Documenti di Didattica
Documenti di Professioni
Documenti di Cultura
NO ITEM
Price $ TOTAL price
A B C $
.1 List of needed medical disposables 720,628.57 123,082.9 0 843,711.47
.2 List of needed medicines. 493,730 579,560 47,103 1,120,393
.3 . List of laboratory supplies 636,013 60,000 153,500 849,513
. List of medical and office furniture. 370,510 9,800 9,920 390,230
.4
List of Fabric and apparel 228,000 0 0 228,000
.5
List of Equipment Requirements 1,259,600 0 1,250 1,260,850
.6
Need list of electrical devices , 9,170 4,675 57,015 70,860
.7 computers and IT.
TOTAL 3,717,651.57 777,117.90 268,788 4,763,557.47
NO ITEM
Price $
A
.1 List of needed medical disposables 720,628.57
.2 List of needed medicines. 493,730
.3 . List of laboratory supplies 636,013
. List of medical and office furniture. 370,510
.4
List of Fabric and apparel 228,000
.5
List of Equipment Requirements 1,259,600
.6
Need list of electrical devices , computers and IT. 9,170
.7
TOTAL 3,717,651.57
28 I.V. CANNULA WITH INJECTION PORT 24G PIECE 200000 0.4 80000 A
Total Price (NIS) NIS 2522200
Total Price( $) $ 720628.5714
2- Drugs A-1
Urgent Antiseptic and disinfectant Request 9-3-2020
UNIT Estimated
# Old Code NEW CODE Product Nme Dosage Form Unit Quantity category Priority
price $ Cost
Antiseptic and
1 E15104604 E15104604 Chlorhexidine 4%, 500 ml Scrub SINGLE 3,000.00 5.50 16,500 A
disinfectant
2 E15104508 E15104508 Chlorhexidine 1.5%+ Cetrimide 15%, 1000 ml Solution LITER 1500 7 Antiseptic and disinfectant 10500 A
3 E15104512 E15104512 Ethyl Alcohol 70% (denatured) with Pump Spray Solution SINGLE 15000 3.35 Antiseptic and disinfectant 50250 A
Ethyl alcohol 70% antiseptic hand gel WITH 0.5
4 O32203172 N32203172 Gel 40000 2.7 Antiseptic and disinfectant 108000 A
PUMPS & HOLDERS LITER
5 N15204308 N15204308 Glutaraldhyde 2% solution with activator for 28 days Solution LITER 2000 6.14 Antiseptic and disinfectant 12280 A
7 O32001146 N32001146 Noradrenaline 1mg\ml 4ml Ampoule SINGLE 5000 3 other drugs related to CVS 15000 A
8 E15104520 E15104520 Povidone Iodine 10 % W/V Solution LITER 3000 4.6 Antiseptic and disinfectant 13800 A
Total $ 84560
Protective equipments:
Total
NO. Item Description Unit Quantity Price $ Priority
price$
Personal protective
1 The Kit contain :Overall body cover, N95 mask and Shoes cover. Kit 330 10 3300 A
equipment
Ideal for central sterile services department (CSSD), PVC shield
2 Medical Face Shields (prevent mist), Size: 17.5 X 9.5cm, Foam headband for comfort, Kit 330 5 1650 A
Latex Free and Single use.
· One L spray bottles, Effective against most viruses and
bacteria, Non-hazardous to the laboratory personnel, Doesn’t
3 Disinfection solution: L 15 10 150 A
possess any destructive effects to the materials of equipment,
surfaces and safety cabinets.
Total $ 5100
List of laboratory Needs of Equipment,Reagents and Accessories for Epidemic Corona Virus 10-3-
2020
Code Item Description Unit الكمية Unite Price $ Total
S.n
المطلوبه اسعار سابقة price Priority
o.
$
010300301 Glucostix(Blood) Glucose stick for determination of glucose in Blood,5% Box /50 strip 800 10.0 8000
1 Glucometer set. A
010300302 Glucostix(Blood) For Pediatric Glucose stick for determination of glucose in Pediatric Box /50 strip 500 17.0 8500
2
Blood,5% Glucometer set. A
010300501 Multistix 9SG stick for determination of (glucose,PH,S.G,Protein,Nitrate, Box /100 strip 1000 6.4 6400
3 Bilirobin,Blood,Kitones,Urobilinogen) in urine A
010500201 Multi-control level I Lypholized ( 2-8 °C) vial/ 5 ml 300 7.5 2250
4 Gl, Ur, U.A, Cr, Chol, T.G, T.p, Alb, T.B,D.B, Na, K, Cl, Li, A
Mg, Ca, P, Fe, amy, Ck, LDH, , Alp, ALT, AST.
010500301 Multi-control level II Lypholized ( 2-8 °C) vial/ 5 ml 300 7.5 2250
5 Gl, Ur, U.A, Cr, Chol, T.G, T.p, Alb, T.B,D.B, Na, K, Cl, Li, A
Mg, Ca, P, Fe, amy, Ck, LDH, , Alp, ALT, AST.
071400120 CBC Control (Universal) For CBC machines ( Celldyn,Emerald,rubby,ABX,Sysmex) Box / 12 x 2.5ml 60 130.0 7800
6 Tri level Low, Medium, High A
Disposable And Glass 0 A
Ware
040600201 CupUrine(100ml)nonsterile (100ml) Th 100 76.0 7600
7 A
Trasparent Urine plastic Cups with cover
040600101 Cup(100ml) Sterile (100ml) No 10000 0.1 1100
8 A
Srerile Urine plastic Cups with cover
042302001 Tubes Plastic Centrifuge polystyrene round Bottom test tube Th 100 19.0 1900
9 centerifuge(Polystyrene with label 10 ml (16X100mm) A
round)
042302101 Tubes Plastic sterile swab with transport medium in Th 3 218.0 654
10 (d12/h150mm)Transport polypropylene test tubes (d12/h150mm) A
Media
042302501 Tubes Vacutainer Plastic Vacutainer with anticoagulant EDTA K3 3 ml Th 300 72.0 21600
11 A
(EDTA K3 3 ml ) (12/75)
042302801 Tubes Vacutainer (with Vacutainer plain (with serum separator) 5 ml Th 400 90.0 36000
12 A
serum 5 ml) (13/75)
061300101 Complement -C 3" "Radial Immunodiffusion ( RID ) , complete kit , 3 Kit /12Test 20 35.0 700
calibrators ( high , medium , low ) with control .
13 For measuring the concentration of human complement C3." A
061400101 Complement -C4 "RID , complete kit , 3 calibrators ( high , Kit /12Test 36 85.0 3060
medium , low ) with control
14 A
For measuring the concentration of human
complement C4."
061700101 Immunoglobulins(IgM,IgG,I "RID , complete kit , 3 calibrators ( high , medium , Kit/12 test 48 85.0 4080
gA) . low ) with control .
15 THE test For measuring the concentration of A
human immunoglobulins ( IgG , IgA , IgM )."
07 Laboratory Diagnostic 0
Accessories And A
Disposable
Radiometer blood gas ABL
A
80 CO-OX
070900113 Sensor Cassette ABL 80 ABL 80(SC80 300/30 Full-OX,noGlu, noQC3). Cassette/300 12 1050.0 12600
CO-OX Sensor cassette /300 samples onboard 30 days, sample
16 shelf life upon delivery 2-3 months. Part # 945-728 . A
070900114 Solution pack CO-OX ABL 80 (Flex Solution Pack Co-OX). Shelf life Upon Pack/300 24 120.0 2880
17 Delivery 2 Monthes Onboard up to 30 days Max part sample A
No 944-252
Radiometer blood gas ABL
A
80 basic
070900119 Sensor Cassette ABL 80 Part#945-779 Cassette/300 12 900.0 10800
18 sample A
basic
070900120 Solution pack Basic part # 944-309 Pack/300 12 200.0 2400
19 sample A
0729 Electrolyte Analyzer - 0 A
NOVA 10
20 072900103 Cleaning Solution 11272 Bottle / 50 ml 10 81.0 810 A
21 072900104 Deproteinizing Solution 12704 BTL 10 77.0 770 A
072900133 Linearity Standad set A Box/20 Vial/1 ML 10 74.0 740
22 A
1.2.3,4
23 072900118 Reagent Pack 14608 Kit 70 591.0 41370 A
072900122 Sodium Conditioning 5D0302 Bottle / 100 ml 5 71.8 359
24 A
Solution
Cell Counter - CD Emerald A
25 071000110 CD Emerald Diluent Code (09H4802) 10L 200 117.0 23400 A
26 071000111 CD Emerald Cleaner Code (09H46602) BTL/960 ml 135 124.0 16740 A
27 071000112 CD Emerald HGB Lyse Code (09H4702) BTL/960 ml 60 310.0 18600 A
0714 Cell Counter - Sysmex 0 A
071400102 Cell Pack K1000, X21 8340011-6 Kit /20 L 250 98.0 24500
28 A
Sysmex
071400108 Stamatolyzer WH KX21 SWH-200A Kit /1.5 l 100 200.0 20000
29 A
Sysmex
Chemistry Autoanalyzer -
A
ERBA XL 200,300
074200100 ERBA XL wash solution concentrated wash solution for XL aqueos Kit/4*100ml 200 47.0 9400
30 A
detergent solution
Chemistry Autoanalyzer -
A
mindray bs-380
073800300 CD -80 Detergent For bs L 200 31.0 6200
31 A
380
0723 Electrolyte Analyzer - AVL 0 A
9180
32 072400103 Cleaning Solution AVL9180 Bp1025 Btl/125 ml 10 90.0 900 A
33 072400107 Snap Back Bp5186 comoetable with smartlyte Kit /620 ml 50 259.0 12950 A
34 080800101 Aerobic bottle For detection of aerobic bacteria in Blood. BTL 5000 2.5 12500 A
080800601 Anaerobic bottle Fluid thioglycolate medium. BTL 2000 2.5 5000
Anaerobic( FTm) + Sodium poly anethol
35 A
Sulphate(SPS) for detection of anaerobic
bacteria un blood
Virology 0 A
100200705 Hepatitis B surface Antigen For qualitative detection of antibody of hepatitis Kit /100 Test 100 330.0 33000
(HbsAg) (Qualitative)ARC B surface antigen in blood, MEIA (Axsym,
36 A
Architect), calibrator, (Negative and positive
control) , solution & accsossires
100200902 Hepatitis C virus Antibody For qualitative detection of antibody anti HCV Kit /100 Test 100 544.0 54400
( Qualitative )ARC antibody in blood, MEIA (Axsym, Architect)
37
calibrator, (Negative and positive control) ,
A
solution & accsossires
100201602 Human Immuno deficincy For qualitative detection of Ag-Ab (Combo) of Kit /100 Test 80 330.0 26400
38 Virus (HIV) HIV1,2 in blood, MEIA (Axsym, Architect) A
(Qualitative)ARC calibrator ., solution & accsossires
448613
total
Reagents and Materials for Corona Virus Testing
The following list of reagents for corona virus is estimated to deal with 2000 patients samples according to the expected
number of samples needed to meet the initial period following first case coronavirus diagnosis, additional quantities will be
needed in the future:
NO. Item Description Unit Quantity Price $ Total price$ Priority
1 mSample Preparation Systems RNA Abbott Kit/96 test 20 850 17000 A
2 Reagent vessels 90/ea 200ml Abbott Box/500 2 1700 3400 A
3 96 Deep well plates 32/ea Abbott Box 1 1000 1000 A
4 LiHa disposable tips with filter 1000ulAbbott Box 5 630 3150 A
5 LiHa disposable tips with filter 200u Abbott Box 5 630 3150 A
6 Reaction vessels 32/ea 5 ml Abbott Box/2000 4 330 1320 A
7 m2000 Optical Adhesive Covers 04j71-75 Box/100 2 50 100 A
Two Items :sterile swab Applicator tip
flocked with nylon fiber and UTM-RT
Viral collection system with transport
8 Transport medium for Viruses.equal to Kit/100 30 200 6000 A
media
copan tube ref. 330c ,copan swab ref.
503cs01
9 Go taq probe 1- step RT qPCR system Promeg -Ref.A6120 100 rxn 1 1000 1000 A
TaqPath™ 1-Step RT-qPCR Master Mix, ThermoFisher Cat. No.A15299
10 Kit 3 2400 7200 A
CG Kit/1000RXN
11 2019-nCoV Positive Control (nCoVPC) Cat. No. RV202005 Vial 1 500 500 A
LightMix SarbecoV E-gene plus EAV
12 MOLBIOL- Roche Cat.-No. 40-0776-96 Kit 20 1600 32000 A
control
LightMix Modular Wuhan coV
13 MOLBIOL- Roche Cat.-No. 53-0777-96 Kit 10 1600 16000 A
RdRPgene
14 RdRP_SARSr-F2 : GTGARATGGTCATGTGTGGCGG (40 n mol) Vial 2 40 80 A
CARATGTTAAASACACTATTAGCATA (40 n
15 RdRP_SARSr-R1: Vial 2 40 80 A
mol)
FAM-CCAGGTGGWACRTCATCMGGTGATGC-
16 Probe-RdRP- 1: RdRP_SARSr-P1: Vial 2 600 1200 A
BBQ(high scale )
FAM-CAGGTGGAACCTCATCAGGAGATGC-
17 Probe-RdRP- 2 : RdRP_SARSr-P2 Vial 2 600 1200 A
BBQ(high scale )
18 Qiagen ultrasense Viral Extraxtion Ref. code 53706 Kit/250 test 1 2000 2000 A
ACAGGTACGTTAATAGTTAATAGCGT (40 n
19 E_Sarbeco_F1: Vial 2 40 80 A
mol)
20 E_Sarbeco_R2: ATATTGCAGCAGTACGCACACA (40 n mol) Vial 2 40 80 A
FAM-ACACTAGCCATCCTTACTGCGCTTCG-
21 Probe-E-1:E_Sarbeco_P1: Vial 2 600 1200 A
BBQ(high scale )
Total $ 97740
4- Medical Office Furniture A
NO Item Quantity Unit Price $ Total Classification
1 ICU bed 20 6000 120000
2 Drug cabinet 2 flap 2 170 340
3 laparotary cabinet 1 170 170
4 Stainless Steel Solution Stand 300 70 21000
5 Fowler bed 150 1200 180000 A )is Urgently
Bolt and minerals stoll chair required
6 20 100 2000
Without back
7 Patient bed nightstand 170 150 25500
8 Emergency trolley 5 2500 12500
9 Stainless Steel trolley 2 shelf 20 450 9000
Total 370510
5- Fabrics and clothing A
No. Item Need Item cost $ Total $ Classification
NO ITEM
Price $
B
.1 List of needed medical disposables 123,082.9
.2 List of needed medicines. 579,560
.3 . List of laboratory supplies 60,000
. List of medical and office furniture. 9,800
.4
List of Fabric and apparel 0
.5
List of Equipment Requirements 0
.6
Need list of electrical devices , 4,675
.7 computers and IT.
TOTAL 777,117.90
1 Rotor-Gene Q 5plex HRM Platform Tubes 0.2 ml; Strip Tubes 0.1 ml (4 tubes); Rotor-Disc 72; Rotor- 1 Unit 60,000
Disc 100; Up to 100 samples per run using a Rotor-Disc 100
Temperature range, 35 to 99ºC; Temperature accuracy, ±0.5ºC
(type, measured 30 seconds after clock start); Temperature
resolution, ±0.02ºC (smallest programmable increment);
Temperature uniformity, ±0.02ºC; Ramp rate (peak ramp rates, air),
>15ºC/s heating, >20ºC/s cooling
Rotor-Disc 100 Starter Kit
Laptop computer, software.
Installation and training.
Cat No./ID: 9001580
Total Cost $ 60,000 $
1- Medical Office Furniture
N Item Quantity Unit Price $ Total Classification
1 Accompany fold sofa chair 20 400 8000 is required to be)B(
upholstered bolt chair with back ,without available within two
2 20 90 1800
hands weeks
Total 9800
Electrical Equipment and Computer for Field Hospital
Unit price Total Total
Item Product Quantity B
$ price $ priceB $
brand name computer
1 15 600 9000
with LED monitor 4 2400
2 laptop 5 580 2900 1 580
3 multi function printer 3 350 1050 0 0
4 UPS 850 VA 15 80 1200 4 320
5 food refrigerator 200 L 12 250 3000 5 1250
6 Medication refrigerator 3 550 1650 0 0
7 telephone 20 25 500 5 125
TOTAL 4675
State of Palestinian دولــــة فلــــــسطين
Ministry of Health وزارة الصحة
International Cooperation Department اإلدارة العامة للتعاون الدولي
2020 03 11 Ref :ICD / _____2020
NO ITEM
Price $
C
.1 List of needed medical disposables 0
.2 List of needed medicines. 47,103
.3 . List of laboratory supplies 153,500
. List of medical and office furniture. 9,920
.4
List of Fabric and apparel 0
.5
List of Equipment Requirements 1,250
.6
Need list of electrical devices , 57,015
.7 computers and IT.
TOTAL 268,788