SBI 4U EXAM REVIEW 4U/AP

1.What is the central dogma of DNA synthesis?

2.If the percent of Adenine in a strand of DNA is 10 % determine the percentages of Thymine Guanine and
Cytosine
3.Draw a model of the DNA ladder. Include names for the complementary nitrogen base pairs. Identify
the sugars and phosphates and show the phosphodiester bond and hydrogen bonds
4.Show DNA replication with the details of the leading and lagging strands.
5.Explain how DNA which is a long twisted strand is organized into chromosomes
6.Explain how Chargoff and Franklin established the groundwork for the Watson Crick model of DNA
7.Define recombinant DNA
8.Draw a diagram to show the sticky ends of DNA after treatment with restriction endonucleases. Show
how these ends can be matched to form a new complete DNA strand.
9.Describe the Meselson Stahl experiment
10.Utilize your text and notes to transcribe and translate the following single stranded DNA
TAC GGT GCA GGG TAA CCG TTG
11.What is a palindromic sequence?
12.In the following DNA sample write down the complimentary strand
TTTAAAGTTAACGCAAATTGTACTAA
13.Circle any palindromic sequences you can identify
14.Describe what a point (substitution) mutation could do to the amino acid sequence of a protein
15.Describe what an insertion or deletion mutation could do to the amino acid sequence of a protein.
16.What cells must have been affected if the mutation is passed down to the offspring and is thus
inheritable?
17.Which letter of the codon series can a point mutation have no effect on the amino acid expressed?
18.What is the difference between introns and exons and which is removed before translation?
19.If DNA is cut by restriction endonucleases at four point how many pieces of the DNA will be identified
on the gel electrophoresis?
20.What is Southern Blotting?
21.State some therapies used to destroy cancer cells in patients. What are some of the side effects of these
therapies?
22.What experiment did Hammerling perform and what did it prove?
23.How does reverse transcriptase work and why is this opposed to the Central Dogma
24.Which organelle in the cell produces ATP utlizing the oxidative Kreb’s cycle?
25.Define homeostasis
26.Draw a diagram of the kidney and name the three regions. Where would the glomerulus for each
nephron be located.
27.Where does the nitrogen waste that must be excreted by the kidney originate from?
28.In the nephron, what components of blood pass from the glomerulus to the Bowman’s capsule?
29.Draw a diagram of the human urinary tract system
30.Where is ADH produced and what does it do?
31What is the function of LH FSH estrogen and progesterone in the female ovarian cycle.?
32.Draw a diagram to show the mechanism of action of a steroid hormone on a body cell
33.Where is the adrenal medulla found and what task does it perform?
34.What is the purpose of epinephrine and what are some other words used to describe this chemical?
35.What are some symptoms of an overactive thyroid?
36.What are some symptoms of an under thyroid?
37.What are some symptoms of an overactive parathyroid?
38.What are some symptoms of diabetes mellitus and how is it different from diabetes insipidus?
39.What is a person who is hyperglycaemic?
40.Which cells of the pancreas make insulin and which make glucagon?
41.What is the purpose of insulin ?
42.What is the purpose of glucagons?
43.What is the difference between white and grey matter in the brain?
44.Where are interneurons found?
45.Sketch and label a diagram of the eyeball and show the focus of objects if the person has myopia or if
they are far sighted.
46.What does it mean if a person has astigmatism?
47.What is difference between infection with a virus as opposed to bacteria at the cellular level?
48.What is the autonomic nervous system?
49.Which lobe of the brain controls sight?
50.Which region of the brain controls coordination of muscles and balance?
51.Which part of the brain controls respiration?
52.Which part of the brain controls heartbeat?
53.What is the purpose of endorphins in the brain?
54.What is the purpose of the killer T cells?
55.Describe the difference between an ionic and covalent bond
56.Draw the following functional groups: carboxyl, carbonyl, amino, alcohol
57.Give three examples of monosaccharides and three of disaccharides and two of polysaccharides
58.Draw a flowchart to show how the following are converted to the final product capable of being used by
the cell
POLYSACCARIDE ATP NADH GLUCOSE SUCROSE
59.Given the periodic table determine the number of protons in carbon. How many electrons are also found
in this element?
60.How could the number of neutrons be determined?
61.Explain the differences between endothermic(endergonic) and exothermic(exergonic) reactions and how
this applies to free energy
62.What is the difference between an isomer and isotope?
63.What element can be found in all organic compounds?
64.Describe how several factors affect enzyme activity
65.Draw an amino acid and circle and name the functional groups
66.How many amino acids are coded for in an RNA strand with 12 nucleotides allowing for one start and
one stop codon.
67.Describe with an example the difference between a hydrolysis and condensation reaction. Which could
also be called a dehydration synthesis reaction?
68.Draw a diagram to outline the process of photosynthesis
69.What is the importance of ribulose biphosphate RuBP or RuDP in photosynthesis?
70.In photosynthesis, what is produced in the light reactions (top of your diagram) and what is produced in
the dark reactions (light independent reactions found at the bottom of your diagram
71.What is the grana of the chlorplast made up of
72.What gases important to the evolution of life on earth does photosynthesis produce?
73.Calculate the Rf value of a chromatography analysis of chlorophyll if the colour rises up 4 cm from the
origin and the solvent front moved 6 cm.
74.Do plants ever use oxygen. Why and when would this be most evident?
75.What is the equation used to calculate growth rate?
76.What is a quadrat and when is it useful?87.What are some factors that limit population growth
77.What is the difference between an exponential and arithmetic growth rate?
78.Define biotic potential, environmental resistance ,carrying capacity, fecundity, natality, mortality
fertility