of the percent leaf area with lesions (e.g.

rating 2 = 8 %).

Data on diseased plants collected were subjected to General Linear Modal (GLM)

and Least Significance Difference (LSD) determined by using Statistical Package at

P ≤ 0.05 (SAS, 2004).

Four leaves from each treatment were sampled at 28 DAI in order to determine the

germination of conidia in blotter test as in the previous experiment. The symptomatic

leaf tissue was surface sterilized in 0.1 % NaOCl for one minute then rinsed three

times in sterile distilled water (SDW), blotted dry with sterilized paper and ten pieces

(5 per petri dish) were plated out on three layer of moisten filter papers then

incubated for 7 days under 25 °C, 12 h/12 h light/darkness, where adequate colony

growth was observed. Detection and identification was carried out to confirm Koch’s

postulates.
 27

The experiment was performed once using a completely randomized design with four

replications. All data were subjected to the standard SAS (2004) procedure. Least

Significance Difference (LSD) was done if treatments showed significant

differences.

3.12.2 Pathogenicity tests for bacterial strains

Strains were revived from beads streaked on NA in a laminar air flow cabinet. The

petri dishes were incubated at 28.5 °C for two days; all bacterial strains were revived

using the same method. Bacterial suspension was prepared on fresh inoculum, where

a 48 h loopful of bacteria culture was added in 10 ml of SDW, and then thoroughly

vortexed. More SDW was added to make 100 mL of suspension. Plants were

subjected to pathogenicity test using the clip and foliar spray inoculation methods. In

clip method, a pair of sterilized scissors was dipped in the bacterial inoculum (107-

108 cfu/ml). Leaves of all four plants in a pot were grasped in one hand and the top 5-

6 cm of four leaves were clipped off simultaneously. In folia spray inoculation

method, bacterial inoculum (107-108 cfu/ml) was sprayed using hand atomizer

sprayer onto the leaf surface of buffelgrass seedlings. Control plant leaves were

sprayed and clipped off using sterilized distilled water for both methods. The

inoculated seedlings were covered in polyethylene bags for 48 h and incubated for 7

days in the screenhouse. Seven days after inoculation, the plants were observed daily

for appearance of disease symptoms and the final data were recorded after 28 days of

inoculation. Percent disease incidence was calculated using the procedures of

Gnanamanickam et al., (1999). Lesion lengths were measured at 7, 14, 21 and 28

days after inoculation.

 28

lesion length
Disease incidence (% ) = x 100 …………………………....(iii)
Total length

3.12.3 Re-isolation of bacteria from infected buffelgrass leaves

The leaves of buffelgrass inoculated by clip method showing the symptoms of

bacterial infection were used for isolation of the bacteria for confirmation. The

infected clipped leaves were cut using a pair of scissors from the plants in the

screenhouse and taken into the laboratory. These were then washed with sterilized

distilled water 2-3 times. Isolation of the bacteria was done using direct plating of

infected leaves on NA medium. Plates were incubated at 28 °C and monitored

between 48 to 72 h for appearance of bacterial colonies. For the other buffelgrass

seedlings inoculated by spraying method showing the visual disease symptoms, the

same procedure was followed.The colonies that grew on the media were purified and

grown on NA (yellow) and KB (cream or white) media then incubated for 24 h at 28

°C. Colonies that appeared were examined if were similar to the bacterial isolates

used for inoculation.

3.13 Buffelgrass Seed Cost and Seeding Rate in Relation to Seed Quality from

Selected Pasture Seed Farms in Tanzania.

Recorded results from germination and purity were used to calculate the actual seed rate

and compare it with the ISTA (2005) recommended seed rate (9 kg/ha). The selling price

per kilogram weight from each seed sample from each farm was calculated and

compared with their respective germination and purity percentage. The most economical

seed sample with minimum seed rate, high pure live seed and germination percentage

were determined and new seed cost per kg proposed according to data obtained.
 29

CHAPTER FOUR

4.0 RESULTS AND DISCUSSION

4.1 Seed Health Testing

4.1.1 Seedborne fungi detected in buffelgrass seed samples

Using the Blotter Method for fungal detection, results (of seed health testing) showed

that buffelgrass seed samples were contaminated by different fungi (Table 2 ). The

pathogenic fungi with their incidence were Phoma spp (28.5 %), Curvularia lunata

(Plate 1A) (17.34 %), Alternaria alternata (Plate 1B) (14.09 %), Bipolaris spp. (Plate

1C) (12.2 %) Fusarium pallidoroseum (8.4 %) and Exserohilum rostratum (7.3 %).

Others included Nigrospora oryzae (Plate 1D) (1.08 %), F. moniliforme (2.2 %), F.

spp. (4.1 %) and Pyricularia grisea (4.9%) (Table 2 and Fig. 2). Presence of fungi in

buffelgrass seeds from different pasture farms imply that the health quality of the

produced seeds was poor and that these disease causing pathogens may be

disseminated with seeds and cause diseases in other fields (Mukhtar, 2009). Ocamb

and Alderman (2004) confirmed Fusarium spp associated with tall fascue grass to

decrease seed germination. The use of pathogen free seeds minimises the

possibilities of dispersing the pathogens with the seeds (Safdar et al., 2009).

The pathogens detected from buffelgrass seeds used in this study have been found in

association with different cereal seeds (Fukhrunnisa et al., 2006; Niaz and Dawar,

2009). Manyangarirwa et al. (2009) reported F. pallidoroseum, F. moniliforme, and

Phoma sp. to be seed transmitted causing direct damage to the seeds through toxins

or physical invasion or indirect seed damage through heating due to respiration of the
 30

fungi. Agarwal and Sinclair, 1997; Thomsen and Schmidt, 1999; Amadi and

Adeniyi, 2009 reported similar results.

Plate 1: Conidia of fungi detected on buffelgrass seeds collected from selected

pasture seed farms in Tanzania

A = Curvularia lunata, B = Alternaria alternata, C = Bipolaris spp and D =

Nigrospora oryzae (x 40)

31
 32

Table 2: Incidence of fungal microorganisms in buffelgrass seeds collected from pasture seed farms in Tanzania

Fungal Incidence a (%) by

Seed Farm
Aa Bs Ph Pg Cl Fp Ex Fs Fm No
LITI Tengeru 4.5 2.0 6.5 0.5 6.5 8.0 0.5 0.0 0.0 1.5
LRC Mabuki 4.5 2.0 4.0 0.0 2.0 4.0 4.0 1.0 0.0 0.0
Mazimbu 1.0 0.5 0.5 0 4.0 0.0 0.5 0.0 2.0 0.5
NLRI Mpwapwa 6.5 11 35 1.5 15 2.0 5.0 1.5 0.0 0.0
LRC Tanga 0.5 1.0 1.0 0.0 1.0 1.5 0.0 4.0 2.0 0.0
Vikuge 9.0 5.5 5.5 7.0 3.5 0.0 13.5 1.0 0.0 0.0
Total 26.0 22.5 52.5 9.0 32.0 15.5 8.4 7.5 4.07 2.0 = 184.5c
Fungib (%) 14.09 12.2 28.46 4.88 17.34 8.4 7.32 4.07 2.17 1.08
a
= percent incidence based on 400 seeds tested using the standard Blotter method, b = fungi (%) = sum of individual species /overall
total (c) Aa = Alternaria alternata, Bs= Bipolaris spp., Ph= Phoma spp., Pg = Pyricularia grisea, Cl= Curvularia lunata, F.p =
Fusarium pallidoroseum, Ex= Exserohilum rostratum, Fs = Fusarium spp., Fm = F. moniliforme, No = Nigrospora oryzae
 33

Figure 2: Incidence (percentage) of fungi detected in the buffelgrass seed

sample collected from selected pasture farms in Tanzania

4.1.2 Relative percentage of fungi in pasture seed farms

The results also showed that, seed infection levels were the highest in buffelgrass

seeds collected from NLRI Mpwapwa (77.5 %), followed by Vikuge pasture farm (35

%), LITI Tengeru (30 %), LRC Mabuki (21.5 %) and LRC Tanga (11 %). Seeds from

Mazimbu (SUA) had the lowest seed infection (9.5 %) (Fig. 3). These results

indicated that, customers purchasing buffelgrass seeds from NLRI Mpwapwa get

seeds with a large number of seedborne fungi compared to the customers purchasing

seed from Mazimbu farm and vice versa. In addition, weather conditions at Mpwapwa
 34

favour fungal growth and seed infection and may not be conducive for pasture seed

production.

Figure 3: Fungal infection levels (percentage) in pasture farms surveyed in

this study in Tanzania

Other fungal species detected in pasture seed during the study included

Actinomycetes, Asperigillus, Cladosporium, Epiccocum, Penicillium and Rhizopus

(Table 3). These saprophytic fungi are known to produce toxic substances that affect

the quality of seeds (Adam, 1977; Amadi and Adeniyi, 2009).

 35

Table 3: Other micro-organisms detected from pasture seed samples used in

this study

Farm Micro-organisms detected

NLRI Mpwapwa Actinomycetes spp . Asperigilus spp Rhizopus
spp.
Mazimbu Actinomycetes spp Asperigilus flavus
Cladosporium spp. Epicoccum spp .Penicillium
spp. Rhizopus spp.,
LRC Mabuki Asperigilus spp. Bacterial ooze Penicillium spp.,
Rhizopus spp.* Smuts *
Vikuge Aspergillus spp., Smut, Rhizopus spp. and
Penicellium spp.
LITI Tengeru Aspergillus spp., Bacterial ooze Rhizopus spp.*
LRC Tanga Bacterial ooze
* Prevalent (>65%), LITI = Livestock Training Institute, LRC= Livestock Research Centre
and NLRI= National Livestock Research Institute.

4.1.3 Incidence of fungal and bacterial diseases under field conditions

The results of field survey in three pasture farms which were found to have un-

harvested grasses indicated presence of mixed infection of fungal and bacterial

diseases. The incidence of buffelgrass leaf spot disease was more than 50 %. The

fields had mixed infection (leaf spot, blights and streaks) (Plates 2 and 3). Cooper

(2006) mentioned Xanthomonas and Pseudomonas genera to be responsible for nearly

all of bacterial leaf spot. For example, through visual observation at Mpwapwa,

Vikuge and Mazimbu farm, buffelgrass fields when visited during April, May and

July were found with mixed bacterial and fungal leaf spot infection (>65 %) (Plates 2

and 3) (Mlay, J. Personal visit, 2012).

 36

A
B

Plate 2: Buffelgrass leaf infections as assessed from National Livestock

Research Institute Mpwapwa and Mazimbu pasture farms in Tanzania

A = chocolate Leaf blight/spot from NLRI Mpwapwa and B= leaf streak/spot, mixed
leaf infection from Mazimbu farm (SUA).

Plate 3: Mixed bacterial and fungal buffelgrass leaf infection (A and B) from

field samples collected from Vikuge and Livestock Research Centre

Mabuki pasture farms, respectively

4.2. Bacterial Species Detected on Buffelgrass Seeds

Using the direct plating method, 60 bacterial isolates from 6 pasture seed samples

were detected. Eight bacterial isolates were selected based on the morphological
 37

characteristics and biochemical similarities in the ability of the species to use glucose

as a carbon source, the specific oxygen requirements for growth (Christopher and

Bruno, 2003) and comparisons of species to known bacterial characteristics as

described by Mortensen (2005). Results based on biochemical and physiological tests

indicated isolates with yellow bacterial colonies (Plates 4) were preliminarily

identified as Xanthomonas oryzae pv. oryzae and X. oryzae pv oryzicola, and the

cream bacterial colonies (Plate 5) as Pseudomonas glumae and Acidovorax avenae

(Table 4).

The results imply that buffelgrass had mixed infection. The Xanthomonas spp. have a

wide range of host including monocotyledons and dicotyledonous (Ndomba, 2009).

Yellow and cream 24 h-old-colonies of bacteria (Plate 4 and 5) were grown on NA

and KB, respectively. Yellow bacterial colonies were circular and viscid. They were

negative for Gram reaction test, Kovac’s Oxidase (except one was variable) and

nitrate reduction tests. The potato soft rot tests also gave negative results implying

that they were not soft rotting bacteria (Cooper, 2006). Hypersensitive reaction on

tobacco and sweet pepper was negative for all bacterial isolates (Table 4). The

bacterial isolates were also variable on starch hydrolysis, positive to gelatin

liquefaction and pathogenicity test on buffelgrass seedlings (Table 4).

The cream bacterial isolates were positive for gelatin liquefaction, nitrate reduction

and variable on starch hydrolysis test (Table 4).

 38

Table 4: Biochemical and morphological characteristics of bacterial isolates

detected from pasture seed samples used in this study

Sample colour Pot Gram Ox Arg St Nitr HR/TP Pig Gel.

S1 Yellow - - - + - - -/- - +

S2 Yellow - - + - v - -/- - +

S2c Cream - - - - - + -/- - +

S3 Cream - - - - v + -/- - +

S4 Yellow - - - + - - -/- - +

S5 Yellow - - + - v - -/- - +

S6 Yellow - - - + - - -/- - +

S6c Cream - - - - v + -/- - +

-Ve = Negative, +Ve = positive, v = variable, Pot =potato soft rot, gram = Gram reaction,
Ox= Oxidase test, Arg= Arginine dihydrolase, St= Starch hydrolysis, Nitr = Nitrate
reduction, HR= Hypersensitivity reaction, T/P = tobacco/pepper, colour= colony colour
pig= Pigment production on KB medium, Gel= Gelatin liquefaction

Plate 4: Purified yellow bacterial colonies (A) grown on Nutrient Agar medium
from National Livestock Research Institute Mpwapwa buffelgrass seeds
using the Direct plating method
 39

Plate 5: Purified cream bacteria colonies (B) on King B medium from Mabuki
buffel grass seeds tested using the Direct plating method

4.2.1 Hypersensitive reaction on tobacco and sweet pepper

Results for hypersensitivity reaction (HR) of the bacterial isolates on tobacco

(Nicotiana tabacum) and sweet pepper (Capsicum annum), indicated that none of the

bacterial isolates induced HR. Such results implied that the bacteria were not

pathogenic or presence of hrp genes. Fett and Jones (1995) reported hypersensitive

response and pathogenicity (hrp) genes to control both pathogenicity and the ability

to cause the HR. The inability of bacteria to elicit HR may be due to presence of the

hrp genes. Mutation of (hrp) genes has been reported to be the cause of failure to

induce infection by bacteria (He et al., 1993, Huang et al., 1995, Bobosha, 2003 and

Samudrala et al., 2009). Zou et al. (2006) reported these hrp genes to be involved in

induction of HR in host and non-host plants and the pathogenicity of susceptible

plants. The plant pathogenic bacteria that are mutant for hrp gene effector protein

have been found to be non pathogenic to compatible hosts (Collmer et al., 2000; Tang

et al., 2006).
 40

4.2.2 Identification of bacteria using Polymerase Chain reaction (PCR)

The results showed that, three out of eight bacterial isolates isolated from buffelgrass

seeds were amplified by XanF7/R7 primers targeting Xanthomonas and produced a

product size of 402 bp (Plate.6). Such results clearly indicated that the amplified

organisms were xanthomonads. It was not possible to differentiate different species of

xanthomonads using these primers. No amplification was observed in a sterile

distilled water control or in other bacteria isolated from buffelgrass seeds. The DNA

from other two yellow and the cream pigmented bacterial isolates were not amplified

implying that they were not xanthomonads. These results concur with the study by

Sakthivel et al., (2001) when genomic DNA of X. o. pv oryzae was used as a template

(Table 5). Seeds of many plant species are reported to contain compounds that inhibit

PCR and can lead to amplification failure (Ha et al., 2009). Presence of inhibitors

may interfere with the cell lysis or capture components necessary for DNA extraction

(Clarissa et al., 2010). The failure of DNA from the yellow colonies thought to be

xanthomonads in the biochemical test might have also been due to presence of PCR

inhibitors in plants.

Low time priming during the amplification of DNA is reported to cause locations of

potential base mismatches or overlapping bands in PCR (Roux, 1995). The causes of

band overlapping in lane 4 and 5 (Plate 6) might have been due to failure of PCR to

amplify under optimum conditions, leading to generation of multiple undefined and

unwanted products, even to the exclusion of the desired products.

 41

402 bp

Plate 6: Gel electrophoresis products as amplified by the XanF7/R7 primer pair

of bacteria isolated from buffelgrass seeds collected selected pasture
farms in Tanzania

Lane M = 1kb molecular weight marker, Lane 1 = negative control and 3 = No amplification,
2, 4, 5 and 6 = showing amplification products of approximately 402 bp size of bacterial
isolates identified from collected buffelgrass seeds

Thus, from this work we conclude that Xanthomonas spp. is the primary causal

pathogen for buffelgrass leaf blight as previously described under section 4.2.

Table 5: Detection of bacteria using polymerase chain reaction (PCR) on

buffelgrass seed samples collected from selected pasture seed farms in
Tanzania

Farm Sample Identity Colony colour PCR result

NLRI Mpwapwa S1 Yellow Positive
Mazimbu S2 Yellow Weak positive
Mazimbu S2c Cream Negative
LRC Mabuki S3 Cream Negative
Vikuge S4 Yellow Positive
LITI Tengeru S5 Yellow Negative
LRC Tanga S6 Yellow Positive
LRC Tanga S6c Cream Negative
 42

LITI = Livestock Training Institute, LRC= Livestock Research Centre and NLRI= National
Livestock Research Institute.
4.2 3 Pathogenicity of fungi and bacteria isolated from buffelgrass seeds

4.2.3.1 Fungi

Results of pathogenicity tests of fungi isolated from buffelgrass seeds in the screen

house are shown in Table 6. The highest disease incidence (40 %) was observed on

plants sprayed with Bipolaris spp., and P. grisea followed by N. oryzae (37.5 %),

Phoma spp. (35 %), and F. pallidoroseum (32.5 %). The lowest disease incidence was

observed on plants sprayed with Exserohilum rostratum (27.5 %). There were no

significant differences (P≤0.05) in pathogenicity among the isolates 7 to14 days after

inoculation (DAI). Significant differences (P ≤ 0.001) between disease incidence was

observed 21 DAI on the plants sprayed with different fungal pathogens (Table 6). The

results also showed that the pathogenicity of different fungi on buffelgrass plants on

the 28 DAI was not significantly different (P≤0.05).

Sanogo and Moorman (1993) reported that low density of pathogenic fungi may lead

to low inoculum potential, hence failure of infected plants to show significant

symptoms of infection even though the pathogen may be present in their cells or

tissue. The results indicated that, the trend of disease appearance on inoculated

seedlings might have been affected by initial density of pathogenic fungi. Of the

inoculated fungi only P. grisea has been reported on buffelgrass to cause leaf spot

(Perrot and Chakraborty, 1999 and Cook, 2007). Thus this is the first report to show

that Bipolaris spp., Nigrospora oryzae, Phoma spp., Fusarium pallidoroseum and

Exserohilum rostratum are major seedborne fungi associated with buffelgrass seeds in

Tanzania.
 43

Table 6: Frequency of occurrence of fungal disease on buffelgrass seedlings at 7 to 28

days after inoculation from selected pasture farms in Tanzania

Disease incidence
g
Isolates 7DAI 14DAI 21DAI 28DAI
a a b
Bipolaris spp 10.0 10.0 22.50 40.0a
Exserohilum 10.0a 10.0a 20.0b 27.5a
F. pallidoroseum 10.0a 15.0a 27.5a 32.5a
Nigrospora oryzae 0.0a 10.0a 20.0b 37.5a
P. grisea 0.0a 10.0a 20.0b 40.0a
Phoma spp. 10.0a 15.00a 22.5b 35.0a
SDW 0.0a 0.00a 0.00c 0.00b

Mean 5.71 10.00 18.93 30.36

F test Ns Ns * Ns
LSD0.05 12.84 15.05 4.81 15.47
CV 152.75 102.35 17.29 34.66
S.E (±) 4.36 5.12 1.64 5.26
g
= Days after inoculation, Means in the same column with same letter are not significantly different
at P≤0.05. SDW = sterilized distilled water, CV = coefficient of variation, LSD = Least
Significance differences, S.E = Standard Error, Ns = not significant and * = significant

4.2.3.2 Disease severity of different fungi inoculated on buffelgrass seedlings

The results showed that, the highest disease rating (2.5) and (2.4) was recorded in

plants inoculated with Phoma and Bipolaris isolates on the 7, 21 and 28 days after

inoculation (DAI), respectively (Fig 4;). Results showed an alternating disease

progress on infected buffelgrass leaves on 7, 14 and 21 DAI. The lowest leaf spot

disease severity on 28 DAI was shown by E. rostratum. There was a gradual increase

in disease severity from 7 to 28 DAI. As the disease progressed, the area around the

discrete lesions turned yellow. Tips and edges of infected leaves turned dark green to

brown giving the leaf folded appearance.

 44

Figure 4: Disease severity rating on buffelgrass leaves 7 to 28 days after

inoculation

4.2.3.3 Frequency of occurrence of infection symptoms on different fungi

inoculated buffelgrass seedlings

The disease symptoms of fungal infection on inoculated buffelgrass seedling were as

indicated in Table 7. The highest disease symptoms (15.50 %) by fungal infection

was caused by Phoma and Bipolaris spp. followed by Pyricularia grisea and F.

pallidoroseum (13.0 %) at 28 days after inoculation (DAI).The results indicated that

there were no significant differences (P≤0.05) between plants inoculated with

different fungal isolates at 7 and 14 DAI (Table 7). There was a slow or late leaf spot

disease development at 7, 14 and 21 DAI. This might be caused by uncontrolled

changes of temperature and humidity at the screen house during the study. Brecht

(2005) reported an increased amount of leaf spotting and leaf tip necrosis of Bipolaris

hawaiiensis and Curvularia lunata on bermudagrass when inoculated at 30 and 25 °C

than at 20 °C.
 45

Table 7: Fungal disease symptoms observed on buffelgrass seedlings at 7 to 28

days after inoculation

Isolates 7 DAIk 14DAI 21DAI 28DAI

a a a
Bipolaris spp 1.50 2.25 8.00 15.50a
Exserohilum 1.50a 1.50ab 4.25bc 8.00b
F. pallidoroseum 1.50a 2.25a 3.00c 13.00ab
Nigrospora oryzae 0.00a 1.50ab 4.25bc 11.75ab
P. grisea 0.00a 1.50ab 5.50abc 13.00ab
Phoma spp. 1.50a 2.25a 6.75ab 15.50a
SDW 0.00b 0.00b 0.00d 0.00c

Mean 0.86 1.61 4.53 10.96

LSD0.05 1.92 2.21 2.89 7.31
F test Ns Ns *** **
CV 152.75 93.33 43.37 45.96
S.E (±) 0.65 0.75 0.98 2.48

Means within the column with the same letters are not significantly different at (P≤ 0.05)
based on GLM procedure, ns = not significant, ** = very significant *** = extremely
significant and k = Days after inoculation

The duration of surface wetness or high humidity in most terrestrial plants has also

been reported to determine leaf spot disease development (Luo et al., 2001;

Khazanda et al,. 2002; Magarey et al., 2005; Jugah et al., 2007; Satish et al., 2010;

Kleczewski and Flory, 2010; Harmon et al., 2011). Further studies are thus, suggested

to be done under more controlled environment. In this experiment, a single spray

application with fungal inoculum on buffelgrass seedlings did not result in plant

death. Infected plants recovered from initial damage and produced new foliage. The

summary of leaf disease symptoms produced by fungi on buffelgrass seedlings used

in the study is as shown in Table 8.

 46

Table 8: Disease symptoms observed on buffelgrass seedlings inoculated with

different fungi used in this study

Fungi Symptoms
Bipolaris spp. Leaf spot
damping off,
leaf blight, leaf spot
Phoma spp. Leaf spots, shrink, loss in germination
Fusarium pallidoroseum Leaf blight, leaf spot
Pyricularia grisea Gray leaf spot and dieback,
Exserohilum rostratum Dieback, leaf streak, leaf spot on older leaves,
Nigrospora oryzae Chocolate brown spots, brown lesion

4.2.3.4 Pathogenicity of bacterial isolates on buffelgrass seedlings

Results showed that, all bacterial isolates that were positive for biochemical,

physiological and PCR tests were pathogenic (Plate 7 and 8) on buffelgrass seedling

(Table 9). Results obtained from aggressiveness of the bacterial isolated used in this

study were all positive. These results show that there were significant differences (P≤

0.001) between lesion length produced by different bacterial isolates at 7 and 14 days

after inoculation on buffelgrass seedlings (Table 9). There were no significant

differences (P ≤ 0.05) on disease symptoms between buffelgrass seedlings inoculated

with different bacterial isolates at 21 to 28 days after inoculation. The initial

symptoms were leaf curling near the cut-off portion. Results indicated that, the

seedlings produced water soaked lesions on the clipped ends and yellow

discolouration which extended downwards (Plate 7 A and B). Such characteristics

were similar to those described by Ali et al. (2009) in rice and Bradbury (1986) in

Clitoria tenatea. The symptoms were also typical of Xanthomonas oryzae pv. oryzae

(Xoo) which cause bacterial blight of rice (Neergaard, 1977; Ali et al., 2009). Sullivan
 47

et al. (2011) reported buffelgrass to be alternative host of Xoo of rice which agrees

with the current findings.

Plate 7: Disease symptoms caused by bacterial blight isolates on buffelgrass

seedlings two weeks after inoculation using the clip method

T = blight lesions on different pot A and B

The largest disease lesion (1.28 cm) was observed on the buffelgrass plant inoculated

with the bacterial isolate S6 obtained from LRC Tanga followed by isolate S1 (1.26

cm) from NLRI Mpwapwa at 21 DAI (Table 9). Likewise at 28 DAI the longest

disease lesion (1.37 cm) was caused by bacterial isolates S 6. In addition, the control

plants which were inoculated with SDW did not show disease symptoms.

Table 9: Lesions length caused by bacterial blight isolates on buffelgrass leaves

at 7 to 28 days after inoculation using the clip method
 48

Lesion length (cm)

Sample no. 7DAI 14DAI 21DAI 28DAI Sample source
g
S5 0.59 c
0.87b
0.99 a
1.34a
LITI Tengeru
a a a a
S6 1.18 1.26 1.28 1.37 LRC Tanga
S2 0.68c 0.93b 1.16ab 1.34a Mazimbu
b a a a
S1 0.97 1.14 1.26 1.35 NLRI-Mpwapwa
c b ab a
S4 0.6 0.99 1.12 1.21 Vikuge
Mean 0.80 1.04 1.16 1.32
F test *** *** Ns Ns
LSD0.05 0.18 0.14 0.25 0.32
CV 12.49 7.61 12.23 13.29
S.E (±) 0.06 0.04 0.08 0.1

Means within the column with the same letters are not significantly different at (P≤ 0.05)
based on GLM procedure, ns = not significant, *** = extremely significant, +ve = positive
g
aggressiveness, = Bacterial isolate; S 1, = isolate from Mpwapwa, S 2, = isolate from
Mazimbu, S4 = isolate from Vikuge S5 = isolates from LITI Tengeru and S 6 = isolates from
LRC Tanga.

Bacterial blight on rice is favoured by warm temperatures (25 to 32ºC), high humidity

(60 %), rain and deep water for at least two weeks (Saettler, 1989; Sullivan et al.,

2011). In this study, disease symptoms (Plate 8) were observed 14 DAI. This slow

infection due to Xanthomonas spp. was also reported by Akhtar and Bhutta (2002) on

paddy, wheat and cotton in Pakistan and was caused by fluctuating weather

conditions. Pathogenicity results of isolates (S2c, S3c and S6c) on buffelgrass seedling

are shown on Table10. The longest leaf lesion length (13.23 cm), was caused by S 3c

isolate followed by S6C (12.13cm) and S2c (7.99cm). There were no significant

differences on buffelgrass (P≤0.05) disease symptoms between seedlings inoculated

at 7, 14, and 21 DAI (Table 10).

C
 49

Plate 8: Disease symptoms caused by bacterial streak isolates using Spray

method on buffelgrass leaves two weeks after inoculation

C = streak lesions

However, isolates (S3c) from LRC Mabuki and (S6c) from LRC Tanga were

significantly different (P≤0.05) from those obtained from Mazimbu 28 DAI. The

inoculated leaves indicated distinct, brown lesion with prominent haloes 28 DAI.

Plants inoculated with sterile distilled water (negative control) did not develop any

disease symptom.

The bacterial strains S2c and S6c caused small, water soaked and translucent to light

yellow brown banded lesions running along the leaf veins. The lesions then developed

to brown /chlorotic halo. The symptoms were similar to those caused by A. avenae

reported on millet and rice by Nelson (2009). Acidovorax avenae is also reported to

infect buffelgrass plants (Song et al., 2004).

Table 10: Disease lesions caused by bacterial streak isolates on buffelgrass

seedlings 7 to 28 days after inoculation using spray method

 50

Lesion length (cm)

Sample no. 7DAI 14DAI 21DAI 28DAI Sample source.
S3 2.08a 3.47a 11.38a 13.23a LRC Mabuki
S6c 1.79a 3.12 a
9.49ab 12.13a LRC Tanga
S2c 1.70a 2.65 a
5.84b 7.99b Mazimbu
Mean 1.86 3.08 8.92 11.12
F test Ns Ns Ns *
LSD0.05 1.10 1.50 4.86 1.98
CV 29.72 24.38 27.28 13.45
S.E (±) 0.32 0.43 1.4 0.86

Means followed by the same letter within a column are not significantly different (P≤ 0.05) according
to LSD test. Ns = not significant, * = significant, 2c = isolates from Mazimbu, S 3c= isolates from LRC
Mabuki and 6c = isolates from LRC Tanga.

These bacterial isolates S2c (from Mazimbu) and S6c (from Tanga) might have been A.

avenae as were previously confirmed by the preliminary biochemical tests. The

symptoms caused by bacterial isolate S3 (which preliminarily characterized as

Pseudomonas) on buffel grass were difficult to differentiate with those caused by A.

avenae. Song et al. (2004) reported failure of the two pathogens to produce distinct

symptoms under field condition. Shakya et al. (1995) reported of plants surviving

infection in the seedling stage to harbour the bacterium without showing symptoms as

the Acidovorax avenae is reported to be located between the glumes and pericarp or

deeper in seed.

4.2.3.5 Detection of bacteria from infected buffelgrass leaves

To confirm that bacterial symptoms which developed on the inoculated buffelgrass

plants were due to bacterial strain inoculated, infected leaves were plated as

previously described. The results of purified colonies had similar characteristics as

those of bacterial strains inoculated (Table 11). The strains were negative to Gram

reaction, Oxidase and potato soft rot tests and were pathogenic on buffel grass

seedlings. Based on these results, Pseudomonas glumae and A. avenae were

 51

confirmed to be causal agents of leaf spot. Pseudomonas spp. has also been reported

to be the causal agent of necrotic spot on various organs of plant species including

cowpea (Bradbury, 1986). Acidovorax avenae is also reported to cause brown streaks

on leaves of rice and pathogenic to a wide host range such as barley, maize and millet

(Kadota, 1996; Yuan, 2004).

Table 11: Characteristics of re-isolated bacteria from inoculated buffelgrass

plants

Isolate Initial Re- Final Gram/ Arg. Nitr. Gel. St. Initial
identity colony isolation colony Oxidase Test Test test test isolate
colour (DAI) colour test
S1k Yellow 21 Yellow -ve/-ve +ve -ve +ve +ve Present
S4 Yellow 21 Yellow -ve/-ve +ve -ve +ve -ve Present
S6 Yellow 21 Yellow -ve/-ve +ve -ve +ve -ve Present
S2 Yellow 21 Yellow -ve/+ve -ve -ve +ve V Present
S5 Yellow 21 Yellow -ve/-ve -ve -ve +ve V Present
S3 Cream 21 Cream -ve/-ve -ve +ve +ve V Present
S6c Cream 21 Cream -ve/-ve -ve +ve +ve V Present
S2c Cream 21 Cream -ve/-ve -ve +ve +ve -ve Present

-ve = negative, +ve = positive, v= variable, Arg= Arginine dihydrolase, St= Starch hydrolysis,
Nitr = Nitrate reduction,DAI =days after inoculation, k= bacterial isolates; S1, = isolate from
Mpwapwa, S2 and 2c, = isolate from Mazimbu, S4 = isolate from Vikuge S5 = isolates from
LITI Tengeru and S6 and 6c = isolates from LRC Tanga, S3= isolates from LRC Mabuki.

4.2.3.6 Re-isolation of fungi from buffelgrass infected leaves

The results for the recovery of fungi on buffelgrass plants previously inoculated with

the fungal pathogens are shown in Table 12. The blotter method was used for fungal

re-isolation from symptomatic leaves. Using the compound microscope and procedure

developed by Mathur and Kongsdal (2003), the results confirmed the presence of

Bipolaris spp., Phoma spp., Fusarium pallidoroseum, Exserohilum rostratum,

Pyricularia grisea and Nigrospora oryzae.

 52

Table 12: Fungal microorganisms re-isolated from inoculated buffelgrass plants

following pathogenicity tests

Isolate Name of Re-isolation Final re- Referral Initial

identity inoculated (DAI) isolates template isolate
fungi conidia
F1g Bipolaris spp. 28 Bipolaris spp. Mathur and Present
conidia Kongsdal,(2003)
F2 Phoma 28 Phoma Mathur and Present
Kongsdal,(2003)
F3 Pyricularia 28 Pyricularia Mathur and Present
grisea grisea Kongsdal,(2003)
F4 Fusarium 28 Fusarium Mathur and Present
pallidoroseu pallidoroseum Kongsdal,(2003)
m conidia
F5 Exserohilum 28 Exserohilum Mathur and Present
rostratum rostratum Kongsdal,(2003)
conidia
F6 Nigrospora 28 Nigrospora Mathur and Present
oryzae oryzae conidia Kongsdal,(2003)
g
= isolate identity, DAI = days after inoculation

4.3 Effect of Fungal Infection on Seed Germination

4.3.1 Germination percent of buffelgrass seeds

Results for germination test conducted using the Top of Paper method indicated that

the number of normal buffelgrass seedling was significantly different (P≤ 0.001)

between the seed farm samples tested (Table 13). Buffelgrass seed samples collected

from Vikuge pasture farm had the highest number of normal seedlings (36 %)

followed by seed samples from Mazimbu pasture farm (27 %), LRC Mabuki (24.5 %)

and NLRI Mpwapwa (10.5 %) (Table13). Buffelgrass seed samples collected from

LRC Tanga did not germinate.

Table 13: Percentage germination of buffelgrass seeds collected from selected

pasture seed farms in Tanzania

 53

Farm Germinationf (%)

Normal Abnormal Hard seeds Dead Seed
Seedlings Seedlings
NLRI Mpwapwa 10.5b 1.50b 17.50ab 70.50b
Mazimbu (SUA) 27.0a 1.5b 3.50c 68.00b
LRC Mabuki 24.5a 2.5ab 19.50a 53.50c
Vikuge 36.0a 5.5a 13.50ab 45.0c
LITI Tengeru 8.0b 2.5ab 20.5a 69.0b
LRC Tanga 0.0b 0.0b 10.25bc 89.75a
Mean 17.67 2.25 14.12 65.96
LSD0.05 12.14 3.11 7.52 13.90
F test *** * ** ***
CV %) 46.25 93.11 35.86 14.19
S.E (±) 4.09 1.05 2.53 4.68

Within a column means with the same letters are not significantly different at P≤ 0.05 based on Least
Significant Difference (LSD), f = Represents percentage from 400 seeds used in germination test. * =
significant, ** = very significant and *** = extremely significant. LRC = Livestock Research Centre,
LITI = Livestock Training Institute, NLRI = National Livestock Research Institute and SUA = Sokoine
University of Agriculture

These results show that germination was low in all pasture seed farms. Seed

dormancy may be one of the causes of such results because seed samples used in this

study were collected soon after harvest. Therefore, storage of buffelgrass seeds may

be required for breaking seed dormancy (Gobius et al., 2001). Palma-Rivero et al.

(2000) obtained a lower germination of buffelgrass seeds (17.8%) and (24.7%) after 4

and 9 months of seed storage, respectively. Yadav et al. (2001) reported slightly

higher (32.4%) buffelgrass seed germination after storing the seeds for one year

compared with Kizima et al. (2012) who reported the germination of 10 % in

buffelgrass seeds that were directly tested soon after harvest.

Seed germination of buffelgrass has been reported to improve by 70 % after storing

under dry conditions for two years (Aganga and Tshwenyane, 2003; Parihar and

Pathak, 2006; Mganga et al., 2010). The current germination results on the number of
 54

abnormal seedlings also showed that the seed samples collected from Vikuge (5.5 %)

were significantly different (P≤ 0.05) from those collected from Mazimbu and NLRI

Mpwapwa both of which had (1.5 %) of abnormal seedlings (Table 13). Mukhtar

(2009) reported the seed quality and seed germination vigour of buffelgrass seedlings

to be adversely affected by fungal infection (e.g. Alternaria spp).

The results also showed that the number of dead seed was significantly different (P ≤

0.001) between seed samples collected from different seed farms. Seeds collected

from LRC Tanga had the highest percentage of dead seeds (89.75 %), followed by

NLRI Mpwapwa (70.5 %), LITI Tengeru (69 %) and Mazimbu, SUA (68 %). Such

results implied that other factors rather than seed dormancy may contribute to poor

germination observed in this study. The most important factor which contributed to

the high number of dead seeds might be infection by seed-borne pathogens (Plate 9 &

10), which have been reported to cause seed decay and deterioration in buffelgrass

(Ndomba, 2009; Habib et al., 2011).

A
 55

Plate 9: Different fungal species (A) growing on buffelgrass seed collected from
LRC Mabuki, detected using Blotter method

Plate 10: Fungi (B) growing on buffelgrass seed collected from NLRI Mpwapwa
detected using Blotter method

The results also indicate that there were significant differences (P ≤ 0.001) between

the number of hard seeds recorded for different pasture seed farms. Pasture seed

samples from LRC Mabuki had the highest (19.5 %) number of hard seed (Table 13).

The lowest number of hard seeds (3.5 %) was recorded in pasture seed samples

collected from Mazimbu SUA farm. The results implied that a big number of pasture

seeds collected from pasture seed farms used in this study did not germinate. Low

seed viability might have been due to seed dormancy and improper storage

conditions. Freshly harvested buffelgrass seeds have been reported to have a high

level of dormancy (Cook, 2007). Germination percent has been reported to improve

when buffelgrass seed were stored 6 to 18 months after harvest (Factsheet, 2012 and

Fig. 1). This post-harvest dormancy is a typical seed behaviour which occurs also in

seeds of Hordeum spp. Triticum spp. and Festuca rubra L. (Palma-Rivero et al.,

2000). Butler (1985) found that the dormancy of Cenchrus ciliaris caryopsis is caused
 56

mainly by the presence of inhibitors in the seed wrappings (bristles, glumes, lemma

and palea). Harty et al. (1983) and Gonzalez et al. (1994) also observed a similar

behaviour in the seeds of Brachiaria and Panicum maximum.

4.3.2 Caryopsis index of buffelgrass seeds

The results of the pure seed unit (Springer and Dewald, 2001) index or caryopsis are

shown in Table 14. The buffelgrass seeds from Mazimbu SUA and LRC Mabuki had

the highest caryopsis index (50 %) followed by NLRI Mpwapwa (33.3 %), LRC

Tengeru (26.7 %) and LRC Tanga (20 %) (Table 14). The lowest caryopsis index was

recorded in seeds from Vikuge (6.7%). Such results imply that many of the spikelets

from each seed sample were empty. Parihar and Pathak (2006) reported poor seed

setting in spikelets to be susceptible to weather condition prevailing at the time of

anthesis and grain formation. The empty spikelets obtained might have resulted from

the effect of weather conditions during seed setting and microorganism infections.

Franco et al. (2007) also reported microorganism (fungal) infection to prevent

maturation of rice grains for about 50 % leading to unfilled rice spikelets.

Table 14: Caryopsis indices for buffelgrass seeds from selected pasture farms in
Tanzania

Number of Caryopses in Caryopsis index

FARM seeds seeds (%)
NLRI-Mpwapwa 30 10 33.3
Mazimbu 30 15 50.0
LRC-Mabuki 30 15 50.0
Vikuge 30 2 6.7
LITI-Tengeru 30 8 26.7
LRC-Tanga 30 6 20.0

NLR = National Livestock Research Institute, LITI = Livestock Training Institute and LRC =
Livestock Research Centre.
 57

The low caryopsis index (of not more than 50 %) obtained in this study indicated that

viability of buffelgrass seeds in the selected pasture seed farms were below 50 %.

This has a negative implication to farmers as they need to buy more seeds for sowing

to compensate for the seeds that will not germinate/unfilled thus, increasing the cost

of pasture establishment.

4.3.3 Purity of buffelgrass seed samples

The results for seed purity determined based on procedures described by ISTA (2005)

are shown in Table 15. The highest proportion of pure seed was recorded from seed

samples collected from LRC Tanga (96.7 %.), LRC Mabuki (95.1%) and NLRI-

Mpwapwa and LITI Tengeru (75.4 %). These results imply that most of the seed

purity was within the FAO (2006) minimum recommended range for quality declared

seeds of buffelgrass (90 %) except those from the two pasture farms above. The

highest percentage of inert material was in seed samples from LITI Tengeru (23 %),

followed by NLRI Mpwapwa (21 %) and Vikuge (6.6 %). Presence of high

proportion of inert material in the seed entail more cost to farmers who purchase these

seeds. Likewise, inert matter may harbour seedborne pathogens (Loch and Boyce,

2001), which may also contribute to reducing germination of buffelgrass.

Table 15: Percentage purity of buffelgrass seeds collected from selected pasture

seed farms in Tanzania

Farm Purity (%)h

Pure Seed Inert Matter Other crop
seed
NLRI Mpwapwa 75.4 21.3 1.6
Mazimbu 93.4 06.6 0
 58

LRC Mabuki 95.1 3.3 0

Vikuge 93.4 6.6 0
LITI Tengeru 75.4 23.0 0
LRC Tanga 96.7 3.3 0
Mean 88.3 10.7 Na
h
= represent percentage of 6 g of buffelgrass seeds used (ISTA, 2005), LRC = Livestock
Research Centre, LITI = Livestock Training Institute, NLRI = National Livestock Research
Institute and SUA = Sokoine University of Agriculture.

4.3.4 Moisture content of buffelgrass seed samples

Results of moisture content (MC) of buffelgrass seed samples are shown in Table 16.

Seed samples collected from LRC Mabuki had the highest MC (9.7 %) followed by

seeds from LRC Tanga (9.4 %). Seed samples from NLRI-Mpwapwa had the lowest

MC (5.1 %). A similar MC range was observed by Kizima et al. (2012) on buffelgrass

seed collected from Mazimbu (5.6 %), Vikuge (5.2 %) and LRC Tanga (5.0 %). Such

results indicated that, the seed samples used in this study had acceptable MC range

i.e. below 12 % (Elias et al., 2006). Chin and Hanson (1999) recommended the MC

of as low as 5% or below (8%) to be important for viability of several forage species

including buffelgrass. Low moisture content increases storage time and longevity of

forage seeds regardless of age (Elias et al., 2006 and ESGPIP, 2010). Anjorin and

Mohammed (2009) reported MC of the seed, prevailing temperature, storage period

and degree of seed invasion with the pathogen as factors influencing the development

of seed-borne fungi.

Table 16: Moisture content (percentage) of buffelgrass seeds collected from

selected pasture seed farms in Tanzania

Farm Moisture Content (%)a-

NLRI Mpwapwa 5.1
Mazimbu 8.1
 59

LRC Mabuki 9.7

Vikuge 6.9
LITI Tengeru 7.6
LRC Tanga 9.4
Mean 7.8
a
= Represents percent of 10 g (ISTA, 2005) in three replicates of buffelgrass seeds used in
moisture determination, LITI = Livestock Training Institute, LRC = Livestock Research
Centre and NLRI = National Livestock Research Institute.

4.3.5 Germination of infected buffel grass seed caryopsis

Germination results of seed unit/caryopses infected with fungal pathogens detected in

this study are as shown in Table 17. The results indicated that, there were significant

differences (P≤0.05) in germination of caryopsis from Vikuge (40.75 %) and those

from NLRI Mpwapwa (12.75 %), LITI Tengeru (23.58 %), Mazimbu (31.75 %) and

LRC Mabuki (33 %). The seed units/caryopses from Vikuge pasture farm were

relatively high in seed infection; however, germination of their caryopsis was

significantly higher than those from other farms (Table 17). This indicated that poor

germination of buffelgrass seeds might be associated with fungal infection in their

seed units/caryopsis. Cram and Fraedrich (2005) and Haikal (2008) reported the

ability of pathogenic fungi to infect seeds internally and destroy the endosperm and

the embryo or contaminated the seeds and affect seedling germination and

development of plants.

The results of germination of buffelgrass caryopsis indicated that removing caryopsis

from spikelets, improves the seed germination compared to seeds with spikelets

(Tables 2 and 17). These results concur with those of Parihar and Pathar (2006) and

Gleiser et al. (2004) who reported the germination of 86 % and 92 % when caryopsis

were removed from the spikelets in buffelgrass and Brachiaria ruziziensis,

 60

respectively. The improvements in the germination of the caryopsis might have been

due to rapid absorption of moisture when planted. Such results are in conformity with

those of Loch (1993) who reported that chaffy husk in buffelgrass has a marked

influence on moisture relation around the caryopsis during germination. Olivier

(2009) also recommended the removal of switchgrass seed coat to improve their

germination. Seed with spikelets may acts as reservoir of seedborne pathogens.

Seedborne pathogen infestation can reduce sanitary quality of seeds leading to

decreased seed germination (Mbega, 2007; Dawar et al., 2007).

Table 17: Buffelgrass caryopsis germination percent from selected pasture seed

farms in Tanzania

Germination (%)
Farm Normal Abnormal
Seedlingsf seedlings Hard seed Dead seed
NLRI-Mpwapwa 12.75d 6.25 a
20.0b 61.00ab
Mazimbu 31.75b 6.25 a
13.20ad 48.75c
LRC Mabuki 33.00b 3.00b 7.25d 56.75b
Vikuge 40.75a 6.25a 11.75cd 41.25d
LITI Tengeru 23.25c 4.50ab 15.0bc 57.25b
LRC Tanga 0.00e 0.00c 34.50a 65.50a
Mean (%) 23.58 4.38 16.96 55.08
 61

F test *** *** *** ***

LSD(0.05) 7.09 1.89 6.58 6.22
CV 20.26 29.14 26.12 7.61
S.E (±) 2.39 0.62 2.2 2.1
Means within the column with same letter are not significantly different (P≤0.05), f = Based
on 400 seeds, ns = not significant, * =significant, ** = very significant and *** = highly
significant, CV= coefficient of variation, S.E = standard error, LSD = Least Significance
difference, LITI = Livestock Training Institute, LRC= Livestock Research Centre and NLRI=
National Livestock Research Institute.

Spikelets from Vikuge had the highest fungal incidence (55.3 %) followed by Mabuki

(18.4 %) and Mazimbu SUA (13.2 %) (Table 18). Thus the removal of spikelets from

caryopses reduced fungal infestation. Similar findings have been reported by Tariq et

al. (2005) in soybean seed and Rasheed et al. (2004) in groundnut seed. Beckstead et

al. (2010) also reported slow germinating or dormant seeds of Bromus tectorum due

to infection by pathogens.

4.3.6 Fungal species located on buffelgrass seed caryopsis and spikelets

The results indicate that fungal infection located on the caryopsis of buffelgrass

included Verticillium spp. which had the highest incidence (41 %) (Plate 11; Table

18). This fungal load on caryopsis was almost twice as much compared to that on the

spikelets (21.1 %) (Table 19). The results also show that caryopses of buffel grass

seeds from LITI Tengeru had the highest seed infection (37.8 %), followed by those

from Vikuge (27.5 %) and Mabuki (24 %). Other fungal species found on buffel

grass caryopsis included F. pallidoroseum (14.2 %), Curvularia lunata and

Exserohilum rostratum (13.7 %). Pyricularia grisea, Phoma spp. and the common

storage fungal seed contaminants namely Penicillium, Actinomycetes, Rhizopus and

Aspergillus were observed on spikelets. High incidence of Rhizopus was detected in

 62

seed samples collected from LRC Mabuki and this could be attributed to high

temperatures and high relative humidity which favours its sporulation and growth.

Table 18: Frequency of occurrence of associated fungi on buffel grass caryopsis

from selected pasture farms in Tanzania

Caryopsisa fungal frequency (%)

Frequency
b
Farm Aa Cl Fp Vc Ex No Total (%)
NLRI Mpwapwa 0 0 0 0 0 0 0 0.00
Mazimbu 0 0 0 0 0 0 0 0.00
LRC Mabuki 0 0 0 56 0 0 56 24.03
Vikuge 0 16 0 24 24 0 64 27.47
LITI Tengeru 16 0 24 16 8 24 88 37.77
LRC Tanga 0 16 9 0 0 0 25 10.73
Total 16 32 33 96 32 24 233

Frequency (%) 6.9 13.7 14.2 41.2 13.7 10.3

a b
= 400 hundred seeds per sample were tested using blotter method. Aa = Alternaria
alternata, Cl =Curvularia lunata, Fp= Fusarium pallidoroseum, Vc = Verticillium sp, Ex
=Exserohilum rostratum, No = Nigrospora oryzae, NLR = National Livestock Research
Institute, LITI = Livestock Training Institute, LRC = Livestock Research Centre

Table 19: Frequency of fungal microorganisms on buffel grass seed spikelets

from selected pasture farms in Tanzania

Fungal frequency (%) on spikelet

% Total
Farm Aa Ph Cl Vc Pg Ex Total Frequency
NLRI Mpwapwa 0 16 8 0 0 0 24 7.89
Mazimbu 16 16 8 0 0 0 40 13.16
LRC Mabuki 0 0 0 56 0 0 56 18.42
Vikuge 0 16 56 8 84 4 168 55.26
LITI Tengeru 8 0 0 0 0 8 16 5.26
LRC Tanga 0 0 0 0 0 0 0 0.00
 63

Total 24 48 72 64 84 12 304b
Frequency (%) 7.9 15.8 23.7 21.1 27.6 3.9

Aa = Alternaria alternata, Cl =Curvularia lunata, Fp= Fusarium pallidoroseum, Vc =

Verticillium sp, Ex =Exserohilum rostratum, Ph = Phoma sp, Pg= Pyricularia grisea and No
=Nigrospora oryzae. Fungal (%) = sum of individual fungal spp/b. NLR = National Livestock
Research Institute, LITI = Livestock Training Institute, LRC = Livestock Research Centre

Plate 11: Fungal species detected on buffelgrass caryopsis from Livestock

Research Centre Mabuki using Blotter method

A =Verticillium spp., B = Bipolaris spp. mycelia on buffel grass caryopsis

4.4 Buffelgrass Seed Cost and Seeding Rate in Relation to Seed Quality from

Selected Pasture Seed Farms in Tanzania

The results of pure seeds (75.4 to 96.7 %) and normal germination of between 8 to 36

% (as previously reported in Table 13) were used to determine the new seed cost and

seeding rate (Table 20). Results of pure live seed (PLS) as described by Houck (2009)

and Bosworth, (2012) were calculated in order to determine actual seed rate after poor

seed germination on buffel grass were obtained in the present study. The results show

that the highest seeding rate for buffelgrass adjusted based on quality was on seeds
 64

from LITI Tengeru (149 kg/ha), followed by NLRI Mpwapwa (108 kg/ha), LRC

Mabuki (38 kg/ha), Mazimbu (SUA) (35.7 kg/ha) and Vikuge farm (26.8 kg/ha)

(Table 20). Table 20 shows that, as the PLS value declines the seed rate increases

markedly.

Such results implied that adjusted seed rates of buffel grass were to be determined for

each farm instead of the previous 9 kg/ha recommended by ISTA (2005). Based on

the adjusted seed rates under this study and the former cost per ha (Tsh. 90 000.00

and 135 000.00), the actual cost of buffel grass seeds per kilogram were to be re-

adjusted. The results showed the highest cost per kilogram (Tsh./kg) to be in pasture

seeds from Vikuge (Tsh. 3 361.97), followed by Mazimbu SUA (Tsh. 2 521.70), LRC

Mabuki (Tsh. 2 329.80) and NLRI Mpwapwa (Tsh.829.00) (Table 20). LITI Tengeru

seeds were to be sold at Tsh.603.00 per kilogram based on the adjusted seed rate

instead of Tsh. 10 000.00 per kilogram. The increment in the seed rates also affected

the cost of seeds, from which livestock keepers would not afford to purchase and

establish their pasture farms if previous price were to remain. However, CRC (2001)

recommended increment in the sowing rates to compensate for the low seed quality.

The increase in seed rate in this study might have been contributed by microorganism

contamination, harvest of immature seeds (some empty florets), inert matter

inclusions (Table 13), improper seed handling and storage conditions. Therefore the

required seed rates for each farm would be an alternative choice before solutions to

these factors are obtained. This suggest the need for further investigation on seed

quality attributes to be carried in order to increase the percent of PLS available in

pasture seed farms and so as to attract many stakeholders who would wish to invest

in pasture production.
 65

Table 20: Buffelgrass seed cost and seeding rate in relation to seed quality
values from selected pasture farms in Tanzania.

Species NLRI Vikuge Mazimbu LRC LRC LITI

Buffelgrass Mpwapwa Farm (SUA) Mabuki Tanga Tengeru
Price (Bulk)/ kg 10 000 15 000 10 000 10 000 10 000 10 000
Seed rate (kg/ha)a 9 9 9 9 9 9
Cost/ha (Tsh.) 90 000 135 000 90 000 90 000 90 000 90 000
% Purity 0.754 0.934 0.934 0.951 0.967 0.754
% Germination 0.11 0.36 0.27 0.245 0 0.08
PLS 0.0829 0.3362 0.2522 0.233 0 0.0603
Re-calculated Seed
108.56 26.77 35.69 38.63 na 149.25
rate (kg/ha)
Re-calculated
829.03 3 361.97 2 521.70 2 329.80 na 603.00
price/kg
PLS= Pure live seed, PLS = %germination*%purity, New Seed rate = recommended rate/total
PLS.a = based on ISTA, (2005), na = not available, Tsh. = Tanzanian shilling, and New seed
price/kg = (cost/ha)/new seed rate
 66

CHAPTER FIVE

5.0 CONCLUSIONS AND RECOMMENDATIONS

5.1 Conclusions

The study indicates that buffelgrass seed tested were variably contaminated with the

seed-borne microorganisms. The fungal pathogens with the highest seed infection

were Curvularia lunata (18.4%), followed by Bipolaris spp. (13.8%) and Alternaria

alternata (14.8%). Other fungal species identified in the seed tested with moderate

infection included Phoma, Exserohilum, Fusarium, Pyricularia and Nigrospora

species. Also storage fungi detected in the buffelgrass seed samples used in this

study included Actinomycetes, Asperigillus, Rhizopus, Cladosporium and

Penicillium species, whilst the bacterial species belonged to the genera of

Xanthomonas, Pseudomonas and Acidovorax. There was also a highly to moderately

variability of buffelgrass seed-borne microorganism infection among different farms

studied. It is concluded that before selling buffelgrass seed for establishment; seed

health measures/procedures should first be considered so as to reduce transmission of

seed-borne microorganisms to other areas.

This study has also shown that removing of spikelets from the caryopsis showed

increased buffel grass seed germination from 36 % to 40.7 % implying that spikelets

contributed to the inhibition and reducing seed germination. The study also showed

the buffel grass seed rates (or actual seed rates) at different pasture farms to be low

due to seed-borne microorganism infection and high when purity and germination of

the seed were compared with their pure live seed values. In order to compensate for
 67

the factors reducing seed germination such as microorganism infection, dormancy

and empty seeds, a new seed rate of 149.25 kg/ha was considered to be the most

appropriate in buffelgrass seeds samples collected. With the view of the results

obtained in the study it is concluded that seed rate to be increase well above the

recommended rate of 9 kg/ha.

5.2 Recommendations

This study recommends;

(a) Further seed health analysis to be done on predominant seedborne

microorganisms identified for other pasture species across the country so

that disease mapping can be done and updated regularly targeting

potentially important pathogens. Seed health assays must continue so as

to improve bulk seed production and discard seeds that are suspected and

often shown to be sources of inoculum for disease epidemics. More

experiments need to be conducted on the on effective control measures of

seedborne microorganisms to reduce the incidence of the buffelgrass

diseases.

(b) Measures to be taken in all pasture seed farms to ensure that good

cultural practises are adhered to in order to minimize the incidence of

pathogens, and ensure that clean and healthy pasture seeds are produced.

This will contribute to reducing the level effect of microorganisms in

buffelgrass seed and their effect on seed germination.

 68

(c) Proper processing of seed before storage to remove inert materials

that will lead to higher seed quality and more uniform seed delivery

during sowing, as well as compensatory effect of lowering seeding rates

and costs per hectare should be arrange and emphasised in existing price-

sensitive markets of buffelgrass in the country.

(d) Establishment of pathogen inoculum thresholds and development of

standardized assays that will allow seed produced in the country to be

monitored for some minimum level of health quality.

 69

REFERENCES

Adams, J. M. (1977). A review of the literature concerning losses in stored Cereals

and pulses. Tropical Science 19(1): 1-27.

Aganga, A. A. and Tshwenyane, S. (2003). A review of the potential of buffel grass

(Cenchrus ciliaris) and napier grass (Pennisetum purpureum) for livestock

feeding in Botswana. Uniswa Journal of Agric.Vol. 12: 15-23.

Agarwal, V. K. and Sinclair, J. B. (1997). Principles of Seed Pathology. Lewis

Publishers. ISBN 0-87371-670-1.

Akhtar, M. A. and Bhutta, M. R. (2002). Detection of Bacterial pathogens in seeds of

Wheat, Paddy and Cotton in Pakistan. Pakistan Journal of Agric. Res. Vol. 17

(3): 273-281.

Ali, A., Khan, M. H., Bano, R., Rashid, H., Raja, N. I. and Chaudhry, Z. (2009).

Screening of Pakistani Rice (Oryzae Sativa) Cultivars against Xanthomonas

oryzae pv. oryzae Pakistan Journal. Botany., 41(5): 2595-2604.

Amadi, J. E. and Adeniyi, D. O. (2009). Mycotoxin production by fungi isolated

from stored grains. African Journal of Biotechnology, 8 (7): 1219-1221.

 70

Aneja, K. R. (1996). Experiments in Microbiology, Plant pathology, Tissue Culture

and mushroom cultivation. 2nd edn, New Age International (P) Limited

NewDelhi. pp130-132.

Anjorin, S. T. and Mohammed, M. (2009). Effects of seed-borne fungi on

germination and seedling growth of water melon (Citrullus lanatus). Journal

of Agric. Soc. Sci., 5: 77–80.

Batra, S. and Kumar, S. (2003). Agrobacterium-mediated transientGUS gene

expression in buffelgrass (Cenchrus ciliaris L.). Jouranal of Applied

Genetics 44(4), pp. 449-458.

Beckstead, J., Meyer, S. E., Connolly, B. M., Huck, M. B. and Street, L. E. (2010).

Cheatgrass facilitates spillover of a seed bank pathogen onto native grass

species. Journal of Ecology 98: 168–177.

Beckstead, J., Meyer, S. E., Smith, C. and Molder, C. (2007). A race for survival: can

Bromus tectorum seeds escape Pyrenophora semeniperda-caused mortality

by germinating quickly? Annuals of Botany 99:907-914.

Bishaw, Z. (Eds) (2003). Seed information. The official Newsletter of the West Asia

and North Africa seed Network No. 24. pp1.

 71

Bobosha, K. (2003). Characterization of Xanthomonas campestris pv. musacearum

Isolates: Causal agent of Enset Bacteria Wilt Disease. Dissertation on award

of MSc.degree at Addis Ababa University, Ethiopia.

Bosworth, S. (2012). Interpreting Hay and Pasture Mixture seed tags.In; Cultivating

Healthy communities Bulletin No. 2/2012, University of Vermont Extension,

USA.

Bradbury, J. F. (1986). Guide to Plant Pathogenic Bacteria.CAB International

Mycological Institute. 332pp.

Brecht, M. O. (2005). Ecology and pathogenicity of Bipolaris spp. and Curvularia

spp.associated with decline of ultradwarf bermudagrass golf putting greens in

Florida, USA Thesis on PhD degree Award. Graduate School, University of

Florida, USA.122pp.

BSC (Buffelgrass Seed Company) (2001). About Buffel Grass In: We help America

grow, Latest Revision, April 09, (361) 993-7321.

Burton, G. W. (1993). African Grasses. In: New crops.(edited by Janick, J. and

Simon, J. E.). John Wiley and Sons. New York. pp294-298.

Butler, J. E. (1985). Germination of buffelgrass (Cenchrus ciliaris). Seed Sci. &

Technol. 13: 538-591.

 72

Cameron, A. G. (2010). Buffel grass; A pasture grass for sandy soil. Agnote No. E

28, Department of Primary Industry, Fisheries and Mines. Northern Territory

Government. 2pp.

Campbell, M. A. Medd, R.W. (2003). Leaf, floret and seed infection of wheat by

Pyrenophora semeniperda. Plant Pathology 52: 437–447.

Chin, H. F, Hanson, J. (1999). Seed storage. In: Forage Seed Production Vol. II

Tropical and Subtropical Species (edited by Loch, D.S. and Ferguson, J.).

CABI, Wallingford, UK. pp. 303-315.

Christopher, K. and Bruno, E. (2003). Identification of bacterial species. In: Tested

studies for laboratory teaching, (Edited by O'Donnell, M.A.) volume 24:103-

130.

Clarissa, T., Nhan, P., Wang, C. and Lee, S. B. (2010). Enhancement Strategies for

Overcoming PCR Inhibitors [http://www.biomatrica.com/downloads/Clarissa's-

_Promega 2010_Poster] . Cited on 09/11/12.

Collmer, A., Badel, J. L., Charkowski, J. L., Deng, A. O., Fouts, W-L., Ramos, D.E.,

Rehm, A. R., Anderson, A. H., Schneewind, D. M., Dijk K-v, O. and Alfano,

J. R. (2000). Pseudomonas syringae Hrp type III secretion system and

effector proteins, In: ‘'Virulence and Defense in Host–Pathogen Interactions:

Common Features Between Plants and Animals,'’ National Academy of

Sciences colloquium held December 9–11, 1999, at the Arnold and Mabel

Beckman Center in Irvine, CA vol. 97(6):8770 – 8777.

 73

Cook, B. G. (2007). Tropical Forages database (SoFT) - Buffel grass.

[http//www.tropicalforages.info/key/forage/media/Html/Cenchrus_ciliaris.ht

m] cited on 23/08/2012.

Cooper, J. (2006). Bacterial Plant Pathogens and Symptomology In: Pacific

Northwest Plant Disease Handbook. Schultz, T. (eds). WSU County

Extension, SJI [http://sanjuan.wsu.edu/mastergardeners/documents

/BacterialPlantPathogens_001.pdf] cited on 26/09/2012.

Cram, M. and Fraedrich, S. (2005). Seed Diseases and Seedborne Pathogens of North

America.Tree Planters' Notes, 53(2):35-44.

CRC (Co-operative Research Centre) (2001). Future Farm Industries (FFI), Sowing

rates. Tropical Perennial grasses. New South Wales, Canada. 4:1-3pp.

[http://www.futurefarmonline.com.au/LiteratureRetrieve.aspx?ID=95837] . Cited on

25/09/2012.

CRC (Co-operative Research Centre) (2008). Weed Management Guide. Buffel grass

(Cenchrus ciliaris), ISBN: 978-1-920932-74-9. [www.weedscrc.org.au] cited

on 07/01/12.

Darrasse, A., Darsonval, A., Boureau T., Marie-Noelle, B., Durand, K. and Marie-

Agnes, J. (2010). Transmission of Plant-Pathogenic Bacteria by Nonhost

Seeds without Induction of an Associated Defense Reaction at Emergence.

Applied and Environmental Microbiology, Vol.76,(20) p. 6787–6796.

 74

Dawar, S., Syed, F. and Ghaffar, A. (2007). Seed borne fungi associated with

Chickpea in Pakistan. Pakistan Journal of Botany, 39(2): 637-643.

Dickey, R. S. and Kelman, A. (1988). ‘Caratovora’ or soft rot group. In: Laboratory

guide for identification of plant pathogenic bacteria 2nd edition. (edited by

Schaad, N.W.). APS Press St. paul, Minnesota. pp81-84.

Dingha, O. D. and Sinclair, J. B. (1995). Basic Plant Pathology Methods. Lewis

Publisher, Boca Raton, Florida. 363pp.

Egamberdiyeva, D. (2005). Characterization of Pseudomonas Species Isolated from

the Rhizosphere of Plants Grown in Serozem Soil, Semi-Arid Region of

Uzbekistan. Research article. The Scientific World Journal 5:501-509.

Elias, S. G., Garay, A. E., Young, W. C., III and Chastain, T. G. (2006). Maintaining

optimum seed quality in storage - storing grass seeds in Oregon 16-18pp

[www.http//cropandsoil.oregonstate.edu/seed-ext/Pub/2006/5]. cited on

6/05/2012.

ESGPIP (Ethiopia Sheep and Goat Productivity Improvement Program) (2010).

Forage seed production and preservation techniques. Technical Bulletin, No.

35. June 2010 pp. 25.

 75

Factsheet (2012). Buffelgrass. In: Tropical forages information.

[http://www.tropicalforages.info/key/Forages/Media/Html/Cenchrus_ciliaris.

htm] cited on 20/09/2012.

Fahy, P. C. and Persley, G. J. (1983). Plant Bacterial Diseases, A Diagnostic Guide.

Academic Press, 393pp.

Fakhrunnisa, M. H. H. and Ghaffar, A. (2006). Seedborne mycoflora of wheat,

sorghum and Barley. Pak.J. Bot. 38(1) 185-192.

Fakhrunnisa, M., Hashmi, H. and Ghaffar, A. (2006). Seed-Borne Mycoflora of

Wheat, Sorghum and Barley. Pak. J. Bot., 38(1): 185-192.

FAO (Food and Agriculture Organisation of United Nations) (2006). Quality

Declared Seed. Plant Production and Protection Paper, No.185. 87-88pp.

Farooq, M. U., Saleem, R. and Razzaq, A. (2003). Estimation of root and shoot

biomass of Cenchrus ciliaris (Dahman) under Barani conditions. Pakistan

Journal of Biological Science 6: 1808–1813.

Fett, W. F. and Jones, S. B. (1995). Microscopy of the interaction of hrp mutants of

Pseudomonas syringae pv. phaseolicola with a nonhost plant. Plant Science

Limerick 107, 27-39.

 76

Fletcher, J., Bender, C., Budowle, B., Cobb, W. T., Gold, S. E., Ishamaru, C. A.,

Luster, D., Melcher, U., Murch, R., Scherm, H., Seem, R. C., Sherwood, J.

L., Sobral, B. W. and Tolin, S. A. (2006). Plant Pathogen Forensics:

Capabilities, Needs and Recommendations. Microbiology and Molecular

Biology Reviews, 70(2): 450-471.

Fletcher, J., Luster, D., Bostock, R., Burans, J., Cardwell, K., Gottwald, T.,

McDaniel, L., Royer, M. and Smith, K. (2010). Emerging Infectious Plant

Diseases. In; Emerging Infections 9 Chapter 18. (Edited by, Sheld,M.,

Grayson, M.L. and Hughes, J.M.) ASM Press, Washington,DC. pp. 338-366.

Forage Crops and Grasses (FCG) (2008). Handbook of Agriculture

[http//www.icar.org.in/files/forage-and-grasses] cited on 14/12/2011).

Franco, A. D., Rodriguez, A. M. and Cedillo, R.G. (2007). Buffel grass leaf blight:

Its presence in Tamaulipas, Mexico. Agriculture Technical of Mexico, 33:

(3).

Friedel, M., Puckey, H., O’Malley, C., Waycott, M., Smyth, A. and Miller, G.

(2006). Buffel grass: both friend and foe. An evaluation of the advantages

and disadvantages of buffel grass use and recommendations for future

research, Desert Knowledge Cooperative Research Centre, Alice Springs.

 77

Ghiasian, S. A., Kord-Bacheh, P., Rezayat, S. M., Maghsood, A. H., Taherkhani, H.

(2004). Mycoflora of Iranian maize harvested in the main production areas in

2000. Mycopathology 158 (1): 113–121.

Gleiser, G., Picher, C. M., Veintimilla, P., Martinez, J. and Verdú, M (2004).Seed

dormancy in relation to seed storage behaviour in Acer. Botanical Journal of

the Linnean Society, 145: 203–208.

Gnanamanickam, S. S., Priyadarshani, B., Narayanan, N. N., Vasudevan, P. and

Kavitha, S. (1999). An over view of bacterial leaf blight disease of rice and

strategies for its management. Current Science, 77(1): 1435-1444.

Gobius, N.R., Phaikaew, C., Pholsen, P., Rodchompoo, O. and Susena, W. (2001).

Seed yield and its components of Brachiaria decumbens cv. Basilisk,

Digitaria milanjiana cv. Jarra and Andropogon gayanus cv. Kent in north-

east Thailand under different rates of nitrogen application. Tropical

Grasslands 35: 26-33.

Gohl, B. (1981). Tropical feeds. Feed information summaries and nutritive values.

FAO Animal Production and Health Series 12. FAO, Rome.

Gonzalez, Y., Mendoza, F. and Torres, R. (1994). Effect of storage, Chemical and

Mechanical Scarification on seeds of Brachiaria decumbens cv. basilisk

Pasture and Forage 17:35-43.

 78

Grice, A.C. and Martin, T.G. (2005). The management of weeds and their impact on

biodiversity in the rangelands. CRC for Australian Weed Management Report

2005, Townsville.

Ha, Y., Fessehaie, A., Ling, K. S., Wechter, W. P., Keinath, A. P., and Walcott, R. R.

(2009). Simultaneous detection of Acidovorax avenae subsp. citrulli and

Didymella bryoniae in cucurbit seedlots using magnetic capture hybridization

and real-time polymerase chain reaction. Phytopathology 99: 666-678pp.

Habib, A., Sahi, S. T., Javed, N. and Ahmad, S. (2011). Prevalence of seed-borne

fungi on wheat during storage and its impact on seed germination. Pakistan

Journal of Phytopathology. 23(1):42-47pp.

Hacker, J. B. and Ratcliff, D. (1989). Seed dormancy and factors controlling

dormancy breakdown in buffelgrass accession from contrasting provenances.

Journal of Applied Ecology 26: 201-212.

Haikal, N. Z. (2008). Effect of filtrate of pathogenic Fungi of Soybean on Seed

Germination and Seedling Parameters. Journal of Applied Sciences Research,

4(1): 48-52.

Hajihasani, M., Abolfazi, H. and Khaghani, S. (2012). Incidence and distribution of

seedborne fungi associated with wheat in Markazi Province, Iran. African

Journal of Biotechnology 11 (23): 6290-6295.

 79

Harmon, P., Palmateer, A. and Ribbeck, R. (2011). Homeowner's Guide to

Fungicides for Lawn and Landscape Disease Management. PP-233

Document series of Plant Pathology Department, Florida Co-operative

Extension Service, Institute of Food and Agriculture Science. University of

Florida.

Harty, R. L., Hopkinson, J. M., English, B. H. and Alder, J. (1983). Germination,

dormancy and longevity in stored seed of Panicum maximum. Seed Science

& Technology. 11:341-351.

He, S. Y., Huang, H. and Collmer, A. (1993). Pseudomonas syringae pv. syringae

harpin Pss: a protein that is secreted via the Hrp pathway and elicits the

hypersensitive response in plants. Cell 73: 1255–1266.

Hildebrand, D. C. and Schroth, M. N. (1972). Identification of the fluorescent

Pseudomonads. In: Proceedings of the 3rd International Conference on Plant

Pathogenic Bacteria, Wageningen Centre for Agricultural Publishing and

Documentation. pp 281-287.

Houck, M. J. (2009). Understanding Seeding Rates, Recommended Planting Rates,

and Pure Live Seed (PLS). USDA NRCS Plant Materials Technical Note

No.11. Alexandria, Louisiana.

 80

HSU (Herbage Seed Unit). (1994). Forage Seed Production. ILCA Training Manual.

ILCA (International Livestock Centre for Africa), Addis Ababa, Ethiopia.

pp70.

Huang, H. C., Lin, R. H., Chang, C. J., Collmer, A. and Deng, W. L. (1995). The

complete hrp gene cluster of Pseudomonas syringae pv. syringae 61 includes

two blocks of genes required for harpinPss secretion that are arranged

colinearly with Yersinia ysc homologs. Molecular plantmicrobe interactions

MPMI, 8 (5), 733-746.

Ibarra, H. M.; Zarate, P.and Saldivar, A. J. (2004). Evaluation of seed size on

germination and seedling growth of buffelgrass. In: American Forage and

Grassland Council, Proceedings. 13: 272-275.

IF (Informed farmers) (2010). Buffel grass (Edited by DI, P.) 9, November, 2010.

[http://informedfarmers/buffelgrass cited on 2/11/2011].

Issoufou, M., Zaman-Allah, M., Ferchichi, A. and Ferjani, E. (2008). Clipping

Effects on the Growth Variation, Water Use Efficiency and Photosynthetic

Activity in Buffel Grass (Cenchrus ciliaris L.) Poaceae. Asian Journal of

Plant Sciences, 7: 95-99.

ISTA (International Seed Testing Association) (2005). International Rules for Seed

Testing Edition 2005/2. ISTA CH-Switzerland.

 81

Jackson, J. (2005). Is there a relationship between herbaceous species richness and

buffelgrass (Cenchrus ciliaris)? Australia Ecology 30: 505-517.

Jacobs, S. S., van Niekerk, W. A., Coertze, R. J., (2004). Qualitative evaluation of

Cenchrus ciliaris cv. Molopo and Gayndah as forage. South Afr. J. Anim.

Sci., 34 (5): 65-67.

Jorge, M. A. B., Van De Wouw, M., Hanson, J. and Mohamed, J. (2008).

Characterisation of a collection of Buffel grass (Cenchrus ciliaris).Tropical

Grasslands.42: 27-39.

Jugah, B., Kadir, A., Ahmad, M., Sariah and Juraimi, A. S. (2007). Fungal Pathogen

of Rottboellia cochinchinensis and its Potential as Bioherbicide. Asian

Journal of Plant Sciences, 6: 21-28.

Jutzi, S. (1986). Harbage seed production in sub-Saharan Africa, its integration in

natural pasture research and seed industry development for regional

supporting activities. In: Proceendings of workshop on African Small

ruminant research and development held at ILCA, Addis Ababa, Ethiopia

(Edited by Haque et al.,) 16-19 September, 1985. pp 32-35.

Kadir, J. B. and Charudattan, R. (2000). Dactylaria higginssii, a bioherbicide agent

for purplenutsedge (Cyperus rotundus). Biological Control, 17:113-124.

 82

Kadota, I. (1996). Studies on the pathogen of bacterial brown stripe of rice and its

ecology. Bull. Hokuriku. Nat. Agric. Expt. Stn. 38:113–171.

Kavana, P. Y., Kizima, J. B., Msanga, Y. N., Kilongozi, N. B., Msangi, B. S. J.,

Kadeng'uka, L. A., Mngulu, S. and Shimba, P. K. (2005). Potential of pasture

and forage for ruminant production in Eastern zone of Tanzania. Livestock

Res. for Rural Development 17 (12).

Khanzada, K. A., Rajput, M. A., Shah, G. S., Lodhi, A. M. and Mehboob, F. (2002).

Effect of seed dressing fungicides for the control of seedborne mycoflora of

wheat. Asian Journal of Plant Sciences, 1(4): 441-444.

King, E. O., Ward, M. K. and Raney, D. E. (1954). Two simple media for the

demonstration of pyocyanin and fluorescin. J. Lab. Clin. Med. 44:301-307.

Kizima, J. B, Mtengeti, E. J. and Nchimbi-Msolla, S. (2012). Current viability status

of Cenchrus ciliaris seeds from three farms in sub humid eastern agricultural

zone of Tanzania. Paper presented in Scientific Conference of Rangeland

Society of Tanzania held at Morogoro Hotel, Morogoro, Tanzania on 14 -16

March, 2012.

Kleczewski, N. M. and Flory, S. L. (2010). Leaf blight disease on the invasive grass

Microstegium vimineum caused by a Bipolaris sp. Plant Dis. 94:807-811.

 83

Kovacs, N. (1956). Identification of Pseudomonas pyocyanea by the oxidase

reaction. Nature, London 178:703.

Kumar, D., Dwivedi, G. K., and Singh, S. N. (2005). Seed yield and quality of buffel

grass (Cenchrus ciliaris) as influenced by row spacing and fertiliser level

Tropical Grasslands , 39: 107 –111.

Lelliott, R. A., Stead D. E., (1987). Methods for the diagnosis of bacterial diseases

of plants. Methods in plant Pathology Vol 2, (Ed. T.F. Preece). Blackwell

Publications, London, UK 216 pp.

Loch, D. S. (1993). Improved handling of chaffy grass seeds; option, opportunities

and value. Tropical Grasslands 27: 314-326.

Loch, D. S. and Boyce, K. G. (2001). Meeting the changing need for herbage seed

quality assurance in the 21st century. [http://www.internationalgrasslands.org

/files/igc /publications/2001/tema 3-1] cited on 2/07/2012.

Luo, Y., Ma, Z. and Michailides, T. J. (2001). Analysis of factors affecting latent

infection and sporulation of Monilinia fructicola on prune fruit. Plant

Diseases. 85:999-1003.

Lwoga, A. B., Lugenja, M. M. S. and Kajuni, A. R. (1984). Pasture research in

Tanzania. In: Proceeding of Pasture Improvements Research in Eastern and

Southern Africa held in Harare, Zimbabwe, 17-21 Sept. 1984. IDRC, pp 210-

221.
 84

M’seddi, K., Mnif, L., Chaieb, M. and Neffati, M. (2003). Cenchrus ciliaris

productivity in relation to rainfall: Correlation between fodder yield

components. Proc. of the VII International Rangeland Congress, Durban,

South Africa. pp1414–1416.

Magarey, R. D., Sutton, T. B., and Thayer, C. L. (2005). A simple generic infection

model for foliar fungal plant pathogens. Phytopathology 95:92-100.

Makiela, S. and. Harrower, K. M. (2008). Overview of the current status of

buffelgrass dieback. Australasian Plant Disease Notes. pp 12–16.

Makiela, S., Harrower, K. M. and Graham, T. W. G. (2003). Buffel grass (Cenchrus

ciliaris) dieback in Central Queensland. Agricultural Science 16: 34–36.

Manyangarirwa, W., Bwerazuva, R. and Mortensen, C. N. (2009). Seed-borne fungal

and bacterial pathogens on farm-retained cowpea seeds from Zimbabwe.

African Crop Science Conference Proceedings, 9: 595 - 59.

Maritza, C. I., Balcazar, M. S., Ramirez, J. L., Medina C.A., Martinez, J. and

Debouck, D. (2009). Handbook of procedures of the germplasm health

laboratory. CIAT Genetic Resources program.

Mathur, S. B. and Mahandhar, H. K. (2003). Fungi in Seeds. The Danish

Government Institute of Seed Pathology for Developing countries. Danish

Government Institute of Seed Pathology for Developing countries,

Copenhagen Denmark. 434pp.

 85

Mathur, S.B. and Kongsdal, O. (2003). Common Laboratory Seed Health Testing

Methods for Detecting Fungi. Danish Government Institiute of Seed

Pathology for Developing Countries. Bassersdorf, ISTA. CH-Switzerland

427pp.

Maude, R. B. (1996). Seedborne diseases and their control. Cambridge: CAB

International. 280 pp.

Mbega, E. R., Mabagala, R. B., Adriko, J. O., Lund, S., Wulff, E. G. and Mortensen,

C. N. (2012). Five Species of Xanthomonads Associated with Bacterial Leaf

Spot Symptoms in Tomato from Tanzania. (edited by Davis, R.M) Plant

Disease.96 (5): 760. DOI:10.1094/PDIS-01-12-0105-PDN.

Mbega, E. R.(2007). Seed health status of Sorghum and Sesame produced under

quality declared seed (QDS) system. Unpublished Dessertation on award of

MSc.degree at Sokoine University of Agriculture, Morogoro, Tanzania 68pp.

Mclvor, J. G. (2005). Australian grasslands. In: Grasslands of the world. (Edited by

Suttie, J. M., Reynolds, S. G. and Batello, C.) (FAO: Rome) pp. 343–380.

Mero, R. N. and Udén, P. (1998). Promising tropical grasses and legumes as feed

resources in Central Tanzania V. Effect of supplementing Cenchrus ciliaris

hay with leaves from four legumes on intake and digestibility by growing

Mpwapwa bulls. Anim. Feed Sci. Technol., 70: 111-122.

 86

Mganga, K. Z., Musimba, N. K. R., Nyangito, D. M. and Mwang’ombe A.W. (2010).

Improving Hydrological Responses of Degraded Soils in Semi Arid Kenya.

Journal of Environmental Science and Technology 3(4): 217-225.

Ministry of Water and Livestock Development (MWLD) (2005). Proc. of Hundred

Years of Livestock Services in Tanzania 105 -2005, Held at LPRI on June 06-

11, 2005. Mpwapwa, Tanzania pp54.

Minson, D. J.and Bray, R. A. (1986). Voluntary intake and in vivo digestibility by

sheep of five lines of Cenchrus ciliaris selected on the basis of preference

rating. Grasses Forage Sci. 41: 47-52.

Mortensen, C. M. (2005). Seed Bacteriology; Laboratory Guide. Danish Seed Health

Centre for Developing Countries, Thorvaldsensvej 40, DK-1871,

Frederiksberg C, Copenhagen, Denmark. 126pp.

Mukhtar, I. (2009). Sunflower Disease and Insect Pests in Pakistan: A Review.

African Crop Science Journal, 17(2): 109 – 118.

Mushtaque, M.,Ishaque, M. and Bakshush, M. A. (2010). Influence of maturity on

morphological characteristics of Buffel grass. Pakistan Journal of Science 62

(2): 124-127.

Mwilawa, A. J. (2005). Pasture and fodder crop handbook for Tanzania 45pp.
 87

Ndomba, R. (2009). Screening for seed-borne micro-organisms in selected pasture

seeds. Unpublished Dessertation on Award of MSc. Degree at Sokoine

University of Agriculture, Morogoro, Tanzania.59pp.

Neergaard, P. (1977). Seed Pathology. John Wiley, New York, USA.1191pp.

Nelson, S. C. (2009). Bacterial leaf blight of fishtail palm. University of Hawaii at

Manoa, College of Tropical Agriculture and Human Resources, Cooperative

Extension Service, PD-65. http://www.ctahr.hawaii.edu/oc/freepubs/pdf/PD-

65.pdf.

Niaz, I. and Dawar, S. (2009). Detection of seed borne mycoflora in maize (Zea

mays L.). Pakistan Journal of Botany 41(1): 443-51.

NLP (National Livestock Policy) (2006). Rangeland Resource Management in

Pastoral and Agro-Pastoral Areas pp29-31.

Ocamb, C. M. and Alderman, S. C. (2004). Fusarium species associated with tall

fescue seed production in Oregon. Online. Plant Health Progress

DOI:10.1094/PHP-2004-0319-01-RS

Ocumpaugh, W. R., Hussey, M. A. and Burson, B. L. (1994). Buffelgrass forage and

Seed production responses to N and P fertilization. Soil Fertility, No.41

Texas A and M University, College station,Texas; Session 10:1-2.

[http://www.internationalgrasslands.org/files/igc/publications/1997/1-10-

001.pdf] cited on 27/6/2012.

 88

Olivier, T. (2009). Effects of temperature and storage regimes on the germination

rates of three native warm-season grasses. Thesis on Award of Msc. degree at

Nicholls State University, USA. 65pp.

Palma-Rivero, M. P., Lopez-Herrera, A. Y. and Molina-Moreno, J. C. (2000).

Storage conditions and seed germination of Cenchrus ciliaris L. and

Andropogon gayanus Kunth. Network of Scientific Journals from Latin

America, the Caribbean, Spain and Portugal Scientific Information System.

34 (1): pp41- 48.

Parihar, S. S. and Pathak, P. S. (2006). Flowering phenology and biology of selected

tropical perennial grasses. Tropical Ecology 47 (1): 81-87.

Perrott, R. (2000). Diseases of buffel grass. Proceedings of buffelgrass workshop,

Theodore Qld, 21–23 February 2000 (edited by. Cook, B.), pp19–20.

Perrott, R. F. and Chakraborty, S. (1999). Pyricularia grisea causes blight of buffel

grass (Cenchrus ciliaris) in Queensland, Australia. Tropical Grasslands 33:

201-206.

Qiagen (2006). DNeasy Blood and Tissue Kit. DNeasy ® Blood and tissue Handbook,

pp 26-49.
 89

Rao, N. K., Hanson J., Dulloo, M. E., Ghosh K., Nowell, D., Larinde, M. (2006).

Handbooks for genebanks No.8 Manual of seed handling in genebanks.

Biodiversity international, Rome, Italy

[http://www.bioversityinternational.org/fileadmin/bioversity/publications

/pdfs/1167_Manual_of_Seed_Handling_in_Genebanks] cited on 14/10/2011.

Rasheed, S., Dawar, S. and Ghaffar, A. (2004). Seedborne mycoflora of groundnut.

Pakistan Journal of Botany, 36(1):199-202.

Roux, K. H. (1995). Optimization and troubleshooting in PCR. (D. C. W & D. G. S,

Eds.) Cold Spring Harbor protocols, 2009 (5), pdb.ip66.

http://www.ncbi.nlm.nih.gov/pubmed/20147122 cited on 28/08/2012.

Rudmanna, S. G., Milhamb, P. J. and Conroy, J. P. (2001). Influence of High CO 2

Partial Pressure on Nitrogen Use Efficiency of the C4 Grasses Panicum

coloratum and Cenchrus ciliaris. Ann. Bot., 88:571-577.

Rukiko, P., (2011). Effect of fungicide application on the germination percentage of

Cenchrus ciliaris from four pasture seed farms in Tanzania. Unpublished

Special project on Award of BSc. Degree at Sokoine University of

Agriculture, Morogoro, Tanzania. pp15.

Saettler, A.W. (1989). “Assessment of yield loss caused by common blight of beans

in Uganda.” Annual Report of the Bean Improvement Cooperative 35: 113-

114.
 90

Safdar, A. H., Anwar, A., Sahi, G. M., Abbas, Q. and Imran, A. (2009). Seed borne

fungal Pathogens associated with pearl millet (Pennisetum typhoides) and

their impact on seed germination. Pakistan Journal of Pyhtopathology, 21(1):

55-60.

Sakthivel, N., Mortensen, C. N, Mathur, S. B. (2001). Detection of Xanthomonas

oryzae pv. oryzae in artificially inoculated and naturally infected rice seeds

and plants by molecular techniques. Appl.Microbiol. Biotechnol. 56:435–441.

Samudrala, R., Heffron, F., McDermott, J. E. (2009). Accurate prediction of secreted

substrates and identification of a conserved putative secretion signal for type

III secretion systems. PLoS Pathog 5: e1000375.

Sanogo, S. and Moorman, G.W. (1993). Transmission and control of Pythium

aphanidermatum in an ebb and flow sub irrigation system. Plant Disease,

77: 287–290.

Santos, B. M. (2010). Seed Quality and Seeding Technology. Vegetable Production

Handbook, HS713, Chapter 4, IFAS Extension, University of Florida. pp19-

22.

Sarwatt, S. and Mollel, E. (2002). Country-Pasture/Forage-Resource Profile. Edited

by Suttie J. M. and modified by Reynolds, S.G. November 2002, Grassland

and Pasture Crops, FAO [http://www.fao.org/ag/AGP/AGPC/doc/Counprof

/tanz.htm] cited on 24/09/2012.

 91

SAS (Statistical Analysis System) (2004). Proprietary Software release 8.1.

Statistical Analysis Institute, Inc. Cary, North Carolina USA.1028pp.

Satish, S., Raghavendra, M. P. and Raveesha K. A. (2010). Management of seed

borne fungal pathogens of sorghum seeds by aqueous extract of Lawsonia

inermis (L). Journal of Biopesticides 3 (Special Issue (1)): 237 -241.

Shakya, D. D., Vinther, F. and Mathur, S. B. (1985) Worldwide distribution of

bacterial stripe pathogen of rice identified as Pseudomonas avenae.

Phytopathologische Zeitschrift 111:256–259.

Singariya, P., Mourya, K. and Kumar, P. (2011). Preliminary phyto-profile and

Pharmacological evaluation of some extracts of Cenchrus grass against

selected pathogens. Journal of Pharm. Sci. &Res. Vol. 3 (8)1387-1393.

Singh and Agrawal, K. (Eds) (2005). Seed technology and Seed Pathology.

http//www.woov.veedambooks.com/no 21283.htm cited on 14/09/2011.

Sinha, R. K., Bhatia, S. and Vishnoi, R. (1996). In: Rala Report no. 200, 115-123pp.

Song, W.Y., Kim, H.M., Hwang, C.Y. and Schaad, N.W. (2004). Detection of

Acidovorax avenae ssp avenae in rice seeds using BIO-PCR. Journal of

Phytopathology 152 (11/12): 667-676.

 92

Springer, T.L. and Dewald, C. L. (2001). Germination and Dormancy of Eastern

Gamagrass seeds. In Proc. 56th Southern Pasture and Forage Crop

Improvement Conference, Springdale, A R. April 21-22.

Sullivan, M., Daniells, E. and Southwick, C. (2011). CPHST Pest Datasheet for

Xanthomonas oryzae pv. oryzae. USDA-APHIS-PPQ-CPHST.

Tang, X. Y., Xiao, Y. M.; Zhou, J. M. (2006). Regulation of the type III secretion

system in phytopathogenic bacteria . Molecular Plant-Microbe Interactions

19 (11): 1159-1166.

Tariq, M. Dawar, S. Abid, M. and Shaukat, S.(2005). Seedborne mycoflora of

soybean. Int. Journal of Biol. Biotech., 2(3):711-713.

Temu, V. W. K., Njau, F. B. C., Shayo, C. M. and Bwire, J. M. N. (2005). Feed and

feeding systems for Ruminant Livestock in Tanzania.In: Proc. of hundred

years of Livestock Services in Tanzania 1905-2005. June 06-11, LPRI.

Mpwapwa. pp 145-153.

Thomsen, K. and Schmidt, L. (1999). Control of fungi during Seed procurement.

Technical Note 53. Danida Forest Seed Centre, Humlebæk, Denmark.

 93

William, M. N. M. (2006). Seed health status of rice and onions under the Quality

Declared seed system: The case of Morogoro and Dodoma Regions.

Unpublished Dissertation on Award of MSc.Degree. at Sokoine University of

Agriculture, Morogoro, Tanzania. 92pp.

Wulff, E. G., Zidab, E., Torpa, J. and Lunda, O. S. (2011) Yucca schidigera extract:

A potential bio-fungicide against seedborne pathogens of sorghum. Plant

Pathology.[http://onlinelibrary.wiley.com/doi/10.1111/j.1365-

3059.2011.02517.x/pdf].Cited on 18/09/2011.

Yadav, M. S., Rajora, M. P. and Sharma, S. K. (2001). Effect of storage and seed

treatments on germination in buffelgrass. Range Management and

Agroforestry, 22, 1–5.

Yuan, X. (2004). Identification of bacterial pathogens causing panicle blight of rice

in Louisiana. Thesis on Award of MSc. Degree at Lousiana State University,

USA. 38pp.

Zou, L., Wang, X., Xiang, Y., Zhang, B., Li, Y., Xiao, Y.,Wang, J.,Walmsley A. R.

and Chen, G. (2006). Elucidation of the hrp Clusters of Xanthomonas oryzae

pv. oryzicola that control the Hypersensitive response in Nonhost Tobacco

and Pathogenicity in Susceptible host Rice. Applied and Environmental

Microbiology 72(9):6212-6224.
 94

APPENDICES

Appendix 1: ANOVA tables for buffelgrass seed Germination tests

1. Dependent Variable: NS

Source DF Sum of Squares Mean Square F Value Pr > F

Model 5 3707.333333 741.466667 11.10 <.0001
Error 18 1202.000000 66.777778
Corrected Total 23 4909.333333
R-Square Coeff Var Root MSE NS Mean
0.755160 46.25529 8.171767 17.66667

2. Dependent Variable: ABS

Source DF Sum of Squares Mean Square F Value Pr > F

Model 5 67.5000000 13.5000000 3.08 0.0352
Error 18 79.0000000 4.3888889
Corrected Total 23 146.5000000
R-Square Coeff Var Root MSE ABS Mean
0.460751 93.10967 2.094968 2.250000

3. Dependent Variable: HS

Source DF Sum of Squares Mean Square F Value Pr > F

Model 5 836.875000 167.375000 6.52 0.0013
Error 18 461.750000 25.652778
Corrected Total 23 1298.625000
R-Square Coeff Var Root MSE HS Mean
0.644432 35.85740 5.064857 14.12500

4. Dependent Variable: DS

Source DF Sum of Squares Mean Square F Value Pr > F

Model 5 4778.208333 955.641667 10.91 <.0001
Error 18 1576.750000 87.597222
Corrected Total 23 6354.958333
R-Square Coeff Var Root MSE DS Mean
0.751887 14.18977 9.359339 65.95833
 95

Appendix 2: ANOVA tables for disease severity rating on buffelgrass plants 7

to 28 days after inoculation

1. Dependent Variable: 7DAI

Source DF Sum of Squares Mean Square F Value Pr > F
Model 6 0.46428571 0.07738095 1.62 0.1896
Error 21 1.00000000 0.04761905
Corrected Total 27 1.46428571
R-Square Coeff Var Root MSE D7AI Mean
0.317073 101.8350 0.218218 0.214286

2. Dependent Variable: 14DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 6 1.11607143 0.18601190 2.72 0.0411
Error 21 1.43750000 0.06845238
Corrected Total 27 2.55357143
R-Square Coeff Var Root MSE 14 D AI Mean
0.437063 66.59776 0.261634 0.392857

3. Dependent variable: 21DAI

Source DF Sum of Squares Mean Square F Value Pr > F
Model 6 7.14620000 1.19103333 31.81 <.0001
Error 21 0.78632500 0.03744405
Corrected Total 27 7.93252500
R-Square Coeff Var Root MSE 21D AI Mean
0.900873 16.71746 0.193505 1.157500

4. Dependent variable: 28DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 6 18.74107143 3.12351190 20.09 <.0001
Error 21 3.26562500 0.15550595
Corrected Total 27 22.00669643
R-Square Coeff Var Root MSE 28 D AI Mean
0.851608 20.16728 0.394342 1.955357

Appendix 3: ANOVA tables for fungal disease symptoms observed on

buffelgrass seedlings at 7 to 28 days after inoculation.

1. Dependent Variable: 7DAI

 96

Source DF Sum of Squares Mean Square F Value Pr > F

Model 6 15.42857143 2.57142857 1.50 0.2265
Error 21 36.00000000 1.71428571
Corrected Total 27 51.42857143
R-Square Coeff Var Root MSE 7DAI Mean
0.300000 152.7525 1.309307 0.857143

2. Dependent Variable: 14DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 6 15.42857143 2.57142857 1.14 0.3727
Error 21 47.25000000 2.25000000
Corrected Total 27 62.67857143
R-Square Coeff Var Root MSE 14DAI Mean
0.246154 93.33333 1.500000 1.607143

3. Dependent Variable: 21DAI

Source DF Sum of Squares Mean Square F Value Pr > F
Model 6 163.7142857 27.2857143 7.05 0.0003
Error 21 81.2500000 3.8690476
Corrected Total 27 244.9642857
R-Square Coeff Var Root MSE 21DAI Mean
0.668319 43.36670 1.966989 4.535714
4. Dependent Variable: 28DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 6 716.214286 119.369048 4.83 0.0030
Error 21 518.750000 24.702381
Corrected Total 27 1234.964286
R-Square Coeff Var Root MSE 28DAI Mean
0.579947 45.33035 4.970149 10.96429

Appendix 4: ANOVA tables for disease lesions length caused by bacterial

isolates on buffelgrass leaves at 7 to 28 days after inoculation
using clip method

1. Dependent variable: 7DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 4 0.80517333 0.20129333 19.93 <.0001
Error 10 0.10100000 0.01010000
Corrected Total 14 0.90617333
R-Square Coeff Var Root MSE 7 D AI Mean
0.888542 12.48949 0.100499 0.804667
 97

2. Dependent variable: 14 DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 4 0.31029333 0.07757333 12.43 <.0007
Error 10 0.06240000 0.00624000
Corrected Total 14 0.37269333
R-Square Coeff Var Root MSE 14 D AI Mean
0.832570 7.615071 0.078994 1.037333

3. Dependent variable: 21DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 4 0.16576000 0.04144000 0.1639 2.04
Error 10 0.20280000 0.02028000
Corrected Total 14 0.36856000
R-Square Coeff Var Root MSE 21 D AI Mean
0.449750 12.23435 0.142408 1.164000

4. Dependent Variable: 28DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 4 0.05117333 0.01279333 0.41 0.7960
Error 10 0.31020000 0.03102000
Corrected Total 14 0.36137333
R-Square Coeff Var Root MSE 28 D AI Mean
0.141608 13.29579 0.176125 1.324667

Appendix 5: ANOVA tables for disease lesions caused by bacterial isolates on

buffelgrass seedlings at 7 to 28 days after inoculation using spay
method

1. Dependent variable: 7DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 2 0.24246667 0.12123333 0.40 0.6881
 98

Error 6 1.82693333 0.30448889

Corrected Total 8 2.06940000
R-Square Coeff Var Root MSE 7D AI Mean
0.117168 29.72020 0.551805 1.856667

2. Dependent variable: 14DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 2 1.01580000 0.50790000 0.90 0.4548
Error 6 3.38260000 0.56376667
Corrected Total 8 4.39840000
R-Square Coeff Var Root MSE 14 D AI Mean
0.230948 24.37805 0.750844 3.080000

3. Dependent variable: 21DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 2 47.10906667 23.55453333 3.98 0.0794
Error 6 35.51553333 5.91925556
Corrected Total 8 82.62460000

R-Square Coeff Var Root MSE 21 D AI Mean

0.570158 27.28544 2.432952 8.916667

4. Dependent variable: 28DAI

Source DF Sum of Squares Mean Square F Value Pr > F

Model 2 45.70246667 22.85123333 10.22 0.0117
Error 6 13.41473333 2.23578889
Corrected Total 8 59.11720000
R-Square Coeff Var Root MSE 28 D AI Mean
0.773082 13.44654 1.495255 11.12000
 99

Appendix 6: ANOVA tables for buffelgrass Caryopsis germination tests

1. Dependent Variable: NS

Source DF Sum of Squares Mean Square F Value Pr > F

Model 5 4494.833333 898.966667 39.37 <.0001
Error 18 411.000000 22.833333
Corrected Total 23 4905.833333
R-Square Coeff Var Root MSE NS Mean
0.916222 20.26187 4.778424 23.58333

2. Dependent Variable: ABS

Source DF Sum of Squares Mean Square F Value Pr > F

Model 5 126.3750000 25.2750000 15.55 <.0001
Error 18 29.2500000 1.6250000
Corrected Total 23 155.6250000
R-Square Coeff Var Root MSE ABS Mean
0.812048 29.13725 1.274755 4.375000

3. Dependent Variable: HS

Source DF Sum of Squares Mean Square F Value Pr > F

Model 5 1823.708333 364.741667 18.59 <.0001
Error 18 353.250000 19.625000
Corrected Total 23 2176.958333
R-Square Coeff Var Root MSE HS Mean
0.837732 26.12292 4.430011 16.95833

4. Dependent Variable: DS
Source DF Sum of Squares Mean Square F Value Pr > F
Model 5 1529.833333 305.966667 17.43 <.0001
Error 18 316.000000 17.555556
Corrected Total 23 1845.833333
R-Square Coeff Var Root MSE DS Mean
0.828804 7.606539 4.189935 55.08333