Veterinary Immunology and Immunopathology 153 (2013) 217–226

Contents lists available at SciVerse ScienceDirect

Veterinary Immunology and Immunopathology

journal homepage: www.elsevier.com/locate/vetimm

Research paper

Cellular and humoral immunity in chronic equine laminitis

Samantha M. Steelman a,∗ , Daisy Johnson a , Bettina Wagner b ,
Ashley M. Stokes c , Bhanu P. Chowdhary a
a
Veterinary Integrative Biosciences, College of Veterinary Medicine & Biomedical Sciences, Texas A&M University, College Station, TX
77843-4458, United States
b
Department of Population Medicine and Diagnostics Sciences, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853,
United States
c
Department of Human Nutrition, Food, and Animal Sciences, University of Hawaii, Honolulu, HI 96848, United States

a r t i c l e i n f o a b s t r a c t

Article history: Chronic equine laminitis causes persistent pain and lameness in affected animals and
Received 25 November 2012 often necessitates euthanasia when pain management strategies become ineffective. Pub-
Received in revised form 1 March 2013
lished studies as well as anecdotal reports suggest that this chronic inflammatory disease
Accepted 4 March 2013
is associated with systemic alterations in immune responsiveness, perhaps involving an
autoimmune component. We investigated this broad hypothesis by measuring a variety of
Keywords:
immune indicators in healthy control horses (CON) and horses with chronic laminitis (LMN).
Neutrophil
Cytokine We found that white blood cells from LMN horses produced more IFN␥ than did cells from
Antibody CON horses when stimulated in vitro with polyinosinic-polycytidylic acid [poly(I:C)], pos-
sibly due to an elevated number of circulating monocytes. No differences between groups
were observed in plasma concentrations of IgG, IgA, IgM, IgE, or rheumatoid factor. Laminar
tissue from LMN horses expressed elevated levels of keratinocyte damage-related genes
as well as inflammatory cytokines and chemokines, which corresponded with a modest
amount of neutrophil infiltration as shown by histological staining of fixed tissue and accu-
mulation of neutrophil elastase protein. Taken together, our results do not support the
hypothesis of an autoimmune component in chronic laminitis, although the strong induc-
tion of neutrophil chemokines and the presence of tissue neutrophils suggests that this cell
type is likely involved in perpetuating the inflammation and tissue damage associated with
this disease.
© 2013 Elsevier B.V. All rights reserved.

1. Introduction phalanx. This condition is usually not reversible and horses

Laminitis is a debilitating disease of the equine foot
that often occurs secondary to gastrointestinal disease
or metabolic syndrome (Slater et al., 1995; USDA, 2000).
The acute phase of the disease is characterized by severe
lameness, disintegration of the laminar tissue connect-
ing the hoof wall to the underlying third phalanx (Pollitt,
1996), and in some cases, dorsopalmar rotation of the third
∗ Corresponding author. Tel.: +1 979 862 1436; fax: +1 979 847 8981.
E-mail address: ssteelman@cvm.tamu.edu (S.M. Steelman).
that survive an episode of acute laminitis often experience
persistent lameness for years. This stage of the disease is
termed chronic laminitis or “founder” (Hood, 1999). Acute
laminitis transitions to the chronic form of the disease
in an estimated 75% of cases (Moore, 2010), leaving the
majority of afflicted horses with some degree of continued
lameness. Whereas much effort has been expended to
identify the causes of acute laminitis, the chronic form of
the disease remains relatively uncharacterized.
Existing publications regarding chronic laminitis pri-
marily focus on management and shoeing strategies to
reduce pain and improve quality of life (Hunt and Wharton,

0165-2427/$ – see front matter © 2013 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.vetimm.2013.03.001
218 S.M. Steelman et al. / Veterinary Immunology and Immunopathology 153 (2013) 217–226

Table 1
Real time PCR primers used in the current study.

Gene Forward Primer Reverse Primer

IFN␥ TACCTATTACTGCCAGGCCGCG ATCCAGGAAAAGAGGCCCACCA

IL-6 ACTCCTTCTTCACAAGCACCGTC AGTGGGGTGGGGAAAGCAGTAG
IL-1 CCAGAGGCGGCCGGGACATAAC GGGAAGGCAGCTGGGCATTGATT
TNF␣ CTGGCCCAGACACTCAGATCATCT CATTTGCACGCCCACTCAGC
ACTB CCAGCACGATGAAGATCAAG GTGGACAATGAGGCCAGAAT
CD3 AATGCAGCCACTGTGTTGGGC TCTGAAGCTCTTGACTGGCGAAC
CD14 TGGCGACATGGTCCTCTCGT CGCGCACCATGGTCTATAGGTC
CD19 AGACTCCTTCTCCAACGGTAA CCACCTCTTCATCCTCATTCT
CCL2 TCCAGTCACCTGCTGCTATAC ATTCTTGGCTTTTGGAGTAGG
CCL4 AGAGAACCAGGGAAAATCAA GTCCAGATTAGGAACCAAGG
CCL7 TCAATAAGAAGATCCCCATCC TCTTGTCCAGGTAGTTCGTGA
IL-8 ACAAGTCCCCAGGGACAGCA ACAACCGCAGCTTCACACAGA
DEFB4 ACTTGCCTTCCTCATTGTCTT AGCAGTTTCTCCGCTTTCTAT
PI3 CTTCTTGATCCTGGTGGTGTT ACTGAATCTTGCCCTTTGACT
SOD2 ACTTTGGTTCCTTCGACAAAT CAGGGGAATAAGACCTGTTGT
TLR4 GGCCAGTGATTTTCCAGTATT AGGGTGGTCAGGTTAGTCATC
S100A8 ACGGATCTGGAGAATGCTATC TGATGTCCAACTCTTTGAACC
S100A9 CGACCTAGAGACCATCATCAA TGCTTGTCCTCATTAGTGTCC
MMP13 CTTGAGCTGGACTCGTTGTT CAGCAGGATTAAGGGGATAGT

2010; Morrison, 2010; Orsini et al., 2010); only a handful
have sought to identify the pathological processes under-
lying this disease (Carter et al., 2011; Faleiros et al., 2004;
Johnson et al., 2004; Kuwano et al., 2005). In particular,
one study suggested that chronic laminitis might have an
autoimmune component (Wagner et al., 2003b), a hypoth-
esis which has yet to be tested. Autoimmune diseases are
generally characterized by circulating autoantibodies or
the presence of autoreactive T cells (Rose and Bona, 1993) in
addition to disease-specific criteria such as elevated white
blood cell (WBC) cytokine levels and increased serum con-
centrations of acute phase proteins or immunoglobulins
(Aho et al., 1997; Badolato and Oppenheim, 1996; Davis
et al., 2010). We recently found evidence of dysregulation
of IgM, IgA, and the acute phase proteins fibrinogen, fetuins
A and B, alpha-2 macroglobulin, and alpha-1 antitrypsin in
the plasma of horses with chronic laminitis (Steelman and
Chowdhary, 2012), thus providing support for the explo-
ration of a possible autoimmune component of this disease.
In the present study, we investigated parameters of
humoral and cellular immunity at both the local and sys-
temic levels in horses with chronic laminitis in order to
characterize the immune status of foundered horses. Our
results suggest a role for neutrophils in perpetuating the
chronic inflammation and tissue damage seen in this dis-
ease.
2. Methods
2.1. Animals and tissue collection
All animal protocols were approved by the Texas A&M
University College of Veterinary Medicine Clinical Research
Review Committee and/or the Institutional Animal Care
and Use Committee, as appropriate, and were performed
with the consent of the owner or the owner’s agent.
Details of the horses used for each experiment are included
in Supplementary Table 1. Horses with chronic lamini-
tis were diagnosed by a licensed veterinarian based on
clinical presentation, case history, and radiographic evi-
dence of dorsopalmar rotation of the distal phalanx. A
detailed description of all laminitis cases, including Obel
grade of lameness (Obel, 1948), is provided in Supplemen-
tary Table 2.
Blood samples (n = 35) were collected from horses and
ponies admitted to the Texas A&M University Large Ani-
mal Clinic (College Station, TX), the Hoof Diagnostic and
Rehabilitation Clinic (Bryan, TX), or that were owned by
Texas A&M University. Blood samples were collected from
the jugular vein into evacuated blood tubes containing hep-
arin or EDTA. Samples were either centrifuged at 1200 x g
for plasma collection, processed immediately for WBC RNA
isolation, or used as described below for in vitro culture of
WBCs. Complete blood counts were performed by the Texas
A&M University Clinical Pathology service on a subset of
samples.
Tissue samples were collected at necropsy from the dor-
sal aspect of the hoof of either forelimb of horses admitted
to the Texas A&M University Large Animal Clinic, the Hoof
Diagnostic and Rehabilitation Clinic, or the Louisiana State
University Veterinary Teaching Hospital (Baton Rouge, LA).
Horses in the control group were euthanized for reasons
unrelated to laminitis or other lameness. Control samples
were not collected from unaffected limbs of unilaterally
lame horses, as it would be impossible to rule out potential
effects of increased weight bearing on the unaffected limb.
2.2. Blood cell culture
Heparinized blood samples from control (CON, n = 10)
and chronic laminitis (LMN, n = 10) horses were thor-
oughly mixed by inversion and the total number of WBCs
was counted for each sample. Sterile aliquots of whole
blood were then treated with 1 ␮g/ml lipopolysaccharide
(LPS; from E. coli 0111:B4, Sigma-Aldrich, St. Louis, MO),
50 ␮g/ml polyinosinic:polycytidylic acid (poly (I:C); Sigma-
Aldrich), or vehicle control (PBS) for 6 h at 37 ◦ C. Upon
completion of the culture, RNA was isolated immediately.
 S.M. Steelman et al. / Veterinary Immunology and Immunopathology 153 (2013) 217–226 219

Table 2
Summary of complete blood counts performed on healthy control horses (n = 5) and horses with chronic laminitis (n = 12). Lymphos: total lymphocytes,
Monos: monocytes, Eosin: eosinphils, Total WBC: white blood cell count, RBC morph: red blood cell morphology.

Case # Group Neutrophils Lymphos Monos Eosin Total WBC RBC morph

21 CON 5934 2494 86 86 8.6 rouleaux

22 CON 4392 2376 – 432 7.2
23 CON 5610 2635 85 170 8.5
24 CON 6175 3040 95 95 9.5
26 CON 4160 1920 128 128 6.4
28 LMN 4160 2015 325 – 6.5 rouleaux
29 LMN 4745 2409 73 73 7.3 rouleaux
30 LMN 5251 3204 267 89 8.9 rouleaux
31 LMN 4176 2520 216 216 7.2 rouleaux
33 LMN 8284 2180 327 109 11 rouleaux
34 LMN 3968 1426 248 434 6.2 rouleaux
35 LMN 8510 2530 345 115 11.5
36 LMN 5002 2788 – 410 8.2
37 LMN 3596 2170 186 186 6.2
38 LMN 4686 1775 284 355 7.1 rouleaux
39 LMN 5369 3367 273 91 9.1 rouleaux
40 LMN 5355 2720 255 170 8.5

2.3. Gene expression calculated using dilutions of a reference serum of known

RNA was isolated from WBCs using the RNeasy Blood
Mini Kit (Qiagen, Valencia, CA) and from laminar tissue
using Qiazol Lysis Buffer (Qiagen) followed by the RNeasy
Cleanup Kit (Qiagen). RNA was reverse transcribed (Super-
Script III First Strand Synthesis Kit or Superscript VILO
cDNA Synthesis Kit, Invitrogen, Carlsbad, CA) and the sub-
sequent cDNA was used to determine gene expression
levels using real time PCR. Twenty-five nanograms of lam-
inar tissue cDNA or 2.5 ng of WBC RNA per PCR reaction
was added to LightCycler 480 SYBR Green I master mix
(Roche Applied Science, Indianapolis, IN) and 0.6 ␮M for-
ward and reverse primers. Primer sequences are listed in
Table 1. PCR reactions were performed on a LightCycler
480 (Roche) and the data was analyzed using the Pfaffl
method (Pfaffl, 2001). Negative controls included samples
in which the reverse transcriptase was omitted as well
as PCR reactions containing no template. Melting curves
were examined for each reaction to ensure that the fluores-
cence detected came from a single product of the expected
size.
2.4. ELISAs
Capture ELISAs were performed to determine plasma
concentrations of IgA and IgM using validated antibody
pairs (Bethyl Labs, Montgomery, TX) and standard pro-
tocols. Briefly, high protein-binding 96 well plates (Nunc
MaxiSorp, Thermo Scientific, Rockford, IL) were coated
with 100 ␮g of unlabelled capture antibody overnight at
4 ◦ C. Plates were blocked with SuperBlock buffer (Thermo
Scientific, Waltham, MA) for 30 min at room temperature.
Whole plasma samples were diluted 1:4000 in assay buffer
(10% SuperBlock in PBS) and 100 ␮l of each diluted sam-
ple was pipetted in duplicate onto the plates, which were
then incubated at 37 ◦ C for 90 min. HRP-conjugated detec-
tion antibodies were diluted 1:50,000 (IgM) or 1:150,000
(IgA) in assay buffer and incubated on the plates for 2 h
at room temperature. SigmaFast OPD (Sigma-Aldrich) was
used as a substrate for HRP. Sample concentrations were
concentration. Plasma concentrations of IgG were deter-
mined using a similar protocol adapted for use with a direct
ELISA. Plates were coated overnight at 4 ◦ C with plasma
samples diluted 1:80,000 in PBS and the HRP-conjugated
detection antibody was used at a dilution of 1:50,000; the
remainder of the protocol was unchanged. IgE was mea-
sured as described previously (Wagner et al., 2003a).
Rheumatoid factor (RF) assays were also performed by
ELISA using heat-aggregated equine IgG (10 min at 70 ◦ C)
diluted 1:100 in PBS as the capture antibody. Detection
antibodies were anti-IgA or anti-IgM (Bethyl Laboratories)
diluted 1:5000 in assay buffer. Plasma samples were seri-
ally diluted from 1:31.25 to 1:8000 (IgM-RF) or 1:125 to
1:2000 (IgA-RF) in order to determine titer.
2.5. Western blots
Western blotting was performed according to published
protocols (Steelman and Chowdhary, 2012). Antibodies
used are as follows: polyclonal rabbit anti-human neu-
trophil elastase (ab68672, Abcam, Cambridge, UK) and
goat anti-rabbit secondary antibody (ab97080, Abcam);
monoclonal rabbit anti-human beta actin (clone 13E5, Cell
Signaling Technology, Danvers, MA) and goat anti-rabbit
secondary antibody (#7074, Cell Signaling Technology).
Resulting bands were quantified using ImageJ software
(Rasband, 1997–2011).
2.6. Histology
Laminar tissue was fixed in neutral buffered formalin
for at least 48 h before being embedded, sectioned to a
thickness of 10 ␮m, and stained with H&E. Observation of
neutrophils was performed by manual inspection of 10–20
40x fields of view per animal.
2.7. Statistics
Comparisons between CON and LMN groups were made
by Student’s t test or two-way ANOVA, as appropriate.
220 S.M. Steelman et al. / Veterinary Immunology and Immunopathology 153 (2013) 217–226
As previous studies (Wang, 2010) suggested that inflam-
matory gene expression would be upregulated in laminar
tissue from horses with laminitis, a one-tailed t test was
used to evaluate these data. A one-tailed t-test was also
used to assess differences in IgA and IgM concentra-
tions between groups, as previous proteomics experiments
in our lab suggested that these immunoglobulins were
elevated in horses with chronic laminitis (SMS, unpub-
lished data; Steelman and Chowdhary, 2012). Calculations
were performed using Prism (GraphPad Software Inc., La
Jolla CA) or a variation of the S programming language
called R, which is commonly used for statistical analysis
(http://www.r-project.org). A P value < 0.05 was consid-
ered sufficient to reject the null hypothesis.
3. Results
3.1. Cellular immunity
Complete blood counts (CBCs) were performed on 5
healthy control horses and 12 horses with chronic lamini-
tis. Absolute counts of all cell types fell within normal
ranges, although the number of monocytes was higher in
LMN horses than in controls (99 ± 10 CON vs. 254 ± 38 LMN,
P < 0.01). Rouleaux were observed in 8 LMN horses (75%)
and 1 CON horse (20%). Total WBC number did not differ
between groups.
WBC expression of the inflammatory cytokines
interleukin-1␤ (IL-1), interleukin-6 (IL-6), tumor necrosis
factor alpha (TNF␣), and interferon gamma (IFN␥) was
assessed in horses with chronic laminitis (n = 9) and in
healthy controls (n = 9). As the 18 horses used for this
experiment had not had CBCs performed, the total number
of WBCs was counted manually; no differences were
seen between groups. In RNA isolated from freshly col-
lected blood samples, we found no significant differences
between the two groups in any of the cytokines tested
(Fig. 1).
To assess the response of WBCs to exposure to
pathogen-associated molecular patterns (PAMPs), whole
blood samples from control (n = 9) and foundered (n = 9)
Fig. 1. Basal cytokine expression in equine white blood cells. RNA was
isolated from whole blood of healthy controls (CON, n = 9) and horses with
chronic laminitis (LMN, n = 9). Pro-inflammatory cytokine expression was
determined by real time PCR. *P < 0.05.
horses were exposed to LPS, poly(I:C), or a vehicle con-
trol for 6 h. LPS and poly(I:C), a double-stranded RNA
molecule, were chosen as they are often associated with
pathogenic bacteria and viruses, respectively. LPS and
poly(I:C) induced expression of IL-1, TNF␣, IL-6, and IFN␥
(P < 0.01) in both groups; induction of IFN␥ was higher in
the LMN group than in controls (P < 0.05; Fig. 2). Post hoc
testing revealed a significant elevation of IFN␥ in LMN sam-
ples treated with poly(I:C) and a trend toward elevation in
samples treated with LPS. No differences were observed in
IL-1, TNF␣, or IL-6 between CON and LMN groups.
3.2. Humoral immunity
Total plasma concentrations of IgM, IgA, IgE, and IgG
in healthy horses and those with chronic laminitis were
measured by ELISA. No differences were found between the
LMN group (n = 8) and controls (n = 14), with the exception
of IgA, which was significantly elevated in the LMN group
(P = 0.025, Fig. 3).
As chronic laminitis shares several similarities with
autoimmune diseases such as rheumatoid arthritis, we
looked for the presence of IgM and IgA rheumatoid fac-
tors in the plasma of LMN horses, young controls (YC),
and mature, age-matched controls (MC). The YC group uni-
formly tested negative for both types of rheumatoid factor;
we thus used the YC values to establish the minimum value
for a positive titer, indicated by the dashed horizontal lines
in Fig. 4. Two MC horses and two LMN horses exceeded this
limit for IgA rheumatoid factor, although the titers for the
MC horses were 500 and 1000, whereas the titers for the
LMN horses were 62 and 250 (Fig. 4). Similar results were
seen with IgM rheumatoid factor, with 3 and 2 horses test-
ing positive in the MC and LMN groups, respectively (Fig. 4).
No significant differences were seen between the MC and
LMN groups for either rheumatoid factor.
3.3. Laminar inflammation
RNA expression of innate inflammatory cytokines,
antimicrobial and damage-related genes, chemokines, and
WBC markers was assessed in laminar tissue of horses with
chronic laminitis (n = 6) as well as in control horses (n = 5).
Chemokine and WBC marker genes were chosen to screen
for the presence of infiltrating inflammatory cells in the
laminar tissue. Other genes of interest were chosen based
on microarray data describing transcriptional changes in
laminar tissue in three different experimental models of
acute laminitis (Budak et al., 2009; Noschka et al., 2008;
Wang, 2010). The genes investigated herein thus represent
a small group of consistently upregulated transcripts that
we believe to be integral to the pathology of acute laminitis
and possibly involved in chronic laminitis.
We found significant upregulation of pro-inflammatory
cytokine genes, antimicrobial/damage-related genes, and
chemokine genes in laminar tissue from foundered horses
(Fig. 5). IL-1 and IL-6 were both significantly increased
(P < 0.05) in chronic laminitis, although TNF␣ and IFN␥
were not (Fig. 5). The antimicrobial peptides beta-defensin
4 (DEFB4) and peptidase inhibitor 3 (PI3) were elevated 22-
and 132-fold, respectively (P < 0.05), although no change
 S.M. Steelman et al. / Veterinary Immunology and Immunopathology 153 (2013) 217–226 221

Fig. 2. Cytokine expression in PAMP-stimulated equine white blood cells. Whole blood of healthy controls (CON, n = 9) and horses with chronic laminitis
(LMN, n = 9) was cultured for 6 h with vehicle (VEH), LPS (1 ␮g/ml), or poly(I:C) (50 ng/ml). RNA was isolated from whole blood and pro-inflammatory
cytokine expression was determined by real time PCR. *P < 0.05.

Fig. 3. Plasma immunoglobulin concentrations. Immunoglobulin concentrations were measured by ELISA in control horses (CON, n = 14) and horses with
chronic laminitis (LMN, n = 8). *P < 0.05.
222 S.M. Steelman et al. / Veterinary Immunology and Immunopathology 153 (2013) 217–226

Fig. 4. IgA and IgM rheumatoid factor titration curves. Titers were measured by ELISA in mature (> 5 y.o., n = 8) control horses [CON(M)] and horses with
chronic laminitis (LMN, n = 8).

Fig. 5. Laminar expression of inflammatory cytokines, damage-related genes, chemokines, and cell surface markers. RNA was isolated from laminar tissue
of control horses (CON, n = 5) and horses with chronic laminitis (LMN, n = 6). Gene expression was determined by real time PCR. *P < 0.05.
 S.M. Steelman et al. / Veterinary Immunology and Immunopathology 153 (2013) 217–226
Fig. 6. Neutrophil elastase expression in laminar tissue. Total protein was
isolated from laminar tissue of control horses (n = 6) and horses with
chronic laminitis (n = 4). Western blotting was performed to determine
neutrophil elastase expression; data are expressed as the ratio of neu-
trophil elastase to beta actin expression. *P < 0.05.
was seen in toll-like receptor 4 (TLR4). The keratinocyte
damage-related genes superoxide dismutase 2 (SOD2),
S100A9, and matrix metalloproteinase 13 (MMP13) were
all significantly upregulated in the LMN group, although
S100A8 was not. The macrophage chemokine CCL2 was
upregulated approximately 10-fold (P < 0.05); the lympho-
cyte chemokines CCL4 and CCL7 did not differ between
groups. IL-8, a neutrophil chemokine, was also increased
in the LMN group (Fig. 5). The cell markers CD3, CD14,
and CD19, which are used to identify T cells, macrophages,
and B cells, respectively, did not differ in expression
levels between the two groups (Fig. 5). Attempts to
quantify RNA expression of myeloperoxidase in laminar
tissue were unsuccessful, likely because neutrophils stop
transcription of this gene shortly after leaving the bone
marrow (Fouret et al., 1989). Nevertheless, western blot of
Fig. 7. Neutrophil infiltration in laminar tissue. Photograph shows typical location of infiltrating neutrophils (arrow) among laminar epithelial cells in a
horse with chronic laminitis. Asterisk denotes keratinized axis of primary epidermal lamina. Secondary laminae have degenerated to the point of being
indistinguishable. Inset shows neutrophils only. H&E stain, 40x magnification.
223
laminar tissue showed a significant increase in neutrophil
elastase protein in horses with chronic laminitis (Fig. 6).
In addition, scattered neutrophils (average < 1 cell per 40x
field) were visible in H&E stained laminar tissues of horses
with chronic laminitis (4/4, 100%), whereas none were
observed in tissues from control horses. Neutrophils were
found exclusively in the lamellae rather than in the deep
dermis, often among the laminar epithelial cells (Fig. 7).
Supplemental Fig. 1 shows a low magnification image of
Fig. 7 and illustrates the nature of the structural changes
seen in the laminar tissues.
4. Discussion
4.1. Cellular immunity
Circulating WBCs are a convenient, non-invasive means
by which to evaluate the immune status of an animal. In
the present study, we profiled both the differential counts
and cytokine production of WBCs in order to gain insight
into the immune responsiveness of horses with chronic
laminitis. We found an ∼2.5 fold elevation of monocytes in
LMN horses, although all horses were well within the nor-
mal range for this cell type (0–1000 cells/␮l). The clinical
relevance of this finding remains unknown, as is the under-
lying physiological mechanism causing this difference. We
also found evidence of rouleaux in 75% of LMN horses, but
only 20% of controls. A previous study suggested elevated
concentrations of fibrinogen in horses with chronic lamini-
tis (Steelman and Chowdhary, 2012); fibrinogen is known
to induce red blood cell aggregation and may underlie the
rouleaux formation seen in foundered horses. As the pres-
ence of rouleaux has the potential to affect microvascular
blood flow, further investigation of rheological parameters
in chronic laminitis is warranted.
The in vivo environment of WBCs is the sum of fac-
tors secreted throughout the body; they are thus in a
unique position to monitor and respond to peripheral infec-
tion or injury. Profiling cytokine expression in these cells
224 S.M. Steelman et al. / Veterinary Immunology and Immunopathology 153 (2013) 217–226
thus provides a static assessment of the animal’s overall
health and well-being. In this study, however, we found
no change in basal production of IL-1, IL-6, TNF␣, or IFN␥.
In vitro antigen-stimulated cytokine production, on the
other hand, has been shown to be an excellent predictor of
some disease states (Davis et al., 2010). In particular, gene
expression of WBCs cultured in their in vivo environment
(i.e., whole blood) is thought to be more representative of
the true physiology of the animal than WBCs cultured in
artificial media (Chen et al., 2010; Hodge et al., 2000). We
found that, while WBCs from both groups responded to
exposure to LPS or poly(I:C), foundered horses expressed
significantly more IFN␥ than did controls. It is possible that
this is due to the elevated number of circulating monocytes
in LMN horses, although unpublished data from our labora-
tory suggests that highly purified neutrophils isolated from
LMN horses produce elevated amounts of IFN␥ (S.M. Steel-
man, unpublished observations). Although neutrophils are
not generally known for expression of interferons, some
evidence suggests that IFN␥ can be induced by stimulation
with IL-12 (Ethuin et al., 2004). Importantly, the differ-
ential response of LMN horses to perceived pathogens,
although conducted in vitro with mixed WBCs rather than
tissue-resident antigen presenting cells, might underly the
adverse reactions to vaccination in some LMN horses. This
hypothesis was not specifically tested in the present study,
but is currently under investigation in our laboratory.
4.2. Humoral immunity
Elevated immunoglobin levels are a hallmark of a num-
ber of chronic inflammatory and autoimmune diseases,
including hepatitis, asthma, and rheumatoid arthritis (Aho
et al., 1997; Mieli-Vergani and Vergani, 2011; Platts-Mills,
2001). Previous work in our laboratory suggested dif-
ferences in plasma immunoglobulin concentrations in a
limited number of animals (Steelman and Chowdhary,
2012), so we sought to confirm and expand upon these data
in the present study. Herein, we found that IgA was signif-
icantly elevated in horses with chronic laminitis. Whereas
the functions of secretory IgA, primarily found at mucosal
surfaces, are well described (Pabst, 2012), the immuno-
logical role of serum IgA is not completely understood.
Serum IgA, which exists predominantly in the monomeric
form, is evelated in several chronic inflammatory diseases
such as ankylosing spondylitis and alcoholic liver disease
and has been shown to have anti-inflammatory proper-
ties (reviewed in Monteiro, 2010). Specifically, IgA inhibits
the respiratory burst in human neutrophils and mono-
cytes (Wolf et al., 1994b), decreases monocyte production
of TNF␣ and IL-6 (Wolf et al., 1994a), and impairs neu-
trophil phagocytosis (Wilton, 1978) and chemotaxis (Van
Epps and Williams, 1976). Notably, our previous work
uncovered a similar increase in the anti-inflammatory
protein apolipoprotein A-IV (APOA-IV) in the plasma of
horses with chronic laminitis (Steelman and Chowdhary,
2012). The elevation of plasma IgA and APOA-IV might
represent a compensatory effort of the immune system to
downregulate inflammation in chronic laminitis. Further
investigation of the anti-inflammatory response in chronic
laminitis is warranted.
It is also interesting to note that some older horses
exhibited positive rheumatoid factor titers, whereas the
younger ones did not; the reason for the occurrence of
rheumatoid factor in otherwise healthy horses is unknown.
A previous study found no increase in C1q-binding immune
complexes in the serum of horses with chronic inflamma-
tory diseases, including osteoarthritis and osteochondrosis
dissecans (Osborne et al., 1995), although Stanek et al.
(1984) found synovial fluid immune complexes in horses
with laminitis [as reported by Osborne et al. (1995)]. Our
data, however, do not support the hypothesis of immune
complexes as contributors to the pathology of chronic
laminitis.
4.3. Laminar inflammation
Although it is generally accepted that some level of
inflammation is ongoing in the laminar tissue of foundered
horses, there is a lack of data describing the nature of this
inflammation. For this reason, we measured the expression
levels of several inflammation-related genes as well as a
“core” group of genes that we and others have found to be
consistently upregulated in several experimental models
of acute laminitis. We believe that these core genes are
integral to the pathology of laminitis and are possible
candidates for targeted intervention. Although not con-
sistently upregulated in our previous studies in acute
laminitis (Wang, 2010), the innate cytokines IL-1, IL-6,
IFN␥, and TNF␣ are potentially important given their major
regulatory roles in initiating and sustaining the immune
response. Similar to results seen in acute, carbohydrate-
induced laminitis (Leise et al., 2011), we found that IL-1
and IL-6, but not TNF␣, were overexpressed in the laminar
tissue of foundered horses. The source of these cytokines is
unknown, but could be laminar keratinocytes or infiltrat-
ing phagocytes. No increase was found in laminar tissue
IFN␥, despite the elevation seen in circulating WBCs. How-
ever, we also found no indication of increased numbers of
antigen presenting cells (macrophages, dendritic cells), T
cells, or B cells during chronic laminitis, as evidenced by
the expression levels of CD14, CD3, and CD19, respectively.
RNA expression of cell markers is often used to assess
tissue infiltration of inflammatory cells (Michalak et al.,
2000; Ponnuswamy et al., 2012), although the possibility
remains that RNA level might not necessarily correlate
with cell number. In the present study, however, the lack
of change in cell marker expression was supported by
an absence of inflammatory cells visible in histological
sections, with the exception of neutrophils. This is inter-
esting in light of the fact that the monocyte/macrophage
chemokine CCL2 was overexpressed in foundered horses,
although the lymphocyte chemokines CCL4 and CCL7
did not differ between groups. IL-8, the prototypical
neutrophil chemokine, was highly upregulated and, in this
study, was accompanied by the presence of neutrophils
within the laminar tissue, as evidenced by both histology
and neutrophil elastase protein levels. With the exception
of a single horse, neutrophil infiltration appeared to be
minimal, although similarly low numbers of laminar
neutrophils have been found in both the developmental
and Obel grade I stages of experimental laminitis (Black
 S.M. Steelman et al. / Veterinary Immunology and Immunopathology 153 (2013) 217–226
et al., 2006). Given the ability of neutrophils to release
proteinases, reactive oxygen species, and inflammatory
cytokines, it is likely that these cells contribute to laminar
tissue damage during chronic laminitis. Indeed, some
groups have hypothesized that neutrophils drive both
systemic and laminar inflammation during acute laminitis,
particularly in the black walnut extract induction model,
where they are likely the source of IL-1 (Belknap, 2010; de
la Rebiere de Pouyade and Serteyn, 2011). As neutrophils
are generally the first cell type to respond to injury or
infection, it is tempting to speculate that their presence
in chronic laminitis is the result of repeated trauma to the
tissue from everyday weight-bearing activity.
The last class of genes examined, the damage-related
genes, is an essential component of the epithelial response
to infection or trauma, particularly the antimicrobial pep-
tides (AMPs). The major keratinocyte AMPs include the
defensins (such as DEFB4) and PI3 (also known as SKALP
or elafin), which defend against microbes by disrupting
bacterial cell membrane integrity (Wiesner and Vilcinskas,
2010). Interestingly, PI3 is also a serine protease inhibitor
that protects against excessive tissue damage by neutrophil
degranulation. Both molecules are produced in response to
inflammation resulting from infection or trauma and are
chemotactic for several types of immune cells (Wiesner
and Vilcinskas, 2010; Wilkinson et al., 2009). The over-
expression of these peptides could be a link between the
mechanical damage to the laminar tissue resulting from
the instability of the decompensated foundered foot and
the chronic inflammation characteristic of this disease. The
dramatic upregulation of MMP13, a collagenase enzyme,
could also promote mechanical instability of the foot via
degradation of laminar collagen. We also found a modest
upregulation of the antioxidant enzyme SOD2, suggest-
ing the occurrence of oxidative injury, perhaps from the
neutrophil respiratory burst. Finally, the calcium-binding
protein S100A9, but not its binding partner S100A8, was
dramatically overexpressed in laminar tissue. S100A8 and
S100A9 are generally co-regulated in laminar keratinocytes
as part of the pro-inflammatory calprotectin complex
(Faleiros et al., 2009), although there is some evidence that
activated neutrophils express S100A9 in the absence of
S100A8 (Kumar et al., 2001). Although immunohistochem-
istry would be necessary to definitively localize expression
of S100A9 to neutrophils, it is possible that the upregula-
tion of this gene in chronic laminitis is due to neutrophil
infiltration.
5. Conclusion
Despite previous speculation that chronic laminitis
might have an autoimmune component (Hood et al., 1990),
we found no evidence to support this hypothesis, either in
the form of circulating immune complexes or expression
of the T cell marker CD3 within laminar tissue. Instead,
we suggest a working hypothesis in which laminar inflam-
mation results from the keratinocytes themselves and
infiltrating neutrophils, likely in response to continual sub-
clinical injury sustained during everyday weight-bearing
activity. The current study provides evidence that spe-
cific targeting of keratinocyte mediators of inflammation
225
or blockade of neutrophil infiltration might provide a more
effective approach to limiting pain and inflammation in
foundered horses.
Acknowledgements
The authors wish to thank Dr. David Hood of the Hoof
Diagnostic and Rehabilitation Clinic and Dr. Carolyn Arnold
of the Texas A&M Veterinary Medical Teaching Hospital
for access to samples and Dr. Jianrong Li for use of lab-
oratory equipment. This research was supported in part
by the United States Department of Agriculture (award #
2011-67012-30685 to SMS and 2010-65205-20446 to BPC).
Appendix A. Supplementary data
Supplementary data associated with this article can be
found, in the online version, at http://dx.doi.org/10.1016/j.
vetimm.2013.03.001.
References
Aho, K., Heliovaara, M., Knekt, P., Reunanen, A., Aromaa, A., Leino, A., Kurki,
P., Heikkila, R., Palosuo, T., 1997. Serum immunoglobulins and the risk
of rheumatoid arthritis. Ann. Rheum. Dis. 56, 351–356.
Badolato, R., Oppenheim, J.J., 1996. Role of cytokines, acute-phase pro-
teins, and chemokines in the progression of rheumatoid arthritis.
Semin. Arthritis Rheum. 26, 526–538.
Belknap, J.K., 2010. Black walnut extract: an inflammatory model. The
Veterinary clinics of North America. Equine Pract. 26, 95–101.
Black, S.J., Lunn, D.P., Yin, C., Hwang, M., Lenz, S.D., Belknap, J.K., 2006.
Leukocyte emigration in the early stages of laminitis. Vet. Immunol.
Immunopathol. 109, 161–166.
Budak, M.T., Orsini, J.A., Pollitt, C.C., Rubinstein, N.A., 2009. Gene expres-
sion in the lamellar dermis-epidermis during the developmental
phase of carbohydrate overload-induced laminitis in the horse. Vet.
Immunol. Immunopathol. 131, 86–96.
Carter, R.A., Engiles, J.B., Megee, S.O., Senoo, M., Galantino-Homer, H.L.,
2011. Decreased expression of p63, a regulator of epidermal stem cells,
in the chronic laminitic equine hoof. Equine Vet. J. 43, 543–551.
Chen, J., Bruns, A.H., Donnelly, H.K., Wunderink, R.G., 2010. Comparative
in vitro stimulation with lipopolysaccharide to study TNFalpha gene
expression in fresh whole blood, fresh and frozen peripheral blood
mononuclear cells. J. Immunol. Methods 357, 33–37.
Davis 3rd, J.M., Knutson, K.L., Strausbauch, M.A., Crowson, C.S., Therneau,
T.M., Wettstein, P.J., Matteson, E.L., Gabriel, S.E., 2010. Analysis of com-
plex biomarkers for human immune-mediated disorders based on
cytokine responsiveness of peripheral blood cells. J. Immunol. 184,
7297–7304.
de la Rebiere de Pouyade, G., Serteyn, D., 2011. The role of activated neu-
trophils in the early stage of equine laminitis. Vet. J. 189, 27–33.
Ethuin, F., Gerard, B., Benna, J.E., Boutten, A., Gougereot-Pocidalo, M.A.,
Jacob, L., Chollet-Martin, S., 2004. Human neutrophils produce inter-
feron gamma upon stimulation by interleukin-12. Lab. Invest. 84,
1363–1371.
Faleiros, R.R., Nuovo, G.J., Belknap, J.K., 2009. Calprotectin in myeloid and
epithelial cells of laminae from horses with black walnut extract-
induced laminitis. J. Vet. Intern. Med. 23, 174–181.
Faleiros, R.R., Stokes, A.M., Eades, S.C., Kim, D.Y., Paulsen, D.B., Moore, R.M.,
2004. Assessment of apoptosis in epidermal lamellar cells in clinically
normal horses and those with laminitis. Am. J. Vet. Res. 65, 578–585.
Fouret, P., du Bois, R.M., Bernaudin, J.F., Takahashi, H., Ferrans, V.J., Crystal,
R.G., 1989. Expression of the neutrophil elastase gene during human
bone marrow cell differentiation. J. Exp. Med. 169, 833–845.
Hodge, G., Hodge, S., Han, P., 2000. Increased levels of apoptosis of leuko-
cyte subsets in cultured PBMCs compared to whole blood as shown
by Annexin V binding: relevance to cytokine production. Cytokine 12,
1763–1768.
Hood, D.M., 1999. The pathophysiology of developmental and acute
laminitis. Vet. Clin. North Am. Equine Pract. 15, 321–343.
Hood, D.M., Amoss, M.S., Grosenbaugh, D.A., 1990. Equine laminitis: a
potential model of Raynaud’s phenomenon. Angiology 41, 270–277.
226 S.M. Steelman et al. / Veterinary Immunology and Immunopathology 153 (2013) 217–226
Hunt, R.J., Wharton, R.E., 2010. Clinical presentation, diagnosis, and prog-
nosis of chronic laminitis in North America. Vet. Clin. North Am.
Equine Pract. 26, 141–153.
Johnson, P.J., Ganjam, V.K., Slight, S.H., Kreeger, J.M., Messer, N.T., 2004.
Tissue-specific dysregulation of cortisol metabolism in equine lamini-
tis. Equine Vet. J. 36, 41–45.
Kumar, R.K., Yang, Z., Bilson, S., Thliveris, S., Cooke, B.E., Geczy, C.L., 2001.
Dimeric S100A8 in human neutrophils is diminished after phagocy-
tosis. J. Leukoc. Biol. 70, 59–64.
Kuwano, A., Ueno, T., Katayama, Y., Nishiyama, T., Arai, K., 2005. Uni-
lateral basement membrane zone alteration of the regenerated
laminar region in equine chronic laminitis. J. Vet. Med. Sci. 67,
685–691.
Leise, B.S., Faleiros, R.R., Watts, M., Johnson, P.J., Black, S.J., Belknap, J.K.,
2011. Laminar inflammatory gene expression in the carbohydrate
overload model of equine laminitis. Equine Vet. J. 43, 54–61.
Michalak, T.I., Hodgson, P.D., Churchill, N.D., 2000. Posttranscriptional
inhibition of class I major histocompatibility complex presentation
on hepatocytes and lymphoid cells in chronic woodchuck hepatitis
virus infection. J. Virol. 74, 4483–4494.
Mieli-Vergani, G., Vergani, D., 2011. Autoimmune hepatitis. Nat. Rev. Gas-
troenterol. Hepatol. 8, 320–329.
Monteiro, R.C., 2010. Role of IgA and IgA fc receptors in inflammation. J.
Clin. Immunol. 30, 1–9.
Moore, R.M., 2010. Vision 20/20 – conquer laminitis by 2020. J. Equine Vet.
Sci. 30, 74–76.
Morrison, S., 2010. Chronic laminitis: foot management. Vet. Clin. North
Am. Equine Pract. 26, 425–446.
Noschka, E., Vandenplas, M.L., Hurley, D.J., Moore, J.N., 2008. Temporal
aspects of laminar gene expression during the developmental stages
of equine laminitis. Vet. Immunol. Immunopathol.
Obel, N.J., 1948. Studies on the histopathology of acute laminitis. Disser-
tation. Swedish University of Agricultural Sciences.
Orsini, J.A., Wrigley, J., Riley, P., 2010. Home care for horses with chronic
laminitis. Vet. Clin. North Am. Equine Pract. 26, 215–223.
Osborne, A.C., Carter, S.D., May, S.A., Bennett, D., 1995. Anti-collagen anti-
bodies and immune complexes in equine joint diseases. Vet. Immunol.
Immunopathol. 45, 19–30.
Pabst, O., 2012. New concepts in the generation and functions of IgA. Nat.
Rev. Immunol. 12, 821–832.
Pfaffl, M.W., 2001. A new mathematical model for relative quantification
in real-time RT-PCR. Nucleic Acids Res. 29, e45.
Platts-Mills, T.A., 2001. The role of immunoglobulin E in allergy and
asthma. Am. J. Respir. Crit. Care Med. 164, S1–S5.
Pollitt, C.C., 1996. Basement membrane pathology: a feature of acute
equine laminitis. Equine Vet. J. 28, 38–46.
Ponnuswamy, P., Schrottle, A., Ostermeier, E., Gruner, S., Huang, P.L., Ertl,
G., Hoffmann, U., Nieswandt, B., Kuhlencordt, P.J., 2012. eNOS protects
from atherosclerosis despite relevant superoxide production by the
enzyme in apoE mice. PLoS ONE 7, e30193.
Rose, N.R., Bona, C., 1993. Defining criteria for autoimmune dis-
eases (Witebsky’s postulates revisited). Immunol. Today 14,
426–430.
Slater, M.R., Hood, D.M., Carter, G.K., 1995. Descriptive epidemiological
study of equine laminitis. Equine Vet. J. 27, 364–367.
Stanek, C., Mayr, B., Graninger, W., Hofmann, R., 1984. Immune complexes
in the peripheral blood of healthy horses and horses with laminitis.
Berl. Munch. Tierarztl. Wochenschr. 97, 25–28.
Steelman, S.M., Chowdhary, B.P., 2012. Plasma proteomics shows an ele-
vation of the anti-inflammatory protein APOA-IV in chronic equine
laminitis. BMC Vet. Res. 8, 179.
USDA, 2000. Lameness and laminitis in U.S. horses. United States Depart-
ment of Agriculture Report #N318.0400.
Van Epps, D.E., Williams Jr., R.C., 1976. Suppression of leukocyte
chemotaxis by human IgA myeloma components. J. Exp. Med. 144,
1227–1242.
Wagner, B., Radbruch, A., Rohwer, J., Leibold, W., 2003a. Monoclonal
anti-equine IgE antibodies with specificity for different epitopes
on the immunoglobulin heavy chain of native IgE. Vet. Immunol.
Immunopathol. 92, 45–60.
Wagner, I.P., Rees, C.A., Dunstan, R.W., Credille, K.M., Hood, D.M., 2003b.
Evaluation of systemic immunologic hyperreactivity after intrader-
mal testing in horses with chronic laminitis. Am. J. Vet. Res. 64,
279–283.
Wang, J., 2010. Genome-wide transcriptome analysis of laminar tissue
during the early stages of experimentally induced equine laminitis.
Dissertation. Texas A&M University.
Wiesner, J., Vilcinskas, A., 2010. Antimicrobial peptides: the ancient arm
of the human immune system. Virulence. 1, 440–64.
Wilkinson, T.S., Dhaliwal, K., Hamilton, T.W., Lipka, A.F., Farrell, L.,
Davidson, D.J., Duffin, R., Morris, A.C., Haslett, C., Govan, J.R., Greg-
ory, C.D., Sallenave, J.M., Simpson, A.J., 2009. Trappin-2 promotes
early clearance of Pseudomonas aeruginosa through CD14-dependent
macrophage activation and neutrophil recruitment. Am. J. Pathol. 174,
1338–1346.
Wilton, J.M., 1978. Suppression by IgA of IgG-mediated phagocytosis
by human polymorphonuclear leucocytes. Clin. Exp. Immunol. 34,
423–428.
Wolf, H.M., Fischer, M.B., Puhringer, H., Samstag, A., Vogel, E., Eibl, M.M.,
1994a. Human serum IgA downregulates the release of inflamma-
tory cytokines (tumor necrosis factor-alpha, interleukin-6) in human
monocytes. Blood 83, 1278–1288.
Wolf, H.M., Vogel, E., Fischer, M.B., Rengs, H., Schwarz, H.P., Eibl, M.M.,
1994b. Inhibition of receptor-dependent and receptor-independent
generation of the respiratory burst in human neutrophils and mono-
cytes by human serum IgA. Pediatr. Res. 36, 235–243.