1Two new species of Garra from the lower Yarlung Tsangpo River drainage in

2 Southeast Tibet, China (Cypriniformes: Cyprinidae)

3
4ZHENG GONG1,4, JÖRG FREYHOF2, JIAN WANG1,4, MENG LIU3, FEI LIU1,
5PENGCHENG LIN1, YUELIANG JIANG3 & HUANZHANG LIU1*
6
71 The Key Laboratory of Aquatic Biodiversity and Conservation, Institute of
8 Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, Hubei
9 Province, P. R. China.
102 Leibniz-Institute of Freshwater Ecology and Inland Fisheries (IGB),
11 Müggelseedamm 310, 12587 Berlin, Germany.
123 Powerchina Chengdu Engineering Corporation Limited, Chengdu 610072, Sichuan
13 Province, P. R. China.
144 University of Chinese Academy of Sciences, Beijing 100049, P. R. China.
151* Corresponding author. E-mail: hzliu@ihb.ac.cn
16
17Running title: Two new species of Garra from Southeast Tibet
18
19
20
21
22Abstract
23Two new species of genus Garra are described from the lower Yarlung Tsangpo River
24drainage in Southeast Tibet, China. Garra motuoensis, new species, is primarily
25distinguished from its congeners by having a prominent, quadrate and slightly bilobed
26proboscis covered with 6–20 small to middle-sized unicuspid tubercles, some middle-
27sized unicuspid tubercles on the transverse lobe and several small unicuspid tubercles
28on the lateral surface; the anus being situated shortly behind the middle between the
29pelvic- and anal-fin origins (distance between anus and anal-fin origin 36–46% of that
30between pelvic- and anal-fin origins); 36–37 lateral line scales and 12
31circumpeduncular scale rows. Garra yajiangensis, new species, is primarily
32distinguished from its congeners by having a prominent, quadrate and slightly bilobed
33proboscis, 2–7 middle-sized unicuspid tubercles on the proboscis, some small
34unicuspid tubercles on the transverse lobe and the lateral surface; the anus being
35situated close to the anal-fin origin (distance between anus and anal-fin origin 19–
3624% of that between pelvic- and anal-fin origins); 34–36 lateral line scales and 12
37circumpeduncular scale rows. The validities of these two new species were also
38corroborated by the molecular phylogenetic analysis based on Cyt b gene sequences.
39
40Key word: Labeoninae, morphology, Cyt b gene, phylogenetic analysis
41
42
43
44
45Introduction
46The genus Garra Hamilton 1822 of the subfamily Labeoninae, family Cyprinidae is a
47group of freshwater fishes widely distributed in tropical and sub-tropical regions from
48South China to West Africa (Menon 1964). This genus comprises bottom dwelling
49fishes usually found in swift-flowing rivers or mountain streams, which is
50characterized by an elongate and subcylindrical body, a crenulated rostral fold on the
51upper lip and a mental adhesive disc on the ventral side of the head (Talwar &
52Jhingran 1991; Chen et al. 2009). As in a largely diversified speciose genus, species
53of Garra exhibit diverse morphological variations in oromandibular, snout and other
54associated structures, which have been used as the basis for species recognition within
55this group (Chu & Cui 1987; Nebeshwar & Vishwanath 2017). Although this genus
56has been established for almost two hundred years, there were still some newly
57recognized species in the latest years. For instance, Roni et al. (2017) described G.
58clavirostris from the Dilaima River, a tributary of the Brahmaputra River in India.
59Nebeshwar & Vishwanath (2017) described G. koladynensis and G. matensis from the
60Koladyne River drainage in India. Roni & Vishwanath (2018) described G.
61substrictorostris from the Leimatak River, a tributary of the Bark River in India. Sun
62et al. (2018) described G. surgifrons from the Daying River, a tributary of the upper
63Irrawaddy River in China. Deng et al. (2018) described G. dengba from the Lohit
64River, a tributary of the upper Brahmaputra River in China.
65 To date, there are 18 Garra species presently recognized from the Brahmaputra
66drainage. In the adjacent drainages (i.e. the Barak-Meghra River, the Kaladan River,
67the Irrawaddy River drainages and some small coastal rivers between), there are 30
68Garra species recognized. Based on the snout morphology, these 48 Garra species
69could be divided into 5 species groups suggested by Nebeshwar & Vishwanath
70(2017), viz., a smooth snout species group (12 species), a transverse lobe species
71group (4 species), a rostral flap species group (9 species), a rostral lobe species group
72(one species) and a proboscis species group (22 species). This again demonstrates the
73high diversity in this group.
74 In the recent years, an ichthyological survey from the lower Yarlung Tsangpo (the
75name of the upper Brahmaputra in China) drainage found two new species of Garra,
76which are described herein.
 77
78Materials and method
79Specimens were collected by electric-fishing. After euthanasia, a small piece of
80muscle tissue was dissected from the right side of back and preserved in 95% ethanol
81for molecular experiment. All specimens were fixed in 10% formalin and later
82transferred to 75% ethanol for long-term preservation. Measurements were conducted
83with a dial caliper by one person and recorded to 0.1 mm. All measurements were
84made point to point (never by projections) from the left side of the fish. Standard of
85counts, measurements and terminology follows Kullander & Fang (2004), while the
86terminology of the structures of snout and oromandibular follows Nebeshwar &
87Vishwanath (2017). Scales along the lateral line were counted from the first one just
88behind the pectoral girdle to the last one on the caudal fin base. Standard length (SL)
89was measured from the tip of the snout to the end of the hypural complex. The length
90of the caudal peduncle was measured from behind the base of the last anal-fin ray to
91the end of the hypural complex, at mid-height of the caudal-fin base. The last two
92branched rays articulating on a single pterygiophore in the dorsal and anal fins were
93counted as “1½”. Frequencies of meristic values are showed in parentheses, if more
94than one values were obtained; asterisks indicate the value for the holotype. All
95voucher specimens were deposited at the Museum of Aquatic Organisms at the
96Institute of Hydrobiology (IHB), Chinese Academy of Sciences, Wuhan, China.
97DNA extraction and PCR. Genomic DNA was extracted from ethanol-preserved
98muscle tissue using modified salt-extraction method following the procedure of Tang
99et al. (2008). The mtDNA Cyt b gene was amplified with primers GluF (5’–
100ACCACCGTTGTATTCAACTACAA–3’) and ThrR (5’–
101ACCTCCGATCTTCGGATTACAAGACCG–3’) (Doadrio et al. 2002).
102Amplifications were performed in a 30 μL reaction volume, which contains 3 μL of
10310 × PCR buffer, 30–50 ng of DNA template, 1 μL of each primer (each 10 μM), 1.5
104μL of dNTPs (each 2.5 mM), and 2.5 U of Taq DNA polymerase, then sterile water
105was added to reach the final volume. Reactions took place in the following program:
106an initial denaturation at 94°C for 4 min, followed by 35 cycles of denaturation at
10794°C for 45 s, annealing at 54–56°C for 45 s, extension at 72°C for 1 min, and a final
108extension at 72°C for 10 min. Amplified DNA fragments was purified and sequenced
109using the same primers by commercial sequencing companies.
110Molecular phylogenetic analysis. A total of 88 individuals of 40 Garra species and 2
111Labeo species were included in the molecular phylogenetic analysis. Labeo altivelis
112and Labeo horie were selected as the outgroup. Among them, 72 individuals were
113downloaded from the GenBank, 16 were newly determined by the present study.
114GenBank accession numbers are given in Table 1. Alignment of Cyt b sequences was
115performed with ClustalX (Thompson et al. 1997) and revised manually with
116SEAVIEW (Galtier et al. 1996). All the aligned sequences were translated into amino
117acid residues in MEGA 6 (Tamura et al. 2013) to test for sequence editing errors.
118Calculation of paired genetic divergences based on Kimura 2-parameter (K2P) model
119and standard error (S.E.) estimated by 1,000 bootstrap replicates were conducted in
120MEGA.
121 Phylogenetic relationships between these two new Garra species and their
122congeners were reconstructed using Bayesian inference (BI) and maximum likelihood
123(ML) methods. The best-fit nucleotide substitution model was selected in jModelTest
1242 based on the Akaike Information Criterion (AIC) (Darriba et al. 2012). BI analysis
125was carried out in MrBayes 3 (Huelsenbeck & Ronquist 2001), with the parameter nst
126= 6 and rates = gamma. In BI analysis, starting trees were random. Two independent
127analyses with four simultaneous Markov chain Monte-Carlo (MCMC) runs of
1284,000,000 generations were made sampling every 100 generations, with a total of
12940,001 trees. The first 10,000 trees were discarded as burn-in. The consensus tree and
130posterior probabilities of the phylogeny were obtained from the following 30,001
131trees. The ML analysis was conducted in RAxML 8 (Stamatakis 2014), using a
132general time-reversible nucleotide model (GTR) with gamma-distributed rate
133variation among sites (G) and invariable sites (I); nodal support values were estimated
134from 1,000 nonparametric bootstrap replicates.
135
136Results
137Garra motuoensis, new species (Figs. 1–2)
138Holotype. IHB 20161470, 162.5 mm SL; China: Tibet Autonomous Region: Motuo
139County: the Xigong River, a tributary flowing to the Yarlung Tsangpo River,
14029°16’44” N, 95°14’56” E, 680 m asl; collected by Zheng Gong, Jian Wang &
141Huaming Hu, October 2016.
142 Paratypes.; IHB 20161471, 1, 120.8 mm SL, April 2016; 20161472, 1, 154.1
143mm SL, June 2016; 20161473, 1, 154.4 mm SL, July 2016; 20171474–5, 2, 129.8–
144140.3 mm SL, November 2017; other data same as the holotype.
145 Diagnosis. Garra motuoensis, a member of the proboscis species group, is
146distinguished from its congeners by the following combination of characters: a
147prominent, quadrate and slightly bilobed proboscis covered with 6–20 small to
148middle-sized unicuspid tubercles, some middle-sized unicuspid tubercles on the
149transverse lobe and several small unicuspid tubercles on the lateral surface; a
150moderate posterior position of anus (distance between anus and anal-fin origin 36–
15146% of that between pelvic- and anal-fin origins); 36–37 lateral line scales, 12
152circumpeduncular scale rows and other morphometric features associated with body
153depth, caudal peduncle, eye, snout, and mental disc.
154 Description. Morphometric data are given in Table 2. Body elongate, cylindrical
155anteriorly and laterally compressed posteriorly. Head moderately large, somewhat
156convex in the interorbital space; longer than width and wider than height. Snout
157moderately rounded, the transverse lobe covered with some middle-sized prominent
158unicuspid tubercles and the lateral surface with several small unicuspid tubercles; the
159transverse lobe demarcated posteriorly by a deep transverse groove; proboscis
160prominent, quadrate and slightly bilobed, with 6–20 small to middle-sized, prominent
161and unicuspid tubercles arranged irregularly. More tubercles in larger individuals than
162in smaller ones. Eye moderately large, situated dorso-laterally behind middle of head.
163Barbels in two pairs; rostral barbel situated antero-laterally, length shorter than eye
164diameter; maxillary barbel shorter than rostral barbel. Rostral cap with crenulated
165margin and numerous tiny papillae, separated from upper jaw by a groove, rostral cap
166posteriorly continuous with lower lip. Edge of upper and lower jaw covered with a
167thin horny sheath. Mental disc large and elliptical, shorter than width; anterior margin
168forming a crescented, fleshy, bulged skin fold, densely covered by tiny papillae.
169Anteromedial fold separated from lower jaw by deep groove and posteriorly bordered
170by a shallow notch from the central callous pad, lateral and posterior margins of
171central callous pad free and papillate; lateral and posterior margins free, with densely
172arranged tiny papillae.
173 Dorsal fin with 3 simple and 8½ branched rays, distal margin slightly concave;
174first branched ray longest, nearly as long as head length; dorsal-fin origin closer to
175snout tip than to caudal-fin base. Pectoral fin with 1 simple and 13 (1) or 14 (5*)
176branched rays; fin length shorter than head length, tip not reaching pelvic-fin origin
177and dorsal-fin origin. Pelvic fin with 1 simple and 8 branched rays; fin length nearly
178as long as head length, tip reaching beyond anus; pelvic-fin origin closer to middle
179caudal-fin base than to snout tip. Anal fin with 3 simple and 5½ branched rays; tip not
180reaching to the base of caudal fin; anal-fin origin closer to caudal-fin base than to
181pelvic-fin origin. Caudal fin forked, upper lobe slightly shorter than lower lobe.
182 Lateral line complete, with 36 (2*) or 37 (4) scales. Transverse scale rows above
183lateral line 3½; between lateral line and pelvic-fin origin 2½ (5*) or 3 (1).
184Circumpeduncular scale rows 12. Predorsal scales 10 (2*) or 11 (4), smaller than
185flank scales. Chest and belly covered by scales, scales on chest smaller than on belly.
186A long axillary scale present at pelvic-fin base. Anus slightly closer to anal-fin origin
187than to pelvic-fin origin, separated from anal-fin origin by 5 scale rows, distance
188between anus and anal-fin origin 36–46% of that between pelvic- and anal-fin origins.
189 Coloration. In preserved specimens, head, dorsum and side dark gray; mouth,
190chest and belly faint yellow or slightly brown. Dorsal, pectoral, pelvic, anal and
191caudal fins gray, Pectoral fin darker gray than other fins; the interradial membranes
192covered with conspicuous melanins. Smaller individuals paler than larger ones.
193 Distribution. Known from the Xigong River, a tributary flowing to the lower
194Yarlung Tsangpo River in Southeast Tibet (Fig. 3).
195 Ecology. This new species was caught from swift-flowing waters with numerous
196rocks in the Xigong River, where water is very limpid (Fig. 4). Macroscopic visual
197examination of the gonads showed that its spawning period occurs in May when water
198temperature reaches 14 ℃. The eggs are yellow and demersal. It mainly feeds on the
199periphytic algae.
200 Etymology. Named for its locality, Motuo County in Southeast Tibet. An
201adjective.
202
203Garra yajiangensis, new species (Figs. 5–6)
204Holotype. IHB 20161577, 165.0 mm SL; China: Tibet Autonomous Region: Motuo
205County: lower Yarlung Tsangpo River, 29°19’22” N, 95°18’13” E, 708 m asl;
206collected by Zheng Gong, Jian Wang & Huaming Hu, October 2016.
207 Paratypes. IHB 20161578–92, 15, 125.8–175.1 mm SL; same data as the
208holotype.
209 Diagnosis. Garra yajiangensis, a member of the proboscis species group, is
210distinguished from its congeners by the following combination of characters: a
211quadrate and slightly bilobed proboscis with 2–7 middle-sized unicuspid tubercles,
212some small unicuspid tubercles on the transverse lobe and the lateral surface; a
213posterior position of anus (distance between anus and anal-fin origin 19–24% of that
214between pelvic- and anal-fin origins); 34–36 lateral line scales, 12 circumpeduncular
215scale rows and other morphometric features associated with body depth, caudal
216peduncle, eye, snout and mental disc.
217 Description. Morphometric data are given in Table 3. Body elongate, cylindrical
218anteriorly and compressed posteriorly. Head moderately large, with a slightly convex
219interorbital space; head longer than width and wider than height. Snout rounded, the
220transverse lobe and lateral surface covered with some small unicuspid tubercles; the
221transverse lobe demarcated posteriorly by a deep transverse groove; proboscis
222quadrate, moderately prominent and slightly bilobed, anterior region of proboscis with
2232–7 middle-sized unicuspid tubercles with two larger ones on each margin corner; the
224tubercles in smaller individuals not as conspicuous as in larger individuals. Eye
225moderately large, situated dorso-laterally, behind middle of head. Barbels in two
226pairs; rostral barbel situated antero-laterally, length slightly shorter than eye diameter;
227maxillary barbel shorter than rostral barbel. Rostral cap crenulated, with numerous
228tiny papillae, separated from upper jaw by a deep groove and posteriorly continuous
229with lower lip. Edge of upper and lower jaw covered with a thin horny sheath. Mental
230disc large, elliptical, shorter than width; anterior margin modified into a crescented,
231fleshy fold, densely covered by tiny papillae; anteromedial fold separated from lower
232jaw by a deep groove and posteriorly bordered a shallow notch from central callous;
233lateral and posterior margins free, with densely arranged tiny papillae.
234 Dorsal fin with 3 simple and 8½ branched rays, distal margin slightly concave,
235first branched ray longest, almost as long as head length; dorsal-fin origin closer to
236snout tip than to caudal-fin base. Pectoral fin with 1 simple and 13 (10) or 14 (6*)
237branched rays; fin length shorter than head length, tip not reaching pelvic-fin origin,
238almost reaching to the dorsal-fin origin vertically. Pelvic fin with 1 simple and 8
239branched rays, length shorter than head length, almost as long as pectoral fin, tip
240reaching beyond anus; pelvic-fin origin closer to caudal-fin origin than to snout tip.
241Anal fin with 3 simple and 5½ branched rays; tip almost reaching the base of caudal
242fin; anal-fin origin closer to caudal-fin base than to pelvic-fin origin. Caudal fin
243forked, upper lobe slightly shorter than lower lobe.
244 Lateral line complete, with 34 (3), 35 (10) or 36 (3*) scales. Transverse scale
245rows above lateral line 4 (8) or 4½ (8*); between lateral line and pelvic-fin origin 2½
246(3*) or 3 (13). Circumpeduncular scale rows 12. Predorsal scales 9 (7*), 10 (8) or 11
247(1); smaller than flank scales. Chest and belly covered by scales, scales on chest
248smaller than on belly. A long axillary scale present at pelvic-fin base. Anus closer to
249anal-fin origin than to pelvic-fin origin, separated from anal-fin origin by 3 scale
250rows, distance between anus and anal-fin origin 19–24% of that between pelvic- and
251anal-fin origins.
252 Coloration. In preserved specimens, head, dorsum and side of head pale brown
253or gray; mouth, chest and belly faint yellow or light brown. Dorsal, pectoral, pelvic
254and anal fins gray or grayish white, pectoral fin darker gray than pelvic and anal fins,
255a gray submarginal band on distal half of dorsal fin; lower lobe and the distal margin
256of upper lobe of caudal fin dark gray.
257 Distribution. Known only from the lower Yarlung Tsangpo River drainage in
258Motuo County, Southeast Tibet (Fig. 3).
259 Ecology. This new species was primarily caught in the mainstream of Yarlung
260Tsangpo, where it inhabits the swift-flowing waters with numerous rocks (Fig. 7). The
261spawning period occurs from March to May when water temperature is 12–17 ℃
262according to macroscopic visual examination of the gonads. The eggs are yellow and
263demersal. It mainly feeds on the periphytic algae.
264 Etymology. Named for its type locality, Yajiang (the Chinese abbreviation of the
265 Yarlung Tsangpo River). An adjective.
266
267Molecular phylogenetic analysis. After alignment, 1137 bps of Cyt b gene sequences
268belonging to 86 individuals of 40 Garra species and two Labeo species were used for
269analysis. Of all 1137 bps, 182 were variable sites and 151 were parsimony informative
270sites. Based on K2P model, paired genetic divergences between these two new species
271and their congeners are given in Table 4. The genetic divergences between G.
272motuoensis and its sampled congeners known from the Brahmaputra and the adjacent
273drainages range from 2.6% (vs. G. cf. gotyla A) to 19.8% (vs. G. poecilura); between
274G. yajiangensis and its congeners range from 6.3% (vs. G. cf. gotyla B) to 16.1% (vs.
275G. poecilura).
276 Phylogenetic trees yielded by two inference methods (BI and ML) showed
277identical topology for most parts, although some shallow nodes vary between both
278methods. Here only the Bayesian Inference tree is shown, with node support values
279displayed from the two inference methods (Fig. 8). The topology of the phylogenetic
280tree indicated that all sampled individuals of G. motuoensis grouped into a
281monophyletic linkage with high probabilities (0.99/100), which was sister to G. cf.
282gotyla A. Similarly, all sampled individuals of G. yajiangensis clustered into a
283monophyletic clade with high probabilities (1/99), which was the closest to G. cf.
284gotyla B. Both G. motuoensis and G. yajiangensis were independent from their sister
285taxon with high probabilities (1/100 & 0.9/66).
286
287Discussion
288Garra motuoensis and its related congeners. The morphology of the snout and the
289shape and distribution patterns of the tubercles on the proboscis are of taxonomic
290significance in distinguishing species of Garra (Nebeshwar & Vishwanath 2017).
291Based on the snout morphology, Nebeshwar & Vishwanath (2017) divided Garra into
2925 species groups. Since G. motuoensis and G. yajiangensis both have a prominent
293proboscis, the comparisons were conducted only with the members of a proboscis
294species group distributed in the Brahmaputra River and the adjacent drainages (Table
2952).
296 Arunachalam et al. (2013) once described 4 Garra species from the upper
297Brahmaputra drainages: G. nigricauda from the Siang River (Yarlung Tsangpo
298actually), G. minima, G. alticaputus and G. kimini from the tributaries of Ranga River.
299However, the original descriptions were obscure. Nebeshwar & Vishwanath (2017)
300also indicated that these 4 nominal species are very likely to be the synonyms of the
301already described species: G. nigricauda are very similar to G. arunachalensis, G.
302minima to G. quadratirostris, G. kimini and G. alticaputus to G. birostris. Given that
303the validities of these four species are in question, they were not added into the
304discussion herein.
305 Garra motuoensis can be distinguished from G. birostris, G. bispinosa, G. gotyla,
306G. kalpangi, G. koladynensis, G. parastenorhynchus, G. substrictorostris and G.
307surgifrons by having less circumpeduncular scale rows (12 vs. 16). It is further
308distinguished from these congeners by having a quadrate and slightly bilobed (vs.
309trilobed in G. koladynensis and G. surgifrons; vs. clubbed in G. substrictorostris)
310proboscis, unicuspid (vs. multicuspid in G. birostris, G. koladynensis, G.
311substrictorostris and G. surgifrons) tubercles on the proboscis and the transverse lobe,
31236–37 lateral line scales (vs. 33–34 in G. birostris, G. gotyla, G. koladynensis and G.
313substrictorostris; vs. 34 in G. bispinosa; vs. 32–33 in G. kalpangi; vs. 31–32 in G.
314parastenorhynchus; vs. 32–34 in G. surgifrons), a smaller eye (15–18% HL vs. 21–25
315in G. birostris; vs. 19–20 in G. bispinosa; vs. 23–28 in G. kalpangi; vs. 23–25 in G.
316surgifrons), a longer mental disc (42–51% HL vs. 33–40 in G. gotyla; vs. 33–38 in G.
317kalpangi; vs. 33–37 in G. parastenorhynchus; vs. 35–42 in G. surgifrons) and a more
318anterior position of anus (distance between anus and anal-fin origin 36–46% of that
319between pelvic- and anal-fin origins vs. 21–30 in G. birostris; vs. 25–30 in G.
320bispinosa; vs. 22–28 in G. gotyla; vs. 21–29 in G. koladynensis; vs. 22–31 in G.
321parastenorhynchus; vs. 18–30 in G. surgifrons).
322 Garra motuoensis is distinguished from G. clavirostris, G. nasuta, G. tamangi
323and G. trilobata by having a quadrate and slightly bilobed (vs. clubbed in G.
324clavirostris; vs. trilobed in G. nasuta, G. tamangi and G. trilobata) proboscis,
325unicuspid (vs. multicuspid) tubercles on the proboscis and the transverse lobe,
326absence (vs. presence in G. nasuta) of a distinct pit between nares, more lateral line
327scales (36–37 vs. 33–34 in G. clavirostris and G. tamangi; vs. 31–32 in G. trilobata),
328a longer caudal peduncle (16.8–20.3% SL vs. 10.1–14.6 in G. clavirostris; vs. 14.7–
32916.5 in G. tamangi) and a more anterior position of anus (distance between anus and
330anal-fin origin 36–46% of that between pelvic- and anal-fin origins vs. 15–24 in G.
331trilobata).
332 Garra motuoensis can be distinguished from other congeners by the presence (vs.
333absence in G. litanensis) scales on the chest, having 36–37 lateral line scales (vs. 35 in
334G. arunachalensis and G. qiaojiensis; vs. 32–34 in G. bimaculacauda and G.
335gravelyi; vs. 33 in G. cornigera; vs. 42–44 in G. dengba; vs. 32 in G. litanensis; vs.
33633–35 in G. longchuanensis), 8 pelvic branched fins (vs. 7 in G. rotundinasus), a
337shallower body (16.7–22.5% SL vs. 22.3–25.4 in G. arunachalensis), a longer head
338(21.2–23.8% SL vs. 18.4–20.6 in G. rotundinasus), a longer caudal peduncle (16.8–
33920.3% SL vs. 14.6–15.7 in G. bimaculacauda; vs. 14.2–15.9 in G. quadratirostris), a
340shorter snout (42–49% HL vs. 56–63 in G. arunachalensis; vs. 51–59 in G.
341quadratirostris), a smaller eye (15–18% HL vs. 17–23 in G. arunachalensis; vs. 19–
34222 in G. cornigera; vs. 22–28 in G. gravelyi; vs. 19–24 in G. quadratirostris), a
343narrower interorbit (47–49% in HL vs. 50–57 in G. longchuanensis; vs. 55 in G.
344qiaojiensis), a longer mental disc (42–51% HL vs. 32–42 in G. cornigera; vs. 34–36
345in G. litanensis) and a more anterior position of anus (distance between anus and anal-
346fin origin 36–46% of that between pelvic- and anal-fin origins vs. 19–25 in G.
347arunachalensis; vs. 23–25 in G. bimaculacauda; vs. vs. 48–60 in G. dengba; vs. 21–
34829 in G. gravelyi; vs. 26 in G. qiaojiensis; vs. 32–37 in G . rotundinasus).
349 Garra motuoensis can be distinguished from another new species, Garra
350yajiangensis by having some prominent middle-sized (vs. small-sized) tubercles on
351the transverse lobe, more lateral line scales (36–37 vs. 34–36), more preanal scale
352rows (5 vs. 3), less transverse scale rows above the lateral line (3½ vs. 4 or 4½) and a
353more anterior position of anus (distance between anus and anal-fin origin 36–46% of
354that between pelvic- and anal-fin origins vs. 19–24).
355Garra yajiangensis and its related congeners. Garra yajiangensis can be
356distinguished from G. birostris, G. bispinosa, G. gotyla, G. kalpangi, G. koladynensis,
357G. parastenorhynchus, G. substrictorostris and G. surgifrons by having less
358circumpeduncular scale rows (12 vs. 16). It is further distinguished from these
359congeners by having a quadrate and slightly bilobed (vs. trilobed in G. koladynensis
360and G. surgifrons; vs. clubbed in G. substrictorostris), unicuspid (vs. multicuspid in
361G. birostris, G. koladynensis, G. substrictorostris and G. surgifrons) tubercles on the
362proboscis and the transverse lobe, 34–36 lateral line scales (vs. 32–33 in G. kalpangi;
363vs. 31–32 in G. parastenorhynchus; vs. 32–34 in G. surgifrons), a shallower body
364(17.4–19.5% SL vs. 20.8–24.9 in G. gotyla; vs. 22.0–26.8 in G. koladynensis; vs.
36520.2–22.0 in G. parastenorhynchus; vs. 22.0–26.8 in G. substrictorostris), a slender
366caudal peduncle (10.4–11.5% SL vs. 13.0–15.7 in G. gotyla), a smaller eye (13–18%
367HL vs. 21–25 in G. birostris; vs. 23–27 in G. kalpangi; vs. 23–25 in G. surgifrons), a
368longer mental disc (49–58% HL vs. 36–42 in G. birostris; vs. 38–44 in G. bispinosa;
369vs. 35–38 in G. kalpangi; vs. 37–43 in G. koladynensis; vs. 33–37 in G.
370parastenorhynchus; vs. 35–42 in G. surgifrons) and a more posterior position of anus
371(distance between anus and anal-fin origin 19–24% of that between pelvic- and anal-
372fin origins vs. 25–30 in G. bispinosa).
373 Garra yajiangensis is distinguished from G. clavirostris, G. nasuta, G. tamangi
374and G. trilobata by having a quadrate and slightly bilobed (vs. clubbed in G.
375clavirostris; vs. trilobed in G. nasuta, G. tamangi and G. trilobata) proboscis,
376unicuspid (vs. multicuspid) tubercles on the proboscis and the transverse lobe,
377absence (vs. presence in G. nasuta) of a distinct pit between nares, more lateral line
378scales (vs. 31–32 in G. trilobata), a shallower body (17.4–19.5% SL vs. 19.4–24.0 in
379G. clavirostris; vs. 20.7–22.3 in G. tamangi; vs. 22.0–24.8 in G. trilobata), a longer
380caudal peduncle (15.7–19.2% SL vs. 10.1–14.6 in G. clavirostris), a longer mental
381disc (length 49–58% HL vs. 39–41 in G. tamangi) and a smaller eye (13–19% HL vs.
38218–22 in G. trilobata).
383 Garra yajiangensis is distinguished from G. cornigera, G. dengba, G.
384longchuanensis, G. qiaojiensis, G. quadratirostris and G. rotundinasus by having a
385more posterior position of anus (distance between anus and anal-fin origin 19–24% of
386that between pelvic- and anal-fin origins vs. 28–41, 48–60, 27–39, 26, 37–44 and 32–
38737). It can be further distinguished from these congeners by having 34–36 lateral line
388scales (vs. 33 in G. cornigera; vs. 42–44 in G. dengba; vs. 37 in G. quadratirostris),
3899–11 predorsal scales (vs. 14–16 in G. dengba), 8 pelvic branched fins (vs. 7 in G.
390rotundinasus), a shallower body (17.4–19.5% SL vs. 19.2–24.7 in G.
391longchuanensis), a narrower interorbit (42–46% HL vs. 50–57 in G. longchuanensis;
392vs. 55 in G. qiaojiensis), a longer mental disc (49–58% HL vs. 34–42 in G. cornigera;
393vs. 43–48 in G. quadratirostris).
394 In addition, G. yajiangensis is distinguished from other congeners by having 2–7
395middle-sized (vs. two large-sized on anterolateral marginal corner and several small-
396sized on between and lateral margin in G. arunachalensis) tubercles on the proboscis
397(see Fig. 3 of Nebeshwar & Vishwanath 2013), 34–36 lateral line scales (vs. 32–34 in
398G. bimaculacauda and G. gravelyi; vs. 32 in G. litanensis), a shallower body (17.4–
39919.5% SL vs. 22.3–25.4 in G. arunachalensis; vs. 21.1–25.8 in G. gravelyi), a longer
400caudal peduncle (15.7–19.2% HL vs. 14.6–15.7 in G. bimaculacauda), a shorter snout
401(43–49% HL vs. 56–63 in G. arunachalensis), a smaller eye (13–18% HL vs. 17–23
402in G. arunachalensis; vs. 17–20 in G. bimaculacauda; vs. 22–28 in G. gravelyi) and a
403longer mental disc (length 49–58% HL vs. 40–44 in G. bimaculacauda; vs. 34–36 in
404G. litanensis).
405Evidence from MtDNA sequences. The validities of G. motuoensis and G.
406yajiangensis can be also corroborated by the molecular phylogenetic analysis based
407on Cyt b gene sequences. The result revealed that G. motuoensis clustered with G. cf.
408gotyla A (GenBank accession number: JX074256) forming a sister relationship with
409the genetic divergence of 2.6%, while G. yajiangensis clustered with G. cf. gotyla B
410(GenBank accession numbers: KF574708–11) forming a sister relationship with the
411genetic divergence of 6.3%. It is worth mentioning that the taxon records of G. cf.
412gotyla A and B in GenBank were both designated to G. gotyla. That is because the
413original description of G. gotyla was unspecific and some allied species were
414misidentified. In view of this fact, Nebeshwar & Vishwanath (2013) designated a
415neotype for G. gotyla and described three new species based on the examinations of
416some materials from the Himalayan foothills. In present study, the identities of G. cf.
417gotyla A and B were unsure. Even thus, the validities of G. motuoensis and G.
418yajiangensis could still be affirmed by the significant genetic divergences and the
419highly supportive monophyly from their congeners.
420
421Comparative Materials.
422 Garra bispinosa: IHB 78IV1573, holotype, 121.0 mm SL; IHB 78IV1462,
42378IV1525, 78IV1535–6, 78IV1547, paratypes, 5, 11.32–129.1 mm SL; China:
424Yunnan prov.: Yingjiang County: Daying Jiang, a tributary of the upper Irrawaddy
425River.
426 Garra cf. kempi: IHB 20161514–22, 20161525–30, 15, 46.9–104.9 mm SL;
427China: Tibet Autonomous Region: Motuo County: the Haguo River, a tributary of the
428lower Yarlung Tsangpo River.
429 Garra dengba: IHB 2016032616, holotype, 108.6 mm SL; IHB 2016032611–5,
4302016032617–22, paratypes, 11, 44.9–97.1 mm SL; China: Tibet Autonomous Region:
431Chayu County: the Lohit River, a tributary of the upper Brahmaputra River.
432 Garra longchuanensis: IHB 201306027, holotype, 145.2 mm SL; IHB
433201305991, 201305993, 201305996–7, 201306018, 201306022–4, 201306026,
434paratypes, 9, 130.5–161.2 mm SL; China: Yunnan prov.: Tengchong County:
435Longchuan River, a tributary of the upper Irrawaddy River.
436 Garra qiaojiensis: IHB 60542, holotype, 162.5 mm SL; China: Yunnan prov.:
437Yingjiang County: Daying River, a tributary of the upper Irrawaddy River.
438 Garra rotundinasus: IHB 78IV1162, holotype, 161.4 mm SL; China: Yunnan
439prov.: Tengchong County: Daying Jiang, a tributary of the upper Irrawaddy River.
440IHB 78IV1163, 90IV0137–8, paratypes, 3, 82.5–189.2 mm SL; China: Yunnan prov.:
441Yingjiang County: Daying River, a tributary of the upper Irrawaddy River.
442 Comparative data derived from published literatures are as follows: G.
443arunachalensis, G. birostris, G. gotyla and G. quadratirostris from Nebeshwar &
444Vishwanath (2013), G. bimaculacauda and G. parastenorhynchus from Thoni et al.
445(2016), G. clavirostris from Roni et al. (2017), G. cornigera and G. trilobata from
446Shangningam & Vishwanath (2015), G. gravelyi from Menon (1964), G. kalpangi
447from Nebeshwar et al. (2012), G. koladynensis from Nebeshwar & Vishwanath
448(2017), G. litanensis from Nebeshwar & Vishwanath (2017) and Roni & Vishwanath
449(2018), G. nasuta from Talwar & Jhingran (1991), G. substrictorostris from Roni &
450Vishwanath (2018), G. surgifrons from Sun et al. (2018), G. tamangi from
451Gurumayum & Kosygin (2016).
452
453Garra species from the Brahmaputra River and the adjacent drainages.
454Eighteen Garra species from the Brahmaputra River drainage. G. annandalei
455Hora 1921, G. arunachalensis Nebeshwar &Vishwanath 2013, G. arupi Nebeshwar,
456Vishwanath & Das 2009, G. bimaculacauda Thoni, Gurung & Mayden 2016, G.
457birostris Nebeshwar & Vishwanath 2013, G. clavirostris Roni, Sarbojit & Vishwanath
4582017, G. chaudhurii Hora 1921, G. dengba Deng, Cao & Zhang 2018, G. gotyla
459(Gray 1830), G. kalpangi Nebeshwar, Bagra & Das 2012, G. kempi Hora 1921, G.
460lissorhynchus (M’Clelland 1842), G. magnidiscus Tamang 2013, G. nasuta
461(M’Clelland 1838), G. parastenorhynchus Thoni, Gurung & Mayden 2016, G.
462quadratirostris Nebeshwar & Vishwanath 2013, G. rupicola (M’Clelland 1839) and
463G. tamangi Gurumayum & Kosygin 2016.
464Thirty Garra species from the adjacent drainages. G. abhoyai Hora 1921, G.
465bispinosa Zhang 2002, G. chakpiensis Nebeshwar & Vishwanath 2015, G. compressa
466Kosygin & Vishwanath 1998, G. cornigera Shangningam & Vishwanath 2015, G.
467dulongensis (Chen, Pan, Xiao & Yang 2012), G. elongata Vishwanath & Kosygin
4682000, G. flavatra Kullander & Fang 2004, G. gravelyi (Annandale, 1919), G.
469koladynensis Nebeshwar & Vishwanath 2017, G. litanensis Vishwanath 1993, G.
470longchuanensis Yu, Wang, Xiong & He 2016, G. manipurensis Vishwanath &
471Sarojnalini 1988, G. matensis Nebeshwar & Vishwanath 2017, G. naganensis Hora
4721921, G. nambulica Vishwanath & Joyshree 2005, G. namyaensis Shangningam &
473Vishwanath 2012, G. nigricollis Kullander & Fang 2004, G. paralissorhynchus
474Vishwanath & Shanta Devi 2005, G. poecilura Kullander & Fang 2004, G.
475propulvinus Kullander & Fang 2004, G. qiaojiensis Wu & Yao 1977, G. rakhinica
476Kullander & Fang 2004, G. rotundinasus Zhang 2006, G. spilota Kullander & Fang
4772004, G. substrictorostris Roni & Vishwanath 2018, G. surgifrons Sun, Li, Zhou & Li
4782018, G. tengchongensis Zhang & Chen 2002, G. trilobata Shangningam &
479Vishwanath 2015 and G. ukhrulensis Nebeshwar & Vishwanath 2015.
480Five groups based on the snout morphology.
481(1) a smooth snout group: G. abhoyai, G. annandalei, G. chakpiensis, G. chaudhurii,
482 G. compressa, G. dulongensis, G. naganensis, G. nambulica, G. rupicola, G.
483 spilota, G. tengchongensis, G. ukhrulensis, a total of 12 species;
484(2) a transverse lobe species group: G. arupi, G. elongata, G. kempi and G.
485 magnidiscus, a total of 4 species;
486(3) a rostral flap species group: G. flavatra, G. lissorhynchus, G. matensis, G.
487 namyaensis, G. nigricollis, G. paralissorhynchus, G. poecilura, G. propulvinus
488 and G. rakhinica, a total of 9 species;
489(4) a rostral lobe species group: G. manipurensis, one species;
490(5) a proboscis species group: G. arunachalensis, G. bimaculacauda, G. birostris, G.
491 bispinosa, G. clavirostris, G. cornigera, G. dengba, G. gotyla, G. gravelyi, G.
492 kalpangi, G. koladynensis, G. litanensis, G. longchuanensis, G. nasuta, G.
493 parastenorhynchus, G. qiaojiensis, G. quadratirostris, G. rotundinasus, G.
494 substrictorostris, G. surgifrons, G. tamangi and G. trilobata, a total of 22
495 species.
496
497Acknowledgements
498We are grateful to Huaming Hu, Mingzheng Li, Lin Chen and other colleagues for
499collecting the specimens. Many thanks go to Tingyu Jian and other locals of Motuo
500County for their help in the field. We are indebted to Fubin Zhang and Wenjing Li for
501their comments on this manuscript. We also thank many researchers for giving access
502to referenced literature materials. This project was supported by a grant from
503Powerchina Chengdu Engineering Corporation Limited and the National Nature
504Science Foundation of China (Grant No. 31400359).
505
506Literature cited
507Arunachalam, M., Nandagopal, S. & Mayden, R.L. (2013) Morphological diagnoses
508 of Garra (Cypriniformes: Cyprinidae) from northeastern India with four new
509 species description from Brahmaputra River. Journal of Fisheries and
510 Aquaculture, 4 (3), 121–138.
511Chen, Z.M., Zhao, S. & Yang, J.X. (2009) A new species of the genus Garra from
512 Nujiang River Basin, Yunnan, China (Teleostei: Cyprinidae). Zoological
513 Research, 30 (4), 438–444.
514 https://doi.org/10.3724/sp.j.1141.2009.04438
515Chu, X.L. & Cui, G.H. (1987) Taxonomic revision of Chinese cyprinid fishes of the
516 genus Garra Hamilton. Acta Zootaxonomica Sinica, 12 (1), 93–100. [In Chinese,
517 English summary].
518Darriba, D., Taboada G.L., Doallo, R. & Posada, D. (2012) jModelTest 2: more
519 models, new heuristics and parallel computing. Nature Methods, 9 (8), 772.
520 https://doi.org/10.1038/nmeth.2109
521Deng, S.Q., Cao, L. & Zhang, E. (2018) Garra dengba, a new species of cyprinid fish
522 (Pisces: Teleostei) from eastern Tibet, China. Zootaxa, in press.
523Doadrio, I., Carmona, J.A. & Machordom, A. (2002) Haplotype diversity and
524 phylogenetic relationships among the Iberian Barbels (Barbus, Cyprinidae)
525 reveal two evolutionary lineages. Journal of Heredity, 93 (2), 140–147.
526 https://doi.org/10.1093/jhered/93.2.140
527Galtier, N., Gouy, M. & Gautier, C. (1996) SEAVIEW and PHYLO–WIN: two
528 graphic tools for sequence alignment and molecular phylogeny. Computer
529 Applications in the Biosciences, 12 (6), 543–548.
530 https://doi.org/10.1093/bioinformatics/12.6.543
531Gurumayum, S.D. & Kosygin, L. (2016) Garra tamangi, a new species of cyprinid
532 fish (Teleostei: Cypriniformes) from Arunachal Pradesh, northeastern India.
533 Species, 17 (55): 84–93.
534Huelsenbeck, J.P. & Ronquist, F. (2001) MrBayes: Bayesian inference of phylogenetic
535 trees. Bioinformatics, 17 (8), 754–755.
536 https://doi.org/10.1093/bioinformatics/17.8.754
537Kullander, S.O. & Fang, F. (2004) Seven new species of Garra (Cyprinidae:
538 Cyprininae) from Rakhine Yoma, southern Myanmar. Ichthyological Exploration
539 of Freshwaters, 15 (3), 257–278.
540Menon, A.G.K. (1964) Monograph of the cyprinid fishes of the genus Garra
541 Hamilton. Memoirs of the Indian Museum, 14 (4), 173-260.
542Nebeshwar, K., Bagra, K. & Das, D.N. (2012) Garra kalpangi, a new cyprinid fish
543 species (Pisces: Teleostei) from upper Brahmaputra basin in Arunachal Pradesh,
544 India. Journal of Threatened Taxa, 4 (2), 2353–2362.
545 https://doi.org/10.11609/jott.o1703.2353-62
546Nebeshwar, K. & Vishwanath, W. (2013) Three new species of Garra (Pisces:
547 Cyprinidae) from north-eastern India and redescription of G. gotyla.
548 Ichthyological Exploration of Freshwaters, 24 (2), 97–120.
549Roni, N., Sarbojit, T. & Vishwanath, W. (2017) Garra clavirostris, a new cyprinid fish
550 (Teleostei: Cyprinidae: Labeoninae) from the Brahmaputra drainage, India.
551 Zootaxa, 4244 (3): 367–376.
552 https://doi.org/10.11646/zootaxa.4244.3.5
553Roni, N. & Vishwanath, W. (2017) A new species of the genus Garra (Teleostei:
554 Cyprinidae) from the Barak River drainage, Manipur, India. Zootaxa, 4374 (2):
555 263–272.
556 https://doi.org/10.11646/zootaxa.4374.2.6
557Shangningam, B.D. & Vishwanath, W. (2015) Two new species of Garra from the
558 Chindwin basin, India (Teleostei: Cyprinidae). Ichthyolological Exploration of
559 Freshwaters, 26 (3), 263–272.
560Stamatakis, A. (2014) RAxML Version 8: a tool for phylogenetic analysis and post-
561 analysis of large phylogenies. Bioinformatics, 30 (9), 1312–1313.
562 https://doi.org/10.1093/bioinformatics/btu033
563Sun, C., Li, X., Zhou, W. & Li, F. (2018) A review of Garra (Teleostei:
564 Cypriniformes) from two rivers in West Yunnan, China with description of a new
565 species. Zootaxa, 4378 (1), 049–070.
566 https://doi.org/10.11646/zootaxa.4378.1.3
567Talwar, P.K. & Jhingran, A. (1991) Inland fishes of India and adjacent Countries.
568 Oxford & IBH Publishing Co., New Delhi, 541 pp.
569Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013) MEGA6:
570 molecular evolutionary genetics analysis version 6.0. Molecular Biology and
571 Evolution, 30 (12), 2725–2729.
572 https://doi.org/10.1093/molbev/mst197
573Tang, Q.Y., Freyhof, J., Xiong, B.X. & Liu, H.Z. (2008) Multiple invasions of Europe
574 by East Asian cobitid loaches (Teleostei: Cobitidae). Hydrobiologia, 605 (1), 17–
575 28.
576 https://doi.org/10.1007/s10750-008-9296-1
577Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. & Higgins, D.J. (1997)
578 The Clustal X windows interface: flexible strategies for multiple sequences
579 alignment aided by quality analysis tools. Nucleic Acids Research, 25 (25),
580 4876–4882.
581 https://doi.org/10.1093/nar/25.24.4876
582Thoni, R.J., Gurung, D.B. & Mayden, R.L. (2016) A review of the genus Garra
583 Hamilton 1822 of Bhutan, including the descriptions of two new species and
584 three additional records (Cypriniformes: Cyprinidae). Zootaxa 4169 (1): 115–
585 132.
586 http://doi.org/10.11646/zootaxa.4169.1.5
587Yu, Q., Wang, X.Z., Xiong, H. & He, S.P. (2016) Garra longchuanensis, a new
588 cyprinid (Teleostei: Cypriniformes) from southern China. Zootaxa, 4126 (2),
589 295–300.
590 https://doi.org/10.11646/zootaxa.4126.2.10
591Zhang, E. (2005) Garra bispinosa, a new species of cyprinid fish (Teleostei:
592 Cypriniformes) from Yunnan, Southwest China. Raffles Bulletin of Zoology, 13,
593 9–15.
594Zhang, E. (2006) Garra rotundinasus, a new species of cyprinid fish (Pisces:
595 Teleostei) from the upper Irrawaddy River basin, China. Raffles Bulletin of
596 Zoology, 54, 447–453.
597
598
599
600FIGURE 1. Garra motuoensis, holotype, IHB 20161470, 162.5 mm SL; China:
601Tibet: Xigong River, flowing to the lower Yarlung Tsangpo River.
602FIGURE 2. Garra motuoensis, holotype, IHB 20161470, 162.5 mm SL; China:
603Tibet: Xigong River, flowing to the lower Yarlung Tsangpo River; dorsal and ventral
604views of head.
605FIGURE 3. Map showing the sampling sites of Garra motuoensis (▲) and Garra
606yajiangensis (★).
607FIGURE 4. Habitat of Garra motuoensis in the Xigong River.
608FIGURE 5. Garra yajiangensis, holotype, IHB 20161577, 165.0 mm SL; China:
609Tibet: lower Yarlung Tsangpo River.
610FIGURE 6. Garra yajiangensis, holotype, IHB 20161577, 165.0 mm SL; China:
611Tibet: lower Yarlung Tsangpo River; dorsal and ventral views of head.
612FIGURE 7. Habitat of Garra yajiangensis in the lower Yarlung Tsangpo River.
613FIGURE 8. Phylogenetic relationships of G. motuoensis, G. yajiangensis and other
61438 Garra species using Bayesian Inference based on Cyt b sequences. Numbers on
615nodes before and after slash (/) represent posterior probabilities in BI tree and
616bootstrap values in ML tree, respectively (above 0.5/50 are shown). G. motuoensis
617and G. yajiangensis are labeled with black rectangles.
618
619
620
621TABLE 1. GenBank accession numbers for each individual included in the molecular
622analysis.

Taxon Accession No. Taxon Accession No.

Garra barreimiae EU000504 Garra motuoensis MG490162*

Garra barreimiae EU000505 Garra motuoensis MG490163*

Garra bicornuta JX074238 Garra mullya JX074237

Garra bispinosa JQ864594 Garra mullya JX293010

Garra bourreti JQ864580 Garra mullya JX293011

Garra ceylonensis JX074252 Garra mullya JF793593

Garra ceylonensis JF793592 Garra nasuta JX074295

Garra cf. annandalei JX074253 Garra orientalis JQ864581

Garra cf. gotyla A JX074256 Garra orientalis JQ864582

Garra cf. gotyla B KF574708 Garra orientalis KX983935

Garra cf. gotyla B KF574709 Garra orientalis KR698391

Garra cf. gotyla B KF574710 Garra orientalis KR698392

Garra cf. gotyla B KF574711 Garra ornata JX074279

Garra cf. kempi MG490148* Garra poecilura NC031628

Garra cf. kempi MG490149* Garra poecilura AP011411

Garra cf. kempi MG490150* Garra qiaojiensis JQ864583

Garra cf. kempi MG490151* Garra qiaojiensis KF727438

Garra congoensis JX074254 Garra qiaojiensis NC028403

Garra congoensis AP011205 Garra regressus FJ196828

Garra congoensis NC031535 Garra rotundinasus JQ864595

Garra cyrano JX074291 Garra rufa NC022941

Garra dembecha FJ196826 Garra rufa AF180857

Garra dengba MG490152* Garra rufa AF180858

Garra dengba MG490153* Garra rufa AP011197

Garra dengba MG490154* Garra salweenica JQ864593

Garra dengba MG490155* Garra salweenica NC033389

Garra dulongensis JQ864590 Garra salweenica KF752478

 Garra flavatra NC022953 Garra sp. KX983936

Garra flavatra AP011410 Garra sp. KX983937

Garra fuliginosa JX074255 Garra spilota NC022944

Garra kempi JX074243 Garra spilota AP011327

Garra lamta JX074239 Garra stenorhynchus JX293008

Garra lamta JX074240 Garra stenorhynchus JX293009

Garra lamta JX074241 Garra tana HQ235750

Garra lissorhynchus JX074242 Garra tana FJ196827

Garra longchuanensis KT959345 Garra tengchongensis JQ864586

Garra longchuanensis KT959346 Garra tengchongensis GU086566

Garra longchuanensis KT959347 Garra yajiangensis MG490156*

Garra longchuanensis KT959359 Garra yajiangensis MG490157*

Garra makiensis JX097082 Garra yajiangensis MG490158*

Garra mirofrontis JQ864584 Garra yajiangensis MG490159*

Garra mirofrontis GU086565 Garra waterloti JX074289

Garra motuoensis MG490160* Labeo altivelis JX074294

Garra motuoensis MG490161* Labeo horie JX074288

623The asterisks (*) represent the sequences determined in the present study.
624
625
626
627Table 2. Morphometric data of Garra motuoensis (holotype: IHB 20161470;
628paratypes: IHB 20161471–3, 20171474–5, n = 5).

Holotype and paratypes

holotype
Range Mean SD

Standard length (SL, mm) 162.5 118.9–162.5 142.0 15.8

In percent of SL

Body depth 17.6 16.7–22.5 19.0 2.5

Head length 21.2 21.2–23.8 22.4 0.9

Head height 13.4 13.4–15.1 14.1 0.7

Head width 17.3 16.0–17.6 17.1 0.6

Dorsal-fin length 23.3 22.6–24.4 23.4 0.6

Pectoral-fin length 20.0 19.6–21.6 20.7 0.9

Pelvic-fin length 19.0 19.0–21.0 19.8 0.8

Anal-fin length 18.5 18.5–20.2 19.3 0.6

Caudal-peduncle length 16.8 16.8–20.3 18.6 1.2

Caudal-peduncle depth 11.3 11.0–12.9 11.8 0.6

Predorsal length 43.4 43.4–46.8 44.5 1.2

Prepectoral length 19.3 18.7–20.2 19.4 0.6

Prepelvic length 48.6 48.6–52.0 50.6 1.1

Preanal length 75.3 72.7–75.4 74.1 1.1

In percent of HL

Snout length 48 42–49 46.0 2.9

Eye diameter 16 15–18 16.7 1.1

Interorbital space 49 47–49 47.9 0.8

Disc length 48 42–51 46.6 3.7

Disc width 69 60–75 67.6 5.1

Callous pad length 33 28–34 32.2 2.3

Callous pad width 48 42–48 44.7 2.5

In percent of distance between pelvic- and anal-fin
origin
Distance between anus and anal-fin origin 37 36–46 40.9 3.8
629
630
631
634Table 3. Morphometric data of Garra yajiangensis (holotype: IHB 20161577;
635paratypes: IHB 20161578–92, n = 15).

Holotype and paratypes

holotype
Range Mean SD

Standard length (SL, mm) 165.0 125.8–175.1 151.4 16.3

In percent of SL

Body depth 18.6 17.4–19.5 18.4 0.6

Head length 23.8 22.2–25.4 23.6 0.8

Head height 14.0 13.9–15.5 14.4 0.4

Head width 16.9 15.8–22.4 17.7 1.5

Dorsal-fin length 22.8 22.1–25.7 23.6 0.8

Pectoral-fin length 21.7 21.3–24.2 22.8 0.9

Pelvic-fin length 21.8 20.0–23.9 21.9 1.1

Anal-fin length 19.9 18.6–21.4 20.0 0.8

Caudal-peduncle length 18.6 15.7–19.2 17.4 0.9

Caudal-peduncle depth 10.5 10.4–11.5 11.0 0.3

Predorsal length 43.2 43.2–47.5 44.9 1.1

Prepectoral length 21.7 19.1–23.0 21.4 1.0

Prepelvic length 49.0 49.0–52.4 50.6 1.2

Preanal length 73.4 73.3–77.4 75.6 1.4

In percent of HL

Snout length 47 43–49 46.4 1.4

Eye diameter 13 13–18 15.3 1.3

Interorbital space 42 42–46 44.0 1.2

Disc length 52 49–58 54.4 2.3

Disc width 67 66–77 70.3. 3.0

Callous pad length 35 33–40 37.0 2.0

Callous pad width 45 44–50 47.1 2.0

In percent of distance between pelvic- and anal-fin
origin
Distance between anus and anal-fin origin 20 19–24 22.0 1.5
636
 637
638Table 4. The K2P genetic divergences (in %) and S.E (in %, parenthetical) between
639G. motuoensis, G. yajiangensis and sampled congeners known from the Brahmaputra
640and the adjacent drainages.
G. motuoensis G. yajiangensis

G. motuoensis – 10.1 (1.0)

G. yajiangensis 10.1 (1.0) –

G. bispinosa 6.0 (0.8) 10.8 (1.1)

G. cf. annandalei 12.4 (1.1) 10.6 (1.0)

G. cf. gotyla A 2.6 (0.5) 10.2 (1.0)

G. cf. gotyla B 9.8 (1.0) 6.3 (0.7)

G. cf. kempi 15.3 (1.2) 13.1 (1.1)

G. dengba 14.0 (1.3) 11.7 (1.0)

G. dulongensis 12.7 (1.2) 11.1 (1.0)

G. flavatra 16.6 (1.4) 14.7 (1.2)

G. kempi 12.2 (1.2) 10.9 (1.0)

G. lissorhynchus 16.0 (1.5) 15.0 (1.3)

G. longchuanensis 9.5 (1.1) 6.8 (0.7)

G. nasuta 11.5 (1.2) 11.1 (1.0)

G. poecilura 19.8 (1.5) 16.1 (1.4)

G. qiaojiensis 7.3 (0.8) 9.5 (0.9)

G. rotundinasus 9.3 (0.9) 7.4 (0.8)

G. spilota 12.6 (1.2) 12.1 (1.1)

G. tengchongensis 13.4 (1.3) 12.8 (1.1)

641
642
643Table 5. Principal diagnostic characters for Garra motuoensis, Garra yajiangensis
644and their 22 congeners with a proboscis.
Pattern of Lateral line Circumpeduncul
Shape of proboscis Anus position
tubercles scales ar scale rows
quadrate, slightly
G. motuoensis unicuspid 34–36 12 36–46
bilobed
quadrate, slightly
G. yajiangensis unicuspid 36–37 12 19–24
bilobed
G. arunachalensis quadrate, bilobed unicuspid 35 12 19–25
G. bimaculacauda quadrate, uni-lobed unicuspid 32–34 12 23–25

G. birostris quadrate, bilobed multicuspid 33–34 16 21–30

G. bispinosa quadrate, bilobed unicuspid 34–35 16 25–30

G. clavirostris clubbed multicuspid 33–34 n/a 19–25

G. cornigera bilobed unicuspid 33 14 28–41

G. dengba quadrate, uni-lobed unicuspid 40–42 12 or 14 48–60

G. gotyla quadrate, bilobed unicuspid 33–34 16 20–24

G. gravelyi quadrate, uni-lobed unicuspid 32–34 n/a 21–29

G. kalpangi quadrate, uni-lobed unicuspid 32–33 16 20–28

uni- or
G. koladynensis trilobed 33–34 16 21–29
multicuspid
G. litanensis quadrate, uni-lobed n/a 32 n/a n/a

G. longchuanensis quadrate, uni-lobed unicuspid 33–35 12 27–39

G. nasuta trilobed multicuspid n/a n/a n/a

G. parastenorhynchus clubbed unicuspid 31–32 16 22–31

G. qiaojiensis quadrate, uni-lobed unicuspid 34 12 26

G. quadratirostris quadrate, uni-lobed unicuspid 37 12 28–37

G. rotundinasus quadrate, uni-lobed unicuspid 33–34 12 32–37

G. substrictorostris clubbed multicuspid 33–34 16 15–27

G. surgifrons trilobed unicuspid 32–34 16 18–30

uni- or
G. tamangi triangular, trilobed 33–34 n/a n/a
multicuspid
uni- or
G. trilobata trilobed 31–32 14 15–24
multicuspid
645The anus position indicates the percentage of distance between anus and anal-fin
646origin in that between pelvic- and anal-fin origins.