Sei sulla pagina 1di 261

Curso de Especialización en Cierre de Minas y Pasivos Ambientales

TRATAMIENTO DE EFLUENTES MINEROS


“ÉNFASIS EN EL DRENAJE ÁCIDO DE ROCAS”
por
NURAL KUYUCAK

Toda ta vida adela11te. I-1


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Fuentes de Efluentes Mineros

• Procesos Minero-Metalúrgicos
– Agua de relaves
– Flujos ácidos del proceso
– Lixiviación de metales por cianuro
– Drenaje ácido de mina e infiltración
• Sitios Mineros
– Drenaje ácido de mina e infiltración
• Otra contaminación


" Toda ta vida adela11te. I-2

1
Drenaje Ácido de Mina = Drenaje Ácido de Roca
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(DAM o DAR)

Puede ocurrir en sitios mineros operativos


y/o cerrados

Toda ta vida adela11te. I-3

FUENTES DE DAR
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Minas metálicas (grandes/localizadas)


• Minas de carbón (pequeñas-medianas/localizadas)
– Superficial
– Subterránea
– Pilas de roca de desmonte
– Depósitos de relave
• Suelos ácidos con sulfuros (pequeña-
mediana/localizada)


" Toda ta vida adela11te. I-4

2
DAR
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Oxidación de sulfuros en residuos mineros, tales


como pirita:
• FeS2(s) + 7/2 O2 + H2O → Fe2+ + 2 SO42- + 2H+

• A menudo contiene metales pesados como Cu, Zn,


Pb, y Ni
• Debe ser tratado para cumplir los requerimientos
ambientales (e.g., límites de descarga)

Toda ta vida adela11te. I-5

DAR – REACCIONES IMPORTANTES


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

FeS2 + 3.5O2 + H2 O Æ Fe2+ + 2 SO4 + 2H+

Fe2+ + 0.25 O2 + H+ Æ Fe3+ + 0.5 H2 O

Fe3+ 3H2 O Æ Fe(OH)3(s) + 3H+

Æ Tanto para el Fe2+ como el Fe3+ ; las concentraciones de Fe


dependen del potencial redox del agua y el equilibrio con el aire.
Æ Fe(OH)3 precipitado de color naranja


" Toda ta vida adela11te. I-6

3
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Flujos Ácidos de Proceso

• Sangrado de la pila de lixiviación


– Típicamente alto sulfato y Fe
• Ácido diluido de la limpieza de gas de la
fundición
– Puede contener As – se requiere tratamiento
específico
• Efuente de refinería

Toda ta vida adela11te. I-7

Perspectivas en en Manejo del Agua de Mina


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

1. Prevención de contaminación en la fuente


– Separar el agua contaminada
– Rehabilitación
– Métodos de minería
2. Reciclaje y reutilización
– Usos generales
– Usos especiales que pueden requerir tratamiento
– Otros usos beneficiosos
3. Descarga al ambiente hídrico
– Descargas controladas
– Transferencia de otra cuenca
– Podría requerirse tratamiento


" Toda ta vida adela11te. I-8

4
DAR – Requiere Tratamiento
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Site Al Cd Cu Fe Mn Ni Pb Zn SO4 pH Eh
(mg/L) (mv)
Brunswick 20 0.1 3 145 20 0.1 2 120 2300 3.2 540
Falconbridge Sudbury
Geco
Heath Steele
Kidd Met. Site
10
25
0.05
0.15
1.1
0.5
10
3
600
180
25
8
10
38
3
<0.5 <0.5
0.1 2
<0.01 0.05 0.1
20
160
60
500
4500
3000
2100
3.1
3.9
3
4.5
500
660
--
r
Mattabi 34 0.5 14 145 33 0.6 <0.5 245 4000 3 680
Mine Doyon 350 0.011 6 1179 23.8 0.769 0.259 5.4 6600 675 ·~
Waite Amulet 15 <0.02 1 75 4 <0.5 <0.5 5 1000 2.5 725
Características de DAM observado en diversos sitios

/"
-84:;;J;'-

• ~ Pontificia Universidad Católica del Perú
Todalavida adela•te. \ <
'I-9
\ ~ ~ PERCAN
~

Impactos del DAR


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Crónico/Agudo (eventos de “lavado” (flushing))


• Limita el uso del agua en el sitio
• Corrosión de la infraestructura y equipamiento del sitio
• Metales tóxicos (e.g., Cu, Cd, As, Al) a la salud humama
y el ecosistema
• Limita el aprovechamiento del agua corriente abajo
• Altera la química del agua y su capacidad de soportar
vida acuática
• Produce precipitados químicos
• Impacta en la calidad de las aguas subterráneas
• Programas de remediación y rehabilitación son caros
• Genera responsabilidades legales ambientales de largo
plazo


• Toda ta vida adela11te. I-10

5
DAR
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El DAR por lo general presenta pH bajo y puede


contener acidez, metales y sulfato en concentraciones
elevadas.
• ¡El DAM puede impactar el ambiente!

Toda ta vida adela11te. I-11

Contaminantes Inorgánicos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Metales pesados:
– Al, Cd, Cu, Co, Fe, Ni, Pb, Zn
• Metaloides:
– As, Mn, Mo, Sb, Se
• Acidez y pH


" Toda ta vida adela11te. I-12

6
Qué es pH?
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

pH = - log [H+]

Toda ta vida adela11te. I-13

Entiendiendo el pH
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• pH es una escala logarítmica:


pH = -log[H+]
i.e., pH cambia en 1 unidad por cada cambio en
un orden de magnitud (potencia de 10) en [H+]

pH 1 2 3 4 5 6 7 8 9 10 11 12 13 14
I I I I I I I I I I I I I I
[H+] 10 1 0.1 0.01
100
1000
10000
100000
1000000


" Toda ta vida adela11te. I-14

7
Entendiendo el pH
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La acidez es la medida de la concentración de H+ y otras


especies disueltas capaces de producir ácido (e.g., Al,
Fe, Mn)
• La acidez también proporciona capacidad de
amortiguamiento al agua
• Generalmente es determinada mediante titulación de
una muestra oxidada* de agua mediante una base
fuerte* hasta alcanzar el pH 8.3
• Se reporta como “---- mg CaCO3/L”
*Se utiliza H2O2 y NaOH como agente oxidante y base fuerte, respectivamente

Toda ta vida adela11te. I-15

Entendiendo el pH
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

pH

12

8.3

mg NaOH agregado


" Toda ta vida adela11te. I-16

8
Acidez en el DAM
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Acidez mineral debida a reacciones de hidrólisis


de Al, Fe y Mn

2 Fe+2 (aq) + 4H2O Æ 2 Fe(OH)3 (s) + 2 H+ (aq)


Fe+3 (aq) + 3H2O Æ Fe(OH)3 (s) + 3 H+ (aq)
Al (aq) + 3H2O Æ
+3 Al(OH)3 (s) + 3 H+ (aq)
Mn (aq) + 2 H2O = O2 (aq) Æ 2 MnO2 + 4 H+ (aq)
+2

• pH = [H+] acidez de protones


• Acidez orgánica

Toda ta vida adela11te. I-17

Acidez y pH
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• pH = acidez de protones
(i.e., log [H+] es sólo un indicador)

• Siempre se usa acidez total


(i.e., acidez inorgánica + acidez orgánica + acidez de protones)

• Se puede calcular la acidez total :

Act = 50⎜⎜ +
[ +
] [ +
] [
⎛ 2 Fe 2+ 3 Fe3+ 3 Al 3+ 2 Mn 2+ ] [ ]
+ 1000 10 − pH ( )⎞⎟⎟
⎝ 56 56 27 55 ⎠


" Toda ta vida adela11te. I-18

9
Entendiendo la Carga de Acido
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La carga de ácido pueden ser calculada multiplicando la


acidez y el caudal
• La carga de ácido es esencialmente equivalente al
requerimiento de tratamiento:
• 100 mg/L CaCO3 @ 116L/s = 1.0 t CaCO3/d
• 1.0 t CaCO3 /d = 740 kg Ca(OH)2

• La acidez generalmente se incremente a medida que el


pH desciende
• Es posible tener agua con alta acidez pero pH neutro

Toda ta vida adela11te. I-19


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Distribución de Hierro Ferroso (Fe2+) y Férrico


(Fe3+) como función del pH

100

Fe(OH)2
Fe(OH)3
Fe3+

Fe2+

0
0 2 3 6 7 8


" Toda ta vida adela11te. I-20

10
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
TASAS DE OXIDACIÓN DEL HIERRO

Fe2+ + 1/2O2 + 2H+Æ Fe3+ + H2O

• Muy lenta a pH < 6 (salvo presencia de bacteria)


• Moderada a pH 6 - 8
• Muy rápida a pH > 8

Toda ta vida adela11te. I-21

Ejercicio 1 – Cálculo de la Carga de Acido


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Caudal = 100 m3/ hr


pH = 2
Fe(total) = 120 mg/L
Fe2+ = 40 mg/L
Mn = 15 mg/L
Al = 27 mg/L


" Toda ta vida adela11te. I-22

11
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Ejercicio 2 – Cálculo de la Carga de Acido

Caudal = 50 m3/ hr
pH = 7.2
Fe(total) = 320 mg/L
Fe2+ = ?? mg/L
Mn = 55 mg/L
Al = ?? mg/L

Toda ta vida adela11te. I-23


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Distribución de Hierro Ferroso (Fe2+) y Férrico


(Fe3+) como función del pH

100

Fe(OH)2
Fe(OH)3
Fe3+

Fe2+

0
0 2 3 6 7 8


" Toda ta vida adela11te. I-24

12
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Ejercicio 2 – Cálculo de la Carga de Acido

Caudal = 50 m3/ hr
pH = 7.2
Fe(total) = 320 mg/L
Fe2+ = ?? mg/L
Mn = 55 mg/L
Al = ?? mg/L

Toda ta vida adela11te. I-25

Por qué es necesario tratar el agua?


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Protección del ecosistema (condiciones de


descarga al ambiente)
• Maximizar el reuso del agua en el sitio (menores
costos de operación)
• Proteger la infraestructura (menores costos de
operación)


" Toda ta vida adela11te. I-26

13
Típicamente en Minerría y Metalurgia el
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Agua Residual es tratada por :


1. Neutralización de acidez
2. Remoción de elementos regulados (en su
mayoría metales y metaloides)
3. Control de toxicidad

Toda ta vida adela11te. I-27

Opciones para el Tratamiento del DAR


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Tratamiento físico (dilución/mezcla, humedales,


pozas de sedimentación)
• Tratamiento Biológico (humedales, tratamiento
microbiano, fitoremediación)
• Tratamiento químico (activo/pasivo)
• Combinaciones de los anteriores


" Toda ta vida adela11te. I-28

14
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Mecanismos para el tratamiento del DAR

• Control de pH (neutralización/precipitación)
• Adsorción/absorción
• Formación de complejos, quelación
• Mediación biológica (SRB)
• Reducción (SO4, Cr6+ to Cr3+, Se6+ to Se4+)
• Oxidación (Fe2+ a Fe3+, Mn2+ a Mn4+, As3+ a As5+,
seguido de precipitación)
• Electroquímica
• Sedimentación, floculación, filtración, sedimentación
• Intercambio iónico
• Cristalización

Toda ta vida adela11te. I-29

Cómo Remover Contaminantes


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Típicamente:
1. Los metales se extraen de la solución:
precipitados como sólidos o adsorbidos en
sólidos
2. Los sólidos son separados de la solución
3. Los residuos generados deben ser eliminados o
reutilizados


" Toda ta vida adela11te. I-30

15
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
METÓDOS DE REMOCIÓN

• Precipitación / Formación de Mineral


– Sulfuros, Hidróxidos o Carbonatos
• Adsorción –
– No de manera permanente,
– Se puede emplear para remoción temporal
– Se puede tener adsorción en compuestos orgánicos
o inorgánicos
• Formación de Compuestos Orgánicos
– No tan estable como los precipitados inorgánicos

Toda ta vida adela11te. I-31

Métodos de Precipitación Primaria


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Métodos de precipitación de metales:

1. Precipitación de hidróxidos
• Adición de caliza o NaOH

2. Precipitación de sulfuros
• Adición de H2S o reducción por sulfato

– Otros: Tratamiento Pasivo (biológico), Evaporación,


intercambio iónico, osmosis inversa,
nanofiltración..., para metales, compuestos
orgánicos, sulfatos, etc.


" Toda ta vida adela11te. I-32

16
Qué es Tratamiento Pasivo?
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• No requiere adición rutinaria de reactivos


• Costo de capital bajo a medio ($5-200k)
• Costo operativo muy bajo ($1-2k/yr)
• Aplicable a bajas cargas de ácido (i.e., acidez
total x caudal <150 kg CaCO3/d)
• Apliacado comunmente a sitios que ya no están
en operación
• Se adapta mejor a minas de carbón (e.g., pH,
Fe, Mn)

Toda ta vida adela11te. I-33

Tratamiento Activo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Requiere adición rutinaria de reactivo y


mantenimiento regular
• Costo de capital medio a alto (> $100k)
• Costo operativo medio a alto (> $50k)
• Se aplica a cualquier carga de acidez y
cualquier composición química del agua
• Comunmente aplicado a sitios operativos y no
operativos


" Toda ta vida adela11te. I-34

17
Métodos de Tratamiento Pasivo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Drenes aeróbicos de caliza • Lechos de lixiviación de


(OLD) o canales abiertos de escorias (SLB)
caliza (OLC) • Sistemas productores de
• Drenes anaeróbicos de caliza alcalinidad
(ALD) • Sistemas sucesivos de
• Pozos de derivación de caliza producción de alcalinidad
• Lechos de caliza Pyrolusite (SAPS)
(caliza con bacterias) • Coberturas productoras de
• Humedales aeróbicos alcalinidad
• Humedales anaeróbicos • Sistemas reversos de
• Humedales de flujo vertical producción de alcalinidad
(RAPS)
• Sistemas reactores microbianos
• Barreras reactivas permeables
(PRB)

Toda ta vida adela11te. I-35

Métodos de Tratamiento Activo


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Control de pH (neutralization/precipitation)
– Planta fija
– In-situ (portatil)

• Mediación Biológica (SRB)


• Adsorción/absorción
• Electroquímicos
• Sedimentación, floculación, filtración, decantación
• Intercambio iónico
• Cristalización


" Toda ta vida adela11te. I-36

18
Sistemas de Tratamiento Activo / Pasivo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Caudal
(L/s) 100 HDS
Dosaje
convencional

LDW (>10 t CaCO3/d)

In-situ
50 (móvil)
(3-5 t CaCO3/d)

Principalmente
pasivos (0.1-1 t CaCO3/d)

0 1500 3000
Acidez ( mg CaCO3/L)

Toda ta vida adela11te. I-37

Procesos de Tratamiento de Agua Ácida de Mina


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La Neutralización/Precipitación con cal es el


método más común y de mayor aceptación
• La acidez es neutralizada; los metales y el SO4
son precipitados

• Cal como CaO o Ca(OH)2

Me
~ ____________
...
2+ /Me3+ + H+ +SO 2- + Ca(OH) Æ Me(OH) /Me(OH) + CaSO + H O
_,,,,4 2 2 3 4 2

Agua Ácida de Mina Lodos


" Toda ta vida adela11te. I-38

19
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Reactivos de Neutralización
• Caliza •Carbonato de sodio
• Cal viva (Na(CO3)2 – sal sosa)
• Cal apagada •Hidróxido de sodio (NaOH –
• Dolomita ((Ca,Mg)CO3) soda cáustica)
• Hidróxido de magnesio •Hyroxyapatito
(Mg(OH)2)
•Amoniaco (NH3)
• Magnesita (MgCO3)
• Cenizas de hornos de cerámica •Hidróxido de potasio (KOH -
• Cenizas de centrales eléctricas potasa cáustica )
a carbón •Peróxido de calcio
• Cenizas de hornos de lecho •Carbonato de bario
fluidizado
•Reactivos basados en sílica
• Lodos alcalinos (pH 12 – 13)
•Residuos de pulpa de papel

Toda ta vida adela11te. I-39

Propiedades de los Reactivos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

pH Solubilidad (mg/L) Costo*


Reactivo
Saturado (en agua fría) ($/t de ácido neutralizado)

Caliza 8 – 9.4 14 15 - 45
Dolomita 8 – 9.5 10-300 15 - 45
Magnesita 9.5-10.5 60-100
Cal viva 12.4 1,300-1,850 130 - 300
Cal apagada 12.4 1,300-1,850 150 - 350
Hidróxido de Mg 9.5 – 10.5 10 – 60 300 - 650
Carbonato de Na 11.6 75,000 500
Soda cáustica 14 450,000 700 - 900
Amoniaco 9.2 900,000 400 – 600

*No incluye costo de transporte


" Toda ta vida adela11te. I-40

20
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Reactivos Alcalinos Comunmente Utilizados

Basicidad
Reactivo Fórmula Química Equivalente *
Cal viva CaO 1.00
Cal apagada Ca(OH)2 1.33
Cal dolomítica CaO.MgO 0.86
Dolomita hidratada Ca(OH)2 .MgO 1.02
Caliza rica en calcio CaCO3 1.79
Caliza dolomítica CaCO3.MgCO3 1.65
Soda cáustica NaOH 1.43
Carbonato de sodio Na2CO3 1.89
Óxido de magnesio MgO 0.72
Hydróxido de magnesio Mg(OH)2 1.04

* Peso relativo de reactivo requerido en comparación al CaO

Toda ta vida adela11te. I-41

Componentes de Costo del Reactivo


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Disponibilidad local
• Pureza
• Solubilidad / tasa de disolución / tamaño de
partícula
• Reactividad (calcinación)
• Eficiencia y metodología de mezclado y
dosificación


" Toda ta vida adela11te. I-42

21
¿Qué es la cal?
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Fuente: Caliza - CaCO3


• Cal viva (CaO): CaCO3 calcinado (@ ~900°C)
CaCO3 + C Æ CaO + CO2

• Cal apagada (Ca(OH)2): CaO hidratado o apagado


CaO + H2O Æ Ca(OH)2

• Requiere cuidados de manipulación y


almacenamiento

Toda ta vida adela11te. I-43

Beneficios de la Cal y la Caliza


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• pH / Calcio
• CaCO3 es efectivo a pH 6 – 7
• CaO y Ca(OH)2 son efectivos a pH 12.4
• Remoción de sólidos totales disueltos y sulfato
• Precipitación de metales / especiación de metales
• Coagulación / floculación
• Costo relativamente bajo
• Producto no protegido por patentes
• Muchas tecnologías desarrolladas


" Toda ta vida adela11te. I-44

22
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Factores que Afectan las Opciones de Tratamiento

• Costo • Distribución espacial y


• Aplicabilidad para el temporal del DAR
tratamiento y los objetivos (e.g., carga de acidez &
fluctuaciones del caudal:
de tratamiento filtraciones uniformes, eventos de
• pH, acidez, caudal lavado, aguas subterráneas,
fuentes simples o múltiples, etc.)
• Recursos localas
• Condiciones del sitio
(disponibilidad)
(e.g., clima y topografía)
• Estado redox (e.g.,
• Opciones de disposición
Fe2+/Fe3+)
de lodos
• Composición química
detalllada
(e.g., contenido de Al)

Toda ta vida adela11te. I-45


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Neutralización con Cal:


Estándar en la Industria

• ¿Porqué Neutralización con Cal?


– ¡La neutralización por cal funciona!
– Permite cumplir con los límites de descarga para
metales pesados
– Puede manejar grandes caudales
– Los costos son bajos en comparación con otras
alternativas
– Sistemas de tratamiento simple
– Los lodos puede ser almacenados de manera segura


" Toda ta vida adela11te. I-46

23
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Tratamiento con Cal

CAL

Floculante Efluente
(polímero) Limpio

•Incremento de pH
•Precipitado Separación
- Metales como (OH) (sólido/líquido) de
DAM - SO4 como CaSO4 lodos
- CaCO3
(Lodo)

Aire Lodos
(O2 + CO2)

Toda ta vida adela11te. I-47


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Etapas Comunes de los Sistemas de


Tratamiento con Cal

• Control de pH
– pH 8 sólo para Fe
– hasta 11 para Cd ó 10.5 para Ni
– típicamente 9.0-9.5 para soluciones de varios
metales pesados (Fe, Zn, Cu, Pb…)
• Mezcla/retención
– Permite la disolución de la cal y la precipitación de los
metales


" Toda ta vida adela11te. I-48

24
Química de la Neutralización
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Ca(OH)2 → Ca2+ + 2OH- Disolución de Cal

Fe2+ + 2OH- → Fe(OH)2


Fe3+ + 3OH-
Zn2+ + 2OH-
Mex+ + xOH-
→ Fe(OH)3
→ Zn(OH)2
→ Me(OH)x
} Precipitación de Metales

Toda ta vida adela11te. I-49


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Precipitación de Metales como Hidróxidos


Zn
10 4
..J

'Ea, 102
:i
o
~
cz:
1.0
1-
zw
u
z
ou
..J
¡:!;
w
2

4 6


" Toda ta vida adela11te. I-50

25
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
CONTROL DE PRECIPITACIÓN MEDIANTE pH

H2O Ù H+(ac) + OH-(ac)

H2CO3(ac) Ù H+(ac) + HCO3-(ac)


HCO3-(ac) Ù H+(ac) + CO3-2(ac)

H2S(ac) Ù H+(ac) + HS-(ac)


HS-(ac) Ù H+(ac) + S-2(ac)

A medida que se incrementa el pH, los aniones se tornan


disponibles

Toda ta vida adela11te. I-51

Remoción de Iones Metálicos mediante


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Neutralización/Precipitación
Concentración
Metal pH Comentario
Obtenida

Cr 7–8 < 0.5 µg/L Reducción de Cr6+ a Cr3+

Cu y Zn 9 – 10 < 0.1 mg/L

Pb y Fe3+ 9 – 10 Rango de µg/L

Obstaculizado por altas


Cd y Ni > 10 < 1mg/L
concentraciones de Fe

Mn > 10 < 1 mg/L Se requiere fuerte oxidación


" Toda ta vida adela11te. I-52

26
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Necesidad de Oxidación Ferrosa

• Los lodos férricos son mucho más estables en el


depósito
• Tratamiento más fácil con oxidación
– Separación sólido/líquido
– Viscosidad del lodo
– Concentración de Fe en el efluente
– Proporciona siperficies de adsorción para metales
• Fe(OH)2 + ½ H2O + ¼ O2 Æ Fe(OH)3

Toda ta vida adela11te. I-53


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Lodo oxidado (Fe3+) Lodo verde (Fe2+)


" Toda ta vida adela11te. I-54

27
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Lodo oxidado rico en Fe-Mn

Lodo oxidado rico en Fe-Al

Toda ta vida adela11te. I-55


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Etapas Comunes de los Sistemas de


Tratamiento de Cal
• Separación sólido-líquido
– Permite la sedimentación de óxidos/hidróxidos de
metales
– Puede incluir poza de limpieza o filtración
• Descarga
- Si la calidad cumple los estándares regulados
- Se puede requerir neutralización adicional de pH, si
existe un límite superior, mediante CO2 o un ácido (e.g.,
H2SO4)


" Toda ta vida adela11te. I-56

28
Modos de Procesos de Tratamiento con Cal
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Convencional (básico) en las pozas de


sedimentación
• Tratamiento del tajo
• Neutralización convencional con cal
• Sistemas de tratamiento de lodos de alta
densidad (convencional, en etapas, sistemas de
paso múltiple)

Toda ta vida adela11te. I-57

Tratamiento Convencional
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Tratamiento Básico de Poza


– Cal directamente añadida a la canaleta (ningún control de pH),
separación S/L en la poza de lodos, 1-5% de sólidos

LIME CO2

AMD
Settling Pond

EFFLUENT

SLUDGE

• Convencional
– Mecánicamente agitado, reactores con control de pH, 3-10% de
sólidos


" Toda ta vida adela11te. I-58

29
Tratamiento Convencional
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• VENTAJAS
– Bajo costo de capital
– Operación simple
– Se adapta mejor a DAM de baja acidez
– Por lo general, permite cumplir con los
requerimientos

Toda ta vida adela11te. I-59

Tratamiento Convencional
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• DESVENTAJAS
– Requiere área significativa para flujos típicos
– Baja eficiencia de cal
– Muy poco control - particularmente TSS
– Baja densidad de lodos – se debe bombear
periódicamente ($)
– Puede ocurrir incrustación de precipitados en el
reactor


" Toda ta vida adela11te. I-60

30
Pozas de Sedimentación
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• OPTIMIZACIÓN
– La mezcla mecánica y el control de pH pueden
incrementar la eficiencia de la cal
– Las bermas pueden ayudar a minimizar la ocurrencia
de corto circuito
– Minimizar la acción del oleaje (revestimiento de
árboles, bermas flotantes...)
APLICACIÓN
- Aplicado a DAM de baja acidez;
- La tendencia es convertirlo en un proceso más
eficiente (HDS)

Toda ta vida adela11te. I-61

Pozas de Sedimentación
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

INGRESO A LA POZA (VERTEDERO PARSHAL)


" Toda ta vida adela11te. I-62

31
Pozas de Sedimentación
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Control de pH

Toda ta vida adela11te. I-63

Pozas de Sedimentación
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Canaletas para mezclado


" Toda ta vida adela11te. I-64

32
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

"


Toda ta vida adela11te.
Toda ta vida adela11te.

I-66
I-65

Compuerta de descarga
Pozas de Sedimentación

Pozas de Sedimentación

33
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

"


Toda ta vida adela11te.
Toda ta vida adela11te.

I-68
I-67

Pozas de Sedimentación
Mina Falconbridge-Kidd

34
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Pozas de Sedimentación

Toda ta vida adela11te. I-69


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

TRATAMIENTO IN-SITU de 30,000 m3 de agua por pH y TSS


" Toda ta vida adela11te. I-70

35
Tratamiento en el Tajo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Tajo no operativo empleado para tratamiento


– pH controlado antes de la descarga en el tajo
– Profundidad útil para el almacenamiento de lodos
– Costo de capital razonable

Toda ta vida adela11te. I-71

Tratamiento en el Tajo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales


" Toda ta vida adela11te. I-72

36
Tratamiento en el Tajo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Toda ta vida adela11te. I-73

Tratamiento del Tajo


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

8 ~1 lp 11 u rl c
F ~ J.80 ~}. .'!.c id
PI I l.l~ ~ le: r R. ~ c lrc ul ~ I o n PII Eftue: n 1
r--------------------------------
• F l• cci..1 • "1
1
1
Tr~.:al~ il 8 1~1rrr
T~1rn t~ 'f
Llf'i1 ~
8y -s l e:rn

R. t tlC b r


" Toda ta vida adela11te. I-74

37
Tratamiento del Tajo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Toda ta vida adela11te. I-75

Fuentes de Cal
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Ca(OH)2 – Cal hidratada (apagada)


• CaO – la cal viva requiere un sistema de
apagado (con molino de bola; temperatura de
apagado crítica)

• CaCO3 – la caliza debe ser polvo fino;


• Debido a su propiedad de amortiguamiento, la
neutralización a pH ~ 6 puede requerir mayor
incremento de pH con cal o NaOH (i.e.,
neutralización en dos pasos)


" Toda ta vida adela11te. I-76

38
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

"


Toda ta vida adela11te.
Toda ta vida adela11te.

I-78
I-77
Sistema de Cal Hidratada

Unidad de Preparación de Cal

39
Unidad de Apagado
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Toda ta vida adela11te. I-79

Optimización del Proceso de Apagado


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La disolución de la cal en el agua es una reacción


exotérmica (genera calor)
• Temperatura de apagado debe ser >80oC
• Normalmente es ajustada por la temperatura del agua
utilizada para el apagado
• La temperatura debe ser controlada mediante una
termocupla
• Si es necesario, debe usarse agua caliente para el
apagado
• Los materiales granulares pueden ser molidos mediante
un molino de bolas para una óptima eficiencia de uso


" Toda ta vida adela11te. I-80

40
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Toda ta vida adela11te. I-81

Eficiencia del Proceso de Tratamiento con Cal


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

VENTAJAS DESVENTAJAS
• Bajo costo; • Formación de yeso;
• Control de proceso simple • Solibilidad de metales cercana
(se controla el pH); y al nivel regulado y varía con el
• Fácil separación sólido/líquido pH;
• Generación de lodo;
• Estabilidad química de
metales en el lodo;
• Baja eficiencia para el
tratamiento de efluentes que
contienen sustancias
orgánicas; y
• Remoción ineficiente de As,
Se, Mo, Sb, Hg.


" Toda ta vida adela11te. I-82

41
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Métodos de Neutralización con Cal y
Densidades de Lodo Resultante
Lime
Sludge or Tailings Pond
Acid Mine Drainage pH ~ 10
Over Flow
(AMD) Sludge retained in the pond
%S ~ 1-2

Type I - Lime addition to acid water: Conventional Method

AMD Air Air


pH pH Flocculant

Lime Clean Water


Slurry

pH ~ 9.5 pH ~ 9.5
Sludge Wastage
%S ~ 2 - 5
Type II - Lime addition to neutralisation reactors: Conventional Method

AMD Air Air


pH pH Flocculant

Clean Water

pH ~ 9.5 pH ~ 9.5
Lime
Slurry Sludge Wastage
Sludge Recycle %S ~ 10 - 30

Type III - Sludge recycled into lime slurry: High Density Sludge “HDS” Process

Lime
AMD Slurry Air
pH pH Flocculant

Clean Water
pH ~5 pH ~9.5

Sludge Wastage
Sludge Recycle %S ~ 20 - 35
Pontificia
Toda la vida ade I-83Density Sludge “HDS” Process
Type IV - Sludge recycle into acid water: High

42
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Proceso de Lodos de Alta Densidad


(Convencional)
SLUDGE LIME

AMD Lime/Sludge
Mix Tank FLOCCULANT
AIR

EFFLUENT

Clarifier

Rapid Mix
Floc Tank
Tank
Lime Reactor
RECYCLE DISPOSAL
SLUDGE

Toda ta vida adela11te. II-1

Mezcla del lodo con la Cal


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El lodo absorbe cal (OH-)


• Lo que produce una lenta liberación de (OH-) y
consecuentemente controla la tasa de
neutralización
• La recirculación del lodo promueve la formación
de cristales proporcionando partículas semilla


" Toda ta vida adela11te. II-2

1
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Mezcla de Lodo y Cal

Sólidos del Lodo Mezcla de Lodo y Cal

Toda ta vida adela11te. II-3


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Formación de partículas de cristales de yeso en el lodo


y ausencia de precipitados en equipos y tuberías

Proceso HDS Convencional (Boliden-Apirsa, España)


" Toda ta vida adela11te. II-4

2
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Proceso de Neutralización de Múltiples Pasos en


Etapas (Lodo en DAR para elevar pH)

• VENTAJAS
– Bajos volúmenes de lodo
– Posible formación de lodo cristalino (yeso)
– Excelente eficiencia de cal
– Menor incrustación en reactor y lavadores
– Ausencia de problema en Tanque de Mezcla Cal/Lodo
– Más apropiado para DAR de alta resistencia
(e.g., Boliden Kristineberg en etapas; Falun 3 pasos (múltiples))

Toda ta vida adela11te. II-5


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Proceso Convencional de
Lodos de Alta Densidad
• DESVENTAJAS
– Alto costo de capital
– Posible viscosidad del lodo
– Problemas de viscosidad/incrustación en el Tanque
de Mezclado de Lodo y Cal


" Toda ta vida adela11te. II-6

3
Aplicación de Proceso HDS de Múltiples Pasos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Nivel de
Mina Metales y SO4 (mg/l)
(m)
Composición
(Profundidad
Química del del Agua)
pH *FeT Zn Cu Al SO4

DAR de Falun
y su cambio 215 (0) 2.5 886 461 7.7 165 2,850

con la
Profundidad 220 (5) 2.5 8,530 2,280 8.3 365 36,300

232.8 (17.8) <1 14,000 3,100 1.5 450 55,500

* >90% en Fe2+
Velocidad del flujo: 30 m3/h

Toda ta vida adela11te. II-7

Proceso de Lodos de Alta Densidad


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(Neutralización en Etapas)

SLUDGE
AMD
LIME
AIR FLOCCULANT

EFFLUENT

Clarifier
Rapid Mix
Reactor #1 Tank
Floc
Reactor #2 Tank
RECYCLE DISPOSAL
SLUDGE

Con un tanque de mezcla rápida donde se agrega la cal


" Toda ta vida adela11te. II-8

4
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Procesos en Etapas (HDS de Dos Pasos)

CleanWater

Sludge Wastage
%S>30

Proceso HDS en Etapas (Planta de Tratamiento Boliden Kristineberg,


Suecia) por Golder Associates Ltd.
También los procesos Geco (Kuyucak & Sheremata, patente de EEUU
1995), y Tetra tienen características similares

Toda ta vida adela11te. II-9


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Procesos de Lodos de Alta Densidad


(Neutralización de Múltiples Pasos)
SLUDGE
LIME
AIR FLOCCULANT
AIR
AMD

EFFLUENT

Clarifier
R1 - pH 4.5 Floc
R2 - pH 6.9
R3 - pH 8.2 Tank
R4 - pH 9.5
RECYCLE DISPOSAL
SLUDGE

Neutralización de Múltiples Pasos


(pruebas a escala de laboratorio por CANMET;
3-pasos @ Falun, Suecia, por Golder )


" Toda ta vida adela11te. II-10

5
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Proceso Convencional de
Lodos de Alta Densidad
• VENTAJAS
– Bajos volúmenes de lodos
– Buena eficiencia de cal
– Menor incrustación en el reactor y los lavadores

Toda ta vida adela11te. II-11


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Proceso de Neutralización en Etapas y


Múltiples Pasos (Lodo en DAR para elevar pH)

• DESVENTAJAS
– Alto costo de capital
– Más complejo de operar/mantener
– Posible viscosidad del lodo e incrustación en el
primer tanque de cal


" Toda ta vida adela11te. II-12

6
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Mezcla de Cal y Lodo

Lodo

Cal

Boliden Apirsa,
España

Toda ta vida adela11te. II-13

Planta de Tratamiento HDS de Múltiples Pasos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

T.-.oi.d Mvnh;;llPtll Wtrt.,-

~ ~ ,-~ __ J ____ OUTOOOR

INDOOR.
_________

F re&h Weter
7
1 \
(or TnNllvd) 1
1 o,y 1
1 P'otymer 1
1 1
1
1
1


" Toda ta vida adela11te. II-14

7
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Micrografías del Lodo

Lodo de Baja Densidad HDS (mezcla de lodo y DAR


de múltiples pasos)

Toda ta vida adela11te. II-15


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Yeso Hidróxidos metálicos

Lodo del Proceso de Neutralización con Cal HDS en Etapas


" Toda ta vida adela11te. II-16

8
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Proceso de Recirculación Simple
Proceso aplicado para mejorar otros procesos existentes

• Reduce la incrustación y mejora la separación sólido/líquido


• No es un HDS real (MDS – lodos de densidad media)
• Puede ofrecer mayor claridad del efluente que los procesos HDS
cuando el clarificador está subdimensionado o hay un contenido
de sólidos demasiado alto

LODO

CAL CO2
DAM

EFLUENTE
LODO

Toda ta vida adela11te. II-17


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Densidad del Lodo


• HDS > 20% de sólidos
• Control de pH
• Tasa de reciclaje vs.
tasa de saturación

30

25
Percent Solids

20

15
10

5
0
Basic Conventional HDS
Tetra (Doyon) Geco S-N


" Toda ta vida adela11te. II-18

9
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Elección de Proceso
• Requerimientos Específicos al Sitio:
– Caudal de DAR
– Calidad del DAR (contenido de metales, acidez,
SO4…)
– Disponibilidad del terreno
– Duración esperada del tratamiento
– Filosofía monetaria: capital vs. costos operativos
– Estabilidad del lodo o problemas de almacenamiento

Toda ta vida adela11te. II-19


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Redundancia en el Reactor de Control

• Uso de dos sensores de pH en una ubicación


– Causa el cierre si un sensor de pH se encuentra
fuera del rango deseado
– Causa el cierre si dos sensores miden valores
sigificativamente diferentes
– Previene la alteración del clarificador (permite el
reinicio y liberación rápidas)
– Respaldo instalado en caso de falla


" Toda ta vida adela11te. II-20

10
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Cumplimiento de Límites de Descarga con


Neutralización con Cal

• Optimización del control de pH


• Sólidos totales en suspensión
• Concentraciones de metales regulados
(e.g., federal, provincial o estatal, específico al
sitio, específico a la industria, etc.)

Toda ta vida adela11te. II-21

Optimización del Control de pH


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Control de pH crítico
• Optimiza las variables PID
– Auto-sintonización por software puede compensar
cambios de caudal, variabilidad del agua cruda y
potencia de la pulpa de cal
– tasa en cascada empleada para las caídas de pH en
el proceso
• Ubicación apropiada de sensores de pH
• El pH se puede medir en diversos puntos
• Mantenimiento/recalibración


" Toda ta vida adela11te. II-22

11
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Separación de Sólidos y Control de Sólidos


en Suspensión
• Importancia del dimensionamiento (y tipo) del
clarificador
• Posible uso de filtración con arena (e.g., < 0.5 g/L de
sólidos)
• El uso de las pozas de limpieza ayuda
• Medición crítica: turbiedad
– Correlacionar los metales regulados críticos (Zn, Fe, Cu...)
– Parar la planta cuando se aproxima al límite de descarga

Toda ta vida adela11te. II-23

Velocidad de Sedimentación
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

25
Settling Rate (m/h)

20

15

10

0
Basic HDS Tetra (Doyon) Geco S-N

II-24

12
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Clarificador Circular
Water
level

lnfluenl

Flow pallern of lhe convenl1onal cenler leed clanher


Peri pheral
effluenl flume

Circular clarifier

Toda ta vida adela11te. II-25


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Clarificadores Circulares (Convencionales)

Clarificador/Espesador

Planta de Tratamiento por Precipitación/Neutralización con Cal HDS,


Boliden Apirsa, España

" Toda ta vida adela11te. II-26

13
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Medición del Nivel de Lodo en un Clarificador
Circular Convencional

II-27
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Clarificador Lamella

• Excelente para la claridad del rebose del


clarificador
• Compacto y se puede instalar en interiores
• NO produce lodo de alta cantidad
• Hecho para algunas plantas pequeñas en
América del Sur (Brasil y Chile)


" Toda ta vida adela11te. II-28

14
Clarificador Lamella
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Tube sett\er

'º""'°'-1:i,t Ir"""'°'
Sludge drawoff

lnfluent

Toda ta vida adela11te. II-29


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Clarificador
Lamella


" Toda ta vida adela11te. II-30

15
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Filtración con Arena

• Puede ser requerida si el contenido de sólidos es bajo


• Garantiza esencialmente el cumplimiento (así como el
control de pH) incluso en el caso de reglamentos
rigurosos
• Costosa, tanto en capital como en operación
• Difícil con aguas de alta incrustación
– Concentraciones de sulfato sobre 2,500 mg/L ocasionan
incrustación de yeso
– pH menor que 10 puede ocasionar incrustación de carbonato

Toda ta vida adela11te. II-31


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Pozas de Limpieza
• Ayuda a remover picos de turbiedad del rebose del clarificador
• Permite mayor tiempo para reaccionar frente a alteraciones de la
planta
• Sujeto a formación de corto-circuitos y resuspensión debido a
vientos fuertes
• No se puede confiar a esta etapa el cumplimiento de límites
LIME CO2

AMD
Settling Pond

EFFLUENT

SLUDGE


" Toda ta vida adela11te. II-32

16
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Flotación
•Emplea flujo de agua
supersaturada para crear
microburbujas
•Más difícil de operar ya que
hay más parámetros de control
•Eficiente para claridad, no
tanto para densidad de lodos

Toda ta vida adela11te. II-33


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Incorporación de Polímero

• Se puede emplear un tanque dedicado (con 2-3


min HRT)
O directamente en
• Lavador y clarificador bien alimentados
• Dos puntos de adición de solución diluida de
polímero
• Distribuidos en proporción de aproximadamente
60/40 en favor del 1er punto de adición


" Toda ta vida adela11te. II-34

17
Tendencias Típicas de TSS
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Clarifier
Polishing Pond
Sand Filter
Effluent Quality (NTU)

Time Scale

Toda ta vida adela11te. II-35

Efectos de Dosificación de Polímero


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

--- ~ ~ =:- - - - - -
'
:
'
: --
--!'
TURB ~ ITY


" Toda ta vida adela11te. II-36

18
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Efectos de Dosificación de Polímero

- -- -- -- -- ----------,----- -- -- -- -- -- -----•--------- - - - - - - - - _,. - - - - - - - - - - - - - - - - - - - -


' '
SLUD~EVIS t osrrr
r-------------------:- -------------------
'

Polyme.r Dosage (arbitrar:, units)

Toda ta vida adela11te.


.
. . ..
II-37
-..i
1
'tiiliiil
~ ,¡'4
!!

Efectos de Dosificación de Polímero


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

_.,. ..... ---:- - ....


. ~, : - .... - ... --: .. -
• SLUDGE DJ!NSin: , - ~_ ,
;:¡¡--------------1----------------1------------.... ---~---------------
] 1 1 --. -
1 1 1 ---
- ~-
= ------- ---- ---·' ----- --------- -·1 ----------- ----·1 ---- --------- --

Poi yrner Dosage (arbit rary u nits)


" Toda ta vida adela11te. II-38

19
Efectos de Dosificación de Polímero
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El error más común que cometen los operadores en la


separación S/L es la sobredosis de polímero (rango 2-
2.5)
– Densidad de lodos y efluente aceptable
– Ocasional problema de viscosidad de lodos
• Dosis óptima (unidades arbitrarias rango 1-1.5)
– Baja turbiedad, excelente calidad del lodo
• Determinación de dosis óptima de polímero
– Reducir alimentación de polímero hasta que se afecte la
turbiedad del rebose del clarificador, luego retornar a 5-10%

Toda ta vida adela11te. II-39

Efectos de Dosificación de Polímero


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

~----¡-.. ____ : -·
-


j¡'
3

[\, ..

su:odr. nF.NSITY
' /"~·
>· ~
:' 2 ,._ --------- ---:--- --- --- --- ----i- --- --- - ~"'-... ;.-----------------
¡
SL6DGE VISCOS!TY
¡ ·~ .. ~~ ..
•"

t 1 ............. .:................ : ···········-··-


" Toda ta vida adela11te. II-40

20
Neutralización con Cal - Conclusión
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El tratamiento con cal funciona... con control de pH y


remoción de TSS; La implementación práctica
requiere considerar
- Sistema auxiliar
- Determinación de costos
- Producción de residuos/lodo
• Tratamiento de poza: bajos costos de capital, pero altos
costos operativos
• Plantas de HDS: alto costo de capital, pero ahorran en
consumo de cal y costos de disposición de lodos

Toda ta vida adela11te. II-41

Retos Futuros
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

– Efluente de alta calidad


– Reglamentos más rigurosos (e.g., menores límites,
más parámetros, remoción de SO4)
– Aprovechamiento del agua tratada
– Uso de los lodos como recurso
– Perfeccionamiento de la tecnología para cumplir los
requerimientos futuros


" Toda ta vida adela11te. II-42

21
Posibles Usos de DAR Tratado
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Abastecimiento suplementario de agua potable


• Descarga al medio ambiente
• Reciclaje y reutilización industrial
• Uso agrícola
• Uso recreacional y para generación de energía
hidroeléctrica

Estudios piloto de Tratamiento de DAR en Túnel


Kingsmill…….

Toda ta vida adela11te. II-43


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Características de DAR Tratado


El DAR tratado aprobó:

• Pruebas biológicas/microbiológicas, como la prueba de


96 h, LC50 (Poecillia reticulata) y prueba de alga
(Daphnia pulex); y
• Pruebas toxicológicas (Chironomus callygraphus).
• El DAR tratado no sería tóxico para la “Vida Acuática” y
se podría incorporar al suministro de agua potable.
• Se demostró que el uso de DAR tratado es técnica y
económicamente posible


" Toda ta vida adela11te. II-44

22
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

AMD Treat
Herramienta Libre para la Estimación de Costos

• Celdas de tratamiento pasivo


• Tratamiento activo (cal y soda cáustica)
• Pozas de sedimentación
• Costos de capital
• Costos operativos
• NO ES UNA HERRAMIENTA DE DISEÑO –
todavía es necesario referirse a los principales
principios de dimensionamiento

Toda ta vida adela11te. II-45

Software AMD Treat


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Contiene muchas “herramientas” útiles


• Co-desarrollado por la Oficina de Minería
Superficial y el Departamento de Protección
Ambiental de Pennsylvania
• http://amdtreat.osmre.gov
• ¡No olvide leer los manuales!


" Toda ta vida adela11te. II-46

23
Curso de Especialización en Cierre de Minas y Pasivos Ambientales _ ri • x

Módulos de
PT
Módulos de
Tratamiento
Activo
Reactor de
Módulos Flujo
Auxiliares Vertical
(SAPS)
Herramienta Módulo de
de Acidez Costo
Módulos de
Costo
Operativo

Proje,ct ieootsRl.fllh<!lr'~
C~ j~t,t:n(l'C)l:Tro,,,tl,r,lm
'Slte,~ jFJSC-SRB~•Mlcel

Pantalla del AMD Treat


II-47

24
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Tratamiento con Reactivos Alternativos

• Precipitación de Sulfuros (H2S, Na2S)


• Carbonates (CaCO3, Na2CO3, MgCO3)

Tratamiento de Iones Metaloides Específicos


As, Se, Mo, etc.

rsidad Catóhca deJ fl ri'.i1


III-1

Métodos Primarios de Remoción


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Métodos de Precipitación de Metales


1. Precipitación de Hidróxidos
• Adición de Cal o NaOH

2. Precipitación de Sulfuros
• Addition of H2S or sulphate reduction

– Otros: Tratamiento Pasivo (biológico), Evaporation,


Intercambio Iónico, Osmosis Reversa,
Nanofiltración…, para metales, compuestos
orgánicos, sulfatos, etc.

III-2

1
Precipitación por Sulfuro
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Comparación de
Solubilidad de
Hidróxidos y Sulfuros
de metal como una
función del pH

Me + S → MeS↓

........
........
..... ,

III-3

Remoción de Metales por Precipitación de Sulfuros


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

CEU. E R~Vld. ·'tRErroS

-0-----M 1: DA'l'S

--- Zn E

III-4

2
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

La remoción de mercurio (Hg) puede ser lograda


mediante precipitación del sulfuro

Hg + S  HgS

rsidad Catóhca deJ fl ri'.i1


III-5

Reactivos Alcalinos Comunmente Utilizados


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Basicidad
Reactivo Fórmula Química Equivalente *
Cal viva CaO 1.00
Cal apagada Ca(OH)2 1.33
Cal dolomítica CaO.MgO 0.86
Dolomita hidratada Ca(OH)2 .MgO 1.02
Caliza rica en calcio CaCO3 1.79
Caliza dolomítica CaCO3.MgCO3 1.65
Soda cáustica NaOH 1.43
Carbonato de sodio Na2CO3 1.89
Óxido de magnesio MgO 0.72
Hydróxido de magnesio Mg(OH)2 1.04

* Peso relativo de reactivo requerido en comparación al CaO

III-6

3
Neutralización con Carbonato
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

CaCO3(s) + H2SO4(aq) ↔ CaSO4(s) + H2O + CO2(g)

CaCO3(s) + Fe2(SO4)3(aq) + 3H2O ↔ 3CaSO4(s) + 2Fe(OH)3(s) + 3CO2(g)

rsidad Catóhca deJ fl ri'.i1


III-7

Estimados de Solubilidades de Carbonatos [M] < 1.0 mg/L


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

1 1 1 1 1

Pb Cd Mn Zn Ca Mg

Fe Cu Ni
Sr

1 1 1

6 7 8 9 10
pH
III-8

4
Tratamiento de Molibdeno, Arsénico y
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Selenio

• No son contaminantes típicos – requieren


tratamiento específico
• Pueden ser removidos con sistemas de
tratamiento pasivo si las concentraciones y el
caudal son relativamente bajos
• El tratamiento activo por lo general requiere co-
precipitación

rsidad Catóhca deJ fl ri'.i1


III-9

Punto Crítico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• No puede tratarse mediante precipitación simple


ya que generalmente se presentan como
aniones y no como cationes, por lo que no
precipitan como hidróxidos…

III-10

5
Diagramas Eh-pH
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IJ

o.a ·
H,_Asl..],
"• ,,.
(, !i ·

--~-~-~-
. '

III-11

Co-Precipitación
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La co-precipitación se completa usando hierro


férrico (Fe3+)
• El pH debe ser regulado al valor apropiado para
el elemento

III-12

6
Tratamiento de Arsénico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El As puede removerse como arsenato de calcio


Ca3(AsO4)2 a un pH elevado (~12)
• El arsenato de calcio no es muy estable
• El As puede ser removido como arsenato
férrico, FeAsO4·xFe(OH)3 es mucho más estable
• Proporción Fe:As de al menos 3:1 para su
eficiente remoción y estabilidad a largo plazo

rsidad Catóhca deJ fl ri'.i1


III-13

Tratamiento de Arsénico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Tasas de remoción considerablemente mejores


con arsenato (As+5) que con arsenito (As+3)
• La oxidación puede ayudar a mejorar el
tratamiento (peróxido, oxígeno purificado, etc.)

III-14

7
Tratamiento de Arsénico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Ar.st·nk -rn11t~i11in~ r-----,----• AllrnH


Wa. ie W;il,e r
li'ttl'.i
l1 :1 ,l!Jm¡,c .hetah
(np tlon:1 1)
St:JUí·Ct'
1 1 1
1 1 1
1 1 1

JtH -1 1., ,:,

Slud ~~ U.is p11 a l

rsidad Catóhca deJ fl ri'.i1


III-15

Tratamiento de Molibedeno
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Significativos ensayos realizados por la mina


Brenda (B.C., Canadá)

• Codelco, Chile también está implementando


actualmente el tratamiento de Mo para la mina
El Teniente

III-16

8
Tratamiento de Molibdeno
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Mina Brenda estudió diferentes tipos de


sistemas de tratamiento en la década de los ‘90
incluyendo:
– Co-precipitación/adsorción con hierro
– Intercambio iónico
– Osmosis inversa
– Electrodiálisis
– Extracción con solventes
– Precipitación por sulfuro / reducción de sulfato
– Biosorción

rsidad Catóhca deJ fl ri'.i1


III-17

Tratamiento de Molibdeno
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Sólo las pruebas de adsorción de Fe presentan


resultados económicos consistentes
• Se han realizado muchas pruebas de laboratorio
y ensayos en campo
• El agua cruda contenía 2.7 mg/L de Mo
• Las pruebas variaban de pH 4 a 6 con adición
férrica de 2:1 a 40:1

III-18

9
Resultados de las Pruebas de Laboratorio
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

50

45
High steel
40 corrosion
Ferric Addition (mg/L)

rate at pH
35 values
below 4 Mo < 0.05 mg/L
30

25

20 Mo < 0.15 mg/L

15

10 Mo > 0.15 mg/L

5
3.0 3.5 4.0 4.5 5.0 5.5 6.0
pH

rsidad Catóhca deJ fl ri'.i1


III-19

Planta de Tratamiento de Molibdeno en Brenda


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Puesta en marcha en noviembre de 1998 por CAN$ 10.5


millones
• Capacidad hidráulica de 5,000 usgpm (19,000 L/min),
diseñada para 4,000 usgpm (15,200 L/min)
• Dos reactores con retención de ~3 minutos cada uno
• Adición férrica de 10:1 (aproximadamente 30 mg/L Fe3+)
• Ácido sulfúrico a pH 4.5
• Reactor clarificador de 39 m de diámetro (tasa de
elevación 1 m/h )
• Filtración de arena-antracita, neutralización de pH, poza
de limpieza (retención de 6 días)

III-20

10
Limpieza del Efluente
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Efluente del filtro de arena neutralizado a pH 8 - 9


• Remueve el Fe residual para cumplir con el límite de 0.3
mg/L
• La poza presenta una retención de 6 días
• Al principio, el Fe no fue removido con el uso de NaOH –
los hidróxidos de hierro no se asentaron en la poza
• Ahora se usa cal, ya que ayuda a coagular y asentar los
hidróxidos de hierro (con una pequeña adición de
NaOH)

rsidad Catóhca deJ fl ri'.i1


III-21

Cumplimiento de los Límites en el


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Efluente Final

• El límite para el efluente es 0.25 mg/L de Mo, y


0.03 mg/L después de la dilución en el medio
ambiente receptor
• La concentración real en el efluente por lo
general es de aproximadamente 0.03 mg/L, y
0.01 mg/L en el receptor
• La concentración de Fe es < 0.2 mg/L

III-22

11
Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Brenda produce aproximadamente 1,000 t/año


• Composición de lodos:
– 5% de Mo
– 44% de Fe
– 5% de carbono (orgánico e inorgánico)
– 2.5% de S
– Nada más por encima de 0.3%

rsidad Catóhca deJ fl ri'.i1


III-23

Disposición de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Poza de Drenaje (e.g., lodos en arena)


– La disposición en pozas es un método factible (el
más usado)
– Los lodos generalmente se mantienen estables y el
filtrado puede estar libre de iones metálicos, lo que
indica bajo contenido de metales en el agua
intersticial
– Al dejarlo abierto a la atmósfera, el potencial redox se
mantiene alto y los precipitados son estables
– Es la opción menos costosa

III-24

12
Rol del Aluminio en la Remoción de
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Metales y TSS

• El Al en el DAM forma precipitados de Al(OH)3


• Presenta sitios de adsorción para los iones
metálicos de manera similar al Fe(OH)3
• El aluminio (Al2(SO4)3) puede ser agregado a las
aguas tratadas y no tratadas para reducir los
TSS y limpiar los efluentes tratados

rsidad Catóhca deJ fl ri'.i1


III-25

Adsorción en el Al(OH)3
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

80
"8
] · 60
*~ 40
20 .

o 6 7 8
pH

III-26

13
Manejo de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Caracterización
– Propiedades y caracterización de lodos
• Estabilidad del lodo
– Métodos para predecir la estabilidad del lodo
– Factores que afectan la estabilidad del lodo
• Impacto del Proceso de Tratamiento en las
Características del Lodo
• Opciones para la disposición de lodos

rsidad Catóhca deJ fl ri'.i1


IV-1

Manejo de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Puntos Críticos
– Volumen
• Millones de m3 lodo/año
– Bajo porcentaje de sólidos
– ¿Estabilidad a largo plazo?
• amorfo
• Especiación de metales
• Yeso/calcita
• Estabilidad física

IV-2

1
Formación de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Los lodos comprenden :


– Oxidos-hidróxidos de metal, yeso, carbonatos
• La calidad del lodo se afecta debido a :
– Calidad del agua cruda
– Reactivos de neutralización
– Diseño del proceso

rsidad Catóhca deJ fl ri'.i1


IV-3

Propiedades del Lodo – Físicas


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Porcentaje de sólidos
– Secar por 24h a 60oC
• Peso constante
– Depende del proceso de tratamiento
• 1% a 40%
– Impacta en los costos de disposición
• Densidad en masa
– 1.05 a 1.37 g/cm3
– Estimación de % de sólidos y composición

IV-4

2
Propiedades del Lodo – Químicas
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Masa amorfa que contiene la mayoría de


metales (Fe, Zn, Cu, Cd…)
• calcita, yeso
• 2-30 µm
• pH 8.5 a 11
• Potencial de neutralización
– 100-900 t CaCO3 equiv.

rsidad Catóhca deJ fl ri'.i1


IV-5

Métodos de Disposición de Lodos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

 Lo más común es la disposición en pozas (sin


drenaje, e.g., lodo en arena/granular)
 El tipo de lodo puede requerir manejo especial
• Crear condiciones reductoras
(e.g.,lodo de aguas servidas en la parte superior del
lodo)
• Fijación con cemento
• Encapsulamiento (e.g., con geomembrane)

IV-6

3
Métodos de Disposición de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Pruebas a desarrollar:

, LODO

Lodo
1 Lodo en Lodo de •
Fijación Encapsulamiento
arena aguas
en servidas en con
pozas la parte cemento
superior del
lodo

IV-7

Prueba para Métodos de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Disposición de Lodos

• Pruebas para simular:


1. Lodo en lecho de arena expuesto a la atmósfera:
• Poza de almacenamiento con drenaje de de arena
2. Cobertura con lodo de aguas servidas:
• Para aplicar condiciones de reducción
3. Encapsulamiento:
• Simula disposición de membranas rellenas con lodo en el
tajo
4. Fijación con cemento

IV-8

4
Pruebas de Lixiviación en Columna
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Conceptualmente más realistas


considerando que simulan mejor
los procesos naturales de
lixiviación
• Se pueden emplear las
observaciones obtenidas de
pruebas en columna para estimar
el potencial impacto ambiental de
diversos escenarios de
disposición de lodos
• Requieren un periodo de
lixiviación (años) mayor para
evaluar la estabilidad del lodo a
largo plazo

rsidad Catóhca deJ fl ri'.i1


IV-9
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IV-10

5
Pruebas para Métodos de
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Disposición de Lodos
• Se riegan dos columnas abiertas (lecho de
arena y lodo de aguas servidas) con agua
destilada para simular la precipitación
• El drenaje de estas celdas es colectado y
analizado
• Luego de varias semanas (e.g., ~3 m), se
desaguan todas las muestras (e.g., centrifuga)
para colectar el agua de intersticial
• El agua intersticial es colectada y analizada por
metales

rsidad Catóhca deJ fl ri'.i1


IV-11

Pruebas para Métodos de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Disposición de Lodos

• Fijación con cemento:


– Como el cemento es alcalino, algunos metales (e.g.,
Mo) pueden ser liberados inmediatamente
– Esta opción también es costosa, por ello, se debe
realizar un análisis costo-beneficio

IV-12

6
Pruebas para Métodos de
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Disposición de Lodos
• Encapsulamiento con geomembrana

– Algunos metales (e.g., Mo y Fe) y sulfuros de metal


pueden permanecer estables
– Opción costosa (el lodo se debe desaguar en la
mayor medida posible e.g., filtración a presión)
– De alto riesgo debido a que podría ocurrir
movilización si la geomembrana se rasga.

rsidad Catóhca deJ fl ri'.i1


IV-13

Pruebas para Métodos de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Disposición de Lodos
• Condiciones reductoras:
– El objetivo es formar/mantener más estables los
complejos de sulfuros metálicos (e.g., FeS, CuS,
MoS2)
– Sin embargo, la reducción de hierro férrico a ferroso
puede causar movilización de As, Mo, etc.

IV-14

7
Opción Típica de Disposición de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Poza de drenaje (e.g., lodo en la arena)


– El embalse es un método factible (más utilizado)
– El lodo permanece, por lo general, estable y el filtrado
puede estar libre de iones metálicos indicando bajo
contenido de metales en el agua intersticial)
– Dejándolo abierto a la atmósfera, el potencial redox
se mantiene alto y los precipitados estables
– Es la opción menos costosa

rsidad Catóhca deJ fl ri'.i1


IV-15

Propiedades del Lodo para Disposición


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El lodo debe tener una textura apropiada para


que pueda ser filtrado
• El keke de lodo HDS podría alcanzar hasta 50-
60% de sólidos, con densidad promedio de 15%
de sólidos empleando filtración al vacío o a
presión
• Los iones metálicos usualmente se mantienen
estables en los sólidos durante la filtración
• El lodo secado se podría reciclar en una
fundición (e.g., mina GreyEagle de Noranda)

IV-16

8
Consideraciones para la Disposición de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Capacidad de drenaje
• Densidad de la pulpa – contenido de humedad
• Volumen – tasa de producción
• Estabilidad del metal – alcalinidad disponible
• Composición del lodo
• Economía

rsidad Catóhca deJ fl ri'.i1


IV-17

Opciones para la Disposición de Lodos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Disposición en la poza
• Co-disposición
• Disposición en labores mineras
• Lodo en el relleno de mina
• Reprocesamiento del lodo
• Estabilización con aditivos
• Disposición en rellenos sanitarios
• Opciones de reutilización de lodos
• Gestión de lodos en el norte de Canadá
• Rehabilitación

IV-18

9
Disposición de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Sistemas de disposición específicamente


diseñados («Pozas de Lodos»)
• Dos pozas con drenaje de arena y dique de filtro
para uso alternado
• El drenaje puede conducir al área de relaves o
la toma de la planta de tratamiento
• Desagüado eventual de lodos > 80% debido a:
1) drenaje, 2) evaporación, y 3) congelamiento-
descongelamiento

rsidad Catóhca deJ fl ri'.i1


IV-19

Densificación por Congelamiento/Descongelamiento


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Durante el congelamiento las moléculas de hielo


empujan los precipitados metálicos hacia los costados,
produciendo su compactación
• Durante el descongelamiento el agua se derrite y deja
las partículas en una forma compactada
• Con un ciclo, se puede obtener > 80% de desaguado

Congelamiento/Descongelamiento es una buen método


para desaguar lodos
El uso alternado de múltiples celdas de lodo puede
incrementar los beneficios del proceso de
congelamiento/descongelamiento

IV-20

10
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Congelado/ Filtrado
Descongelado
al vacío

Lodo Congelado/Descongelado tiene


Oxidado Lodo reducido menor volumen y textura granular
rsidad Catóhca deJ fl ri'.i1
IV-21

Disposición en la Poza
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Áreas de desagüado y
almacenamiento
• Aspectos críticos
– Viento – resuspensión,
emisión de polvo
– Costos del terreno
– Falla de la poza –
propiedades tixotrópicas
del lodo

IV-22

11
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Celdas Múltiples de
Disposición de Lodos

IV-23

Disposición en la Poza
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Tipos
– Excavación, presa de tierra, concreto, revestido, con
formación de playa
– Limpieza y/o almacenamiento a largo plazo
• Costos
– Depende de la tasa de producción de lodos,
estabilidad
– Se puede requerir remoción mecánica de lodos
($10-20/m3)
• Mina Kidd ~ $1M/año
– Revestimientos sintéticos ~ $4-$12/m2

IV-24

12
Disposición/Almacenamiento de Lodos y
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Diseño de la Poza de Lodos

IV-25

Pozas de Drenaje
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

LODO

TUBERIAS DE DRENAJE

Estas pozas permiten el


drenaje del agua en exceso
desde el fondo y la
evaporación en la
superficie.
Las pozas se pueden vaciar
y reutilizar periódicamente
si así se desea

IV-26

13
Efecto de Congelamiento/Descongelamiento
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

y Desaguado

rsidad Catóhca deJ fl ri'.i1


IV-27
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

60%S en promedio

Desaguado del lodo mediante


filtrado al vacío para su
disposición en relleno
sanitario (Falun, Suecia)

IV-28

14
Co-disposición de Relaves-Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Lodo mezclado con relaves


antes de la disposición
– ~< 5% de lodo en relaves
– Llena espacios vacíos en el
relave
– Sólo reduce la movilidad de
metales a corto plazo
– Plazo mayor
• Ocurrirá disolución/agotamiento
del lodo
• Mayor grado de oxidación

rsidad Catóhca deJ fl ri'.i1


IV-29

Co-disposición con otros residuos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Elimina instalaciones adicionales


de gestión de residuos
• Ambiente de co-disposición de
lodos-relaves
– Beneficioso tanto en términos de
estabilidad del lodo como en
reducción de generación de acidez al
menos en el corto plazo.
• Fuente adicional de alcalinidad
• Llena los vacíos entre partículas y
reduce la penetración de agua y
oxígeno

IV-30

15
Codisposición con otros residuos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El lodo se puede volver inestable si entra en contacto


con mayores niveles de acidez
– Oxidación de sulfuro
• El lodo de cal nunca se debe depositar con residuos de
sulfuro parcialmente oxidados, ya que la lixiviación de
metales es inevitable

Tailings Relaves
Tailings codisposed Partial sludge
Relaves Disolución parcial
codispuestos
with sludgecon dissolution
del lodo
lodos

rsidad Catóhca deJ fl ri'.i1


IV-31

Disposición en Labores Mineras


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Consideraciones
– Capacidad de la mina,
espacios vacíos,
configuración
– Propiedades del lodo –
viscosidad
– Disposinibilidad y acceso al
sitio
• Ventajas
– El llenado de los vacíos de
mina puede reducir la
subsidencia
– El lodo puede ayudar a la
neutralización del agua de
mina
– Bajo consumo/rehabilitación
de la superficie del terreno

IV-32

16
Disposición en Labores Mineras
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El lodo se bombea/transporta en camión a las


perforaciones en minas subterráneas profundas
inactivas
• La alcalinidad del lodo proporciona cierta
neutralización del agua ácida de mina
• El hidróxido férrico no se disuelve, más bien se
acumula en las labores
• No se requiere rehabilitación de la superficie
• Se emplea como material de relleno luego de ser
mezclado con relaves benignos y estabilizado
(e.g.,con cemento)

rsidad Catóhca deJ fl ri'.i1


IV-33

Disposición en Tajos Inundados


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Arrastre
productividad

reemplazo
Lo

1. Sólidos en suspensión
do

Mezcla

P 2. Productividad
O2 3. Oxígeno disuelto
4. Arrastre
5. Mezclado de toda
la laguna

IV-34

17
Lodo en el Relleno
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El relleno en pasta es una práctica


común en la industria minera.
Integración de lodos y escoria como
material de relleno para reducir la
cantidad de residuos a disponer en
superficie
• Estabilización por cemento de la
escoria, relave y lodo (Kristineberg)
• Estabilidad físico-química
• Mina Pogo (Alaska)
– Lodos de las instalaciones de tratamiento
de aguas dispuestos como relleno
subterráno durante la operación

rsidad Catóhca deJ fl ri'.i1


IV-35

Reprocesamiento de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Los lodos pueden contener


concentraciones
significativas de metales
– Zn, Cu, Ni
– Recuperación de metales para
compensar costos
• Métodos Hidrometalúrgicos
– Extracción por solventes
– Intercambio iónico en lecho
fluidizado
– Lixiviación ácida

IV-36

18
Reprocesamiento de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Fundición
– Requiere secado del
lodo (en secadora
giratoria a menos de
20% de humedad)
– Impactos de
impurezas
– Ningún costo de
disposición adicional,
reciclaje, ningún
pasivo adicional

rsidad Catóhca deJ fl ri'.i1


IV-37

Lodos de Fundición - Ejemplos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• California Gulch de Asarco


– Pb reciclado al bullion, Cu a la mata, Cd al polvo del filtro de
manga, y Zn, Fe, Al y otros metales traza a la escoria.
– El beneficio principal de la adición de lodos fue el contenido de
cal y las unidades de Pb y Cu incidentales se recuperaron bien.

• Fundición Pasminco Port Pirie (PPPS), Sur de Australia


– Neutralización con cal, sulfuro de sodio y cloruro férrico
– La pulpa se espesa y filtra retornando los sólidos a la fundición
para reprocesamiento.

Noranda Grey Eagle, California, embarcado a Quebec Canadá


(recuperación de Cu)

IV-38

19
Factores que Afectan la
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Densidad de los Lodos

1. Calidad del agua cruda


2. Diseño del proceso
3. Reactivos (álcalis y floculante)
4. Parámetros operativos del proceso
5. Equipos del proceso

rsidad Catóhca deJ fl ri'.i1


IV-39

Concentraciones de Metales en DAM


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Fe y Cu se densifican bien si están en


concentraciones suficientes
• Al, Zn, Mn y Ni no se densifican tan fácilmente
• Con menos de 100 mg/L de metales totales,
difícil de alcanzar 15% de sólidos
• Con más de 200 mg/L Fe o Cu, se espera más
de 20% de sólidos con el proceso HDS

IV-40

20
Características de DAM
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

:J'
l!h500
se
o Concentraciones
~400 promedio de
metal:
e41 Fe – 259 mg/L
Zn – 179 mg/L
~boo
o
Cu – 17 mg/L
pH ~ 2.7
u

10 20 30 40 ~o &o 10 so
Time (days)

rsidad Catóhca deJ fl ri'.i1


IV-41

Reactivos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Álcali utilizado para formar HDS:


• Cal viva > cal hidratada > soda cáustica
• Floculante (polímero)
– Algunos polímeros son mejores en la densificación
– La sobredosis del floculante reducirá la densidad

IV-42

21
Resultados Piloto de la Densidad de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

!i

!il J!i 11111


Time Cho11nil

rsidad Catóhca deJ fl ri'.i1


IV-43

Calidad del Efluente


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

con Concentración de Polímeros

IV-44

22
Densidad del Lodo – Tamaño de Partícula
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

30

-
#
1:
25 •
-- -- - . - -- ---- .-,-• -- -- - . - -- -
AJl1;¡Ji

11
Lime
Causti:

~0 20
(.J
""0 15 •;e •
0
d)
10
• -'
'll
0l
""0
::,
1-i-
'

ci3 5
•! •:
o

4 6 8 10 12 14 16 18
Sludge Particle Size - 90% passing (microns)

rsidad Catóhca deJ fl ri'.i1


IV-45

Diferencia entre LDS y HDS


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Lodo de Baja Densidad (1 a 10% de sólidos) es


una masa suelta, amorfa (como copos de
algodón)
• Lodo de Alta Densidad (15 a 30% de sólidos)
contiene partículas discretas (como billas de
rodajes)
• El tamaño de partícula parece más grande con
LDS

IV-46

23
Micrografías de Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Lodo de Alta Densidad (HDS) Lodo de Baja Densidad (LDS)


(billas de rodajes) (copos de algodón)

rsidad Catóhca deJ fl ri'.i1


IV-47
de Especialización en Cierre de Minas y Pasivos Ambientales

14
Viscosidad/Filtrabilidad

12
10 • viscosidad vs. contenido de sólidos
8 • Capacidad de filtración (capacidad de
6 desagüado)
4 → El lodo debe tener textura granular
Curso

2 para desaguar
0
Viscosidad Capacidad de Filtración
IV-48
Cominco Geco S-N Tetra (Doyon)

24
Proceso – Reciclaje
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Según la literatura, proporción de 20:1 ó 25:1 de


sólidos reciclados a sólidos formados
– (masa de sólidos reciclados por unidad de
tiempo):(masa de sólidos formados por unidad de
tiempo)
• Experiencia: sólo se necesitan los sólidos
suficientes en el reactor de neutralización para
forzar las reacciones deseadas
– 10 g/L generalmente suficiente
– Más de 25 g/L es perjudicial para la calidad del
efluente

rsidad Catóhca deJ fl ri'.i1


IV-49

Proceso HDS – Densificación


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(Tipo I – Mezcla “Convencional” de lodo/cal)

• HDS se forma a medida que :


– El lodo se recubre con partículas de cal en el tanque
de mezclado de lodo/cal
– Fuerza la ocurrencia de reacciones de precipitación
en la superficie de partículas
– Incrementa el tamaño de partícula, la velocidad de
sedimentación y la densificación

IV-50

25
Proceso HDS – Densificación
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(Tipo II – Mezcla “En Etapas” de Lodo/DAM)

• Produce HDS debido a


– Disolución parcial de lodo cuando está en contacto
directo con DAM
– Causa un incremento de pH y la precipitación de
metales en el primer reactor
– Esto ocurre en la superficie de las partículas
existentes, causando así el incremento del tamaño de
las partículas

rsidad Catóhca deJ fl ri'.i1


IV-51

Pruebas Piloto - Resultados de Densidad del Lodo


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Comparación de las Propiedades del Lodo

Mecla Lodo/DAM Mezcla Lodo/Cal

IV-52

26
Proceso HDS – Densificación
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(Tipo II – Mezcla “En Etapas” de Lodo/DAM)

rsidad Catóhca deJ fl ri'.i1


IV-53

Comparación de Propiedades de Lodos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IV-54

27
Control del Proceso
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Necesita:
– Buen control del pH
– Oxidación de hierro ferroso
– Sólidos suficientes para que ocurran las reacciones
deseadas (tasa de reciclaje)

rsidad Catóhca deJ fl ri'.i1


IV-55

Equipos de Proceso
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Reactores
– Tiempo mínimo de retención 20 minutos
– Se recomienda retención de 30 - 45 minutos
• Clarificador
– Para clarificación, mínimo velocidad de elevación de
1 m/hr
– Cuanto mayor mejor (tanto para el efluente como
para el lodo)

IV-56

28
Densidad del Lodo – Tamaño del Clarificador
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

25 , - - - - - ~ - - - ~ - - - ~ - - - ~ -- - -,

. •-- - . ' '


Densidad de lodos (% sólidos)

- - -~ - -- - - - ----- -:- - -- - - - - - - - -~- - - - ----- - - -

.
20 - - - - -- -- - --~ - - - -
1 1 1 1

15
:
- - - - - - - - - - -r - - - - - - - - - - - - r - - - - - - - - - - - -,- - - - - - - - - - - - --,- - - - - • - - - - - -

10 --- --- ----_._ __------- -- -'- - -------- ___,_ - -- -- -- -- - - _._ ., __ ----- - - -


: : : t

5 -- - - ... - ----; -- --- - -- -- - -~ - - - --- - ----..,:- ------ - - ---""\---- - --- -- - -



o ~~~~~~~~~~~~~~~~~~~~~

o 500 1000 1500 2000 2500


Clar1tier Densiflcation Surface Area (m2)

rsidad Catóhca deJ fl ri'.i1


IV-57

Densidad Mayor en Sistemas de Poza


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Es posible en algunos casos reciclar el lodo con


una draga o bomba sumergible
• El reciclaje:
– Reduce el consumo de cal (mejora la eficiencia)
– Incrementa la densidad del lodo
– Mejora la sedimentación y la eficiencia del
tratamiento

IV-58

29
Densidad de Lodos – Conclusión
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Afectada principalmente por la composición


química del agua cruda y el diseño del proceso
• La densidad del lodo se forma precipitando
sólidos en la superficie de las partíuclas
existentes
• Los clarificadores grandes mejoran la densidad
del lodo
• Los parámetros de operación del proceso y la
selección de reactivos son críticos

rsidad Catóhca deJ fl ri'.i1


IV-59

30
Estabilidad del Lodo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Actualmente no se existen protocolos de


lixiviación regulados para lodos o residuos
sólidos mineros
• Las actuales pruebas de lixiviación (TCLP)
emplean ácido acético
– El ácido orgánico no imita el escenario de disposición
– Moviliza metales como Pb que normalmente no se
movilizarían
• La solución de lixiviación de lluvia ácida sintética
(SPLP) es más apropiada

rsidad Catóhca deJ fl ri'.i1


V-1

Pruebas de Lixiviación por Lotes


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Normado (ácido acético)


– TCLP – Procedimiento de Lixiviación
de Característica de Toxicidad
– simula ácidos orgánicos típicamente
presentes en rellenos municipales
• Modificado (lluvia ácida sintética)
– Diseñado para simular ambientes de
disposición de residuos mineros
– SPLP – Procedimiento de Lixiviación
por Precipitación Sintética
• Agitación agresiva
• Simula lixiviación a largo plazo

V-2

1
Estabilidad del Lodo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Las concentraciones de solución de lixiviación fueron,


por lo general, 5 veces menores que los límites
regulados
• En general, el lodo aprueba consistentemente las
pruebas de lixiviación con lluvia sintética
• Ocasionalmente el lodo ‘desaprueba’ las pruebas tipo
ácido acético
– Zn, Cd, y Ni son los más móviles
• Los lodos con mayor cantidad de carbonato se
desplazan mejor
• El lodo con mayor cristalinidad es más estable
• Los lodos antiguos se cristalizan y estabilizan

rsidad Catóhca deJ fl ri'.i1


V-3

Capacidad de Lixiviación de los Metales


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(Estabilidad)
• La estabilidad de los lodos está indirectamente
relacionada con el tipo de proceso de tratamiento
• Sistema de tratamiento básico
– La cantidad de consumo de cal es alta
– Alto grado de alcalinidad en exceso
– Reducción de lixiviación de metales; y
– Estabilidad prolongada del lodo
• Tratamiento de lodos de alta densidad
– Menores niveles de alcalinidad en exceso
– La utilización de cal es muy eficiente
– Mayor grado de cristalinidad

V-4

2
Contexto Regulatorio
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Los lodos de tratamiento son productos


residuales que pueden caer bajo el ámbito de la
legislación sobre gestión de residuos
• Pruebas de extracción de lixiviados empleadas
para evaluar si el residuo se clasifica como
peligroso
• Los reglamentos para lixiviados varían según la
jurisdicción y las licencias específicas al sitio

rsidad Catóhca deJ fl ri'.i1


V-5

Límites Regulatorios para Solución de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Lixiviación
Pammotor FJdcrnl RogulGtory Limit (mg/L)
(us: (Canada)
Arsenic 5 2.5
Bariu11 100 1 OJ
Bc,ron - 50J
Cadmiun 1 O5
Chromium 5 5
Lead 5 5
Mercury 0.2 0.1
Sclorium 1 1
Silver 5 -
Uranium - 1O

V-6

3
Factores que Afectan la Estabilidad de los Lodos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Todos los lodos de cal se


volverán inestables con la
adición de una cantidad
suficiente de ácido
• Se requieren miles de años de
precipitación marginalmente
ácida que percole por el lodo
para proporcionar una
depresión modesta de pH
• Las muestras de lodo
sometidas a prueba (por lotes)
produjeron un pH de solución
de lixiviación final que oscila
entre 5.0 y 10.6
• La capacidad de lixiviación del
lodo depende enormemente del 12
pH de la solución de lixiviación
final

rsidad Catóhca deJ fl ri'.i1


V-7

Alcalinidad en Exceso
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La alcalinidad en exceso sirve


para reducir la capacidad de
lixiviación de los metales
– Incrementa la estabilidad del lodo a
corto plazo
– Amortigua el pH en la región alcalina
o neutral, limitando el grado de
lixiviación de metales.
• Se examinó la adición de cal en
exceso a los lodos de
tratamento tipo HDS
– Menor lixiviación de metales
– Formación de etringita
– Propiedades de manipuleo malas

V-8

4
Alcalinidad Disponible
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

600

500

400

300

200

100

0
Basic Conventional Cominco
Tetra (Doyon) Geco SN

V-9

Factores que Afectan la Estabilidad del Lodo


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Hidróxido
Ferroso
Verde

Hidróxido
Férrico
Naranja

V-10

5
Lixiviabilidad de Metales (Estabilidad)
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La estabilidad del lodo se relaciona indirectamente


con el tipo de proceso de tratamiento
• Sistemas de tratamiento básico
– La cantidad de cal consumida es alta
– Alto grado de alcalinidad en exceso
– Reducción en la lixiviación de metales; y
– Prolongada estabilidad del lodo
• Tratamiento de lodos de alta densidad
– Menores niveles de alcalinidad en exceso
– La utilización de cal es muy eficiente
– Mayor grado de cristalinidad

rsidad Catóhca deJ fl ri'.i1


V-11

Cristalinidad del Precipitado


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La liberación de metales de los


precipitados cristalinos es, por
lo general, menor que la del
material amorfo o con
cristalización deficiente
• La estabilidad del lodo
depende de la estabilidad de la
masa amorfa
• Los procesos que promueven
la cristalización por lo general
producen lodos con menor
propensión a lixiviar metales

V-12

6
Envejecimiento del Lodo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Los lodos se densifican con el tiempo


– Incremento de 25% (mínimo)
– Congelamiento-descongelamiento
– Desagüado natural
• El tamaño de partícula se incrementa con la
antigüedad
– Recristalización de calcita
– La proporción de calcita y yeso se incrementa con el
tiempo
• Menores Eh y pH en el material antiguo
• Los lodos antiguos presentan menor propensión
de lixiviación de metales que los lodos frescos

rsidad Catóhca deJ fl ri'.i1


V-13

Envejecimiento del Lodo


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Efecto en la Estabilidad del Lodo


250

• 60oC

200 • 25oC

• 4oC

150
[Zn] (mg/L)

100

50

0
1 - sat
1 - atm
6 - sat
.......... ,r,....
6 - atm
12 - sat
___
·---- ... .. ... ,
12 - atm
25oC
60oC
4oC

Aging Time (months - conditions)

V-14

7
Ambiente de Disposición
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El método de
disposición en última
instancia afecta la
estabilidad del lodo a
largo plazo
• El lodo puede volverse
inestable si entra en
contacto con niveles
moderados de acidez

rsidad Catóhca deJ fl ri'.i1


V-15

8
Temas Emergentes
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

•Remoción de sulfato
•Remoción de Amonio y nitrato
•Tiosales (en efluente de minas en operación)

rsidad Catóhca deJ fl ri'.i1


VI-1

Remoción de SO4
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

La cal puede retirar hasta ~2,000 mg/L


(i.e., límite teórico de solubilidad del “yeso” CaSO4)

 Podría requerse para cumplir con los límites regulatorios:

• Tratamiento Químico: BaCl2, precipitación de Al(OH)3


(Savmin)
• Tratamiento Biológico: Bacterias sulforeductoras
• Tratamiento Electroquímico (e.g., ecodose)
• Membrana (osmosis inversa con evaporación)

VI-2

1
Proceso de Remoción Biológico de SO4
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Fundamentos del Tratamiento


– Remoción biológica del sulfato en presencia de una
fuente de carbono con bacterias sulforeductoras
(SRB):
2C2H5OH + 3SO42- → 3HS- + 3HCO3- + CO2 + biomasa

 El HS- generado es oxidado, produciendo lodos


con azufre
• 0.67 kg DQO º 1 kg SO4
• 1.0 kg alcalinidad º 0.96 kg SO4

rsidad Catóhca deJ fl ri'.i1


VI-3

Evaluación del Proceso Paques Thiopaq


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Configuración del Proceso


Proceso compuesto por tres pasos:
• precipitación de metales al inicio
• reducción del sulfato (SO4 ® H2 S)
• oxidación del sulfuro ( H2 S ® S)
Dos flujos de reciclaje:
• reciclado de sulfuro para precipitación de metales
• reciclado de alcalinidad para neutralizar el agua de mina

VI-4

2
Proceso de Remoción Biológica de SO4
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Carbono

Separador
de H2S

Agua Ácida Reducción Agua de Mina


Limpieza
.....__________)
de Mina de Sulfato Tratada

Sulfuro
a Lodo con
Azufre Azufre

rsidad Catóhca deJ fl ri'.i1


VI-5
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

4431-202

Product
Water

Waste
Sludge
Sludge
Recycle Pumps
Waste
Sludge

stripping
Steam Gas
Bioler

502 Scrubber

H2 Absorption
SprayTower

VI-6
Figure 3 -A: Biological Sulphate Removal Process • lntegrated Process Flow Diagram

3
Proceso Electroquímico de Remoción de
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Sulfato (Proceso Ecodose)

Descripción del Proceso


Procesos electroquímicos:
Zn ® Zn2+ + 2e-
2H+ + 2e- ® H2(g)
El Zinc precipita el sulfato bajo condiciones favorables.
Zn4 (OH)6 SO4 Þ 2.7 kg Zn /kg SO 4
Zn2 (OH)2 SO4 Þ 1.36 kg Zn /kg SO4
 El SO4 es removido como lodo de ZnSO4, que puede ser
recuperado.
rsidad Catóhca deJ fl ri'.i1
VI-7
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Sistema Piloto Ecodose

VI-8

4
Remoción de Sulfato por el Proceso Mintek Savmin
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Fundamentos del Proceso


Savmin es un proceso que consta de tres pasos:
• neutralización, remoción de metales, cristalización del
yeso.
• remoción selectiva del sulfato por precipitación de
etringita
• ablandamiento y ajuste de pH

Recuperación secundaria de aluminio para para su


recirculación al proceso principal.

rsidad Catóhca deJ fl ri'.i1


VI-9
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Lime Lime co,

Acidmine
water
..,,,,..,.
Ettrlnglte Product
water
removal

Gypsum Calcium
sludge Carbonate
slud e

Allumlnlum
H,SO, n,covwy

VI-10

5
Curso de Especialización en Cierre de Minas y Pasivos Ambientales 4431-201

MilkofLime
Lime Saturator
DosingPump
Recycle Pump

Recarbonation
TowerFeed
Pump

Acid Mine
Water

Gypsum
Recycle
Pumps

VI-11
Gypsum Sludge Gypsum Sludge
Recycle Pump WastePump

Remoción de Cianuro, Compuestos de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Nitrógeno y Tiosales
• QUÍMICA
– H2O2, ozono u oxidación de cloro
– SO2 & oxidación por aire (para CN)
– Complejación y precipitación (para CN)
– Cloración alcalina
– Intercambio iónico (para NO3)
• BIOLÓGICA
– Aeróbica (para CN, NH3, tiosales)
– Nitrificación: NH3+ O2  NO3
– Anaeróbica (para NO3)
– Desnitrificación: NO3 + Corg  N2 - + CO2-

VI-12

6
DISEÑO CONCEPTUAL PARA LA REMOCIÓN BIOLÓGICA DE COMPUESTOS DE
NITRÓGENO EN AGUAS DE MINA
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

ONC PO R LA EDUCTION IOt..OBtQUE DES CO P ES AZOTES


co CEPT A DESIG FOR IOl.OGl AL REMOVAL tlllTRO co pou o
FROM Mll'IIE WATERS

VI-13

Formación de Tiosales
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Tiosales: Especies intermedias de azufre “polisulfuros (Sn2-)”


que ocurren entre el sulfuro (S2-) y el sulfato (SO42-)

Las tiosales se forman:


• Durante la molienda y flotación de los minerales de sulfuro complejo
• Por oxidación del grupo sulfuro (S22-) (e.g., pirita-FeS y pirrotita-
FeS2) por oxígeno (O2) y particularmente a pH neutro o mayor

FeS2 + 2O2 + H2O  Fe2+ + 2OH- + 2S0

4S0 + 6OH-  2S2- + S2O32- + 3H2O

3S2O32- + 2O2 + H2O  2S3O62- + 2OH-

4S2O32- + O2 + 2H2O  2S4O62- + 4OH-

VI-14

7
Impacto de las Tiosales en el Ambiente
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La oxidación de las tiosales puede generar acidez (eg., H+, Fe2+)

S2O32- + ½ O2 + H2O  2H+ + 2SO42-

O por oxi-hidróxidos de hierro (FeOOH):

S2O32- + 8FeOOH + 8H+  2SO42- + 8Fe2+ + 11H20

O simplemente por desproporción:

S2O32- + H2O  SO42- + HS- + H+

» Las tiosales presentan una capacidad retardada para generar acidez


en los efluentes de la planta (i.e., una caída de pH) y,
consecuentemente, un incremento de las concentraciones de
sólidos disueltos y metales en el agua.
rsidad Catóhca deJ fl ri'.i1
VI-15

Factores que Afectan la Formación de Tiosales


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La producción de tiosales puede variar con la ubicación y


tipo de operación.
• Los factores pueden incluir:
– Contenido de azufre del mineral
– pH de molienda y flotación
– temperatura del agua de proceso
– tiempo de residencia en la molienda y los circuitos de flotación
– tasa de agitación de la pulpa
– tamaño de la molienda
– densidad de la pulpa
– temperatura de la pulpa
– flujo de SO2 gaseoso y aire disponibles para la flotación

VI-16

8
Degradación y Manejo de las Tiosales
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La tasa de conversión de tiosales a sulfato y la producción


de acidez son bajas a temperaturas normales y en
ausencia de catalizadores biológicos o químicos y
oxidantes fuertes
• Los rayos ultravioleta (UV) de la luz solar son efectivos
para la degradación de tiosales
• La práctica convencional es la “Degradación Natural” en
los depósitos de relaves
• Prácticas preventivas para mejorar la capacidad
amortiguante del efluente (e.g., aumento del pH de la
descarga a 10 o más para remover metales (e.g., Ni) y
adición de CO2 al efluente tratado para disminuir el pH a
fin de cumplir con los límites regulatorios)
rsidad Catóhca deJ fl ri'.i1
VI-17

Opciones para el Tratamiento de Tiosales


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Oxidación química (e.g., peróxido de hidrógeno (H2O2),


cloro (Cl2) y ozono (O3))
• Membrana y procesos electroquímicos (e.g., osmosis
inversa (RO), electrodiálisis (ED) y electro-oxidación)
• Oxidación por aire (e.g., bajo condiciones alcalinas, aire
con catalizador de Cu o aire con SO2)
• Oxidación biológica (e.g., bacteria sulfoxidante
• (e.g.,Thiobacillus sp.) en columnas y pozas y lodos
activados)
• Otros métodos como reducción de metales (e.g., Fe) y
disposición en el mar
• Exceptuando la oxidación biológica, los métodos han
sido evaluados sólo mediante pruebas a escala en
laboratorio.

VI-18

9
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Manejo del Agua y Planta de Tratamiento por


Neutralización con Cal HDS el Apirsa, Boliden

Tajo Los Frailes Molienda


Mineral
Aznallcollar Pit Recirculación del Agua
Relaves y Agua
almacenamiento y adición de H2O2

Agua Compresor de Aire Floculante

Clarificador
Río
Cal

Lodo
Mezcla de cal
Mezcla Rápida Tanques de Neutralización/Oxidación Proceso

Recirculación de lodos
Relaves

Disposición en el tajo

rsidad Catóhca deJ fl ri'.i1


VI-19

10
Desarrollo y Diseño del Proceso
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Se evalúa la capacidad de tratamiento mediante


pruebas a escala de banco (i.e., se investigan el
pH óptimo, dosis de cal y polímero)
• Con pruebas piloto:
– se desarrolla un proceso específico al sitio y se
verifica la factibilidad; se investiga la cantidad y la
calidad del lodo
– Se obtienen parámetros de diseño y de escalamiento
para el proceso a escala real
– No es necesario para cada caso

rsidad Catóhca deJ fl ri'.i1


VII-1

Pruebas de Capacidad de Tratamiento a


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Escala de Banco
Determinar:
• pH y dosis de cal óptimos
• Tipo y dosis óptima de polímero
• Tasa de sedimentación de sólidos (velocidad
sedimentación inicial)
• Oxidación necesaria
• Estimado bruto de generación de lodos

VII-2

1
Pruebas de Capacidad de Tratamiento a Escala de Banco
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

VII-3

Pruebas a Escala de Banco realizadas


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Durante el Arranque de la Planta

VII-4

2
Pruebas Piloto
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Deben simular el proceso real tanto como sea posible para


verificar:

• Los resultados de la prueba a escala piloto (re: pH, cal,


polímero)

Determinar:
• Tasa de reciclaje de lodo
• Tasa de sedimentación de lodos
• Cantidad y propiedades de lodos
• Calidad del efluente final

rsidad Catóhca deJ fl ri'.i1


VII-5
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Estudio Piloto
de HDS por
etapas en
Kristineberg
(Suecia, 1999)

VII-6

3
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

rsidad Catóhca deJ fl ri'.i1

VII-8
VII-7
Equipo Piloto

Planta Piloto del Túnel Kingsmill


Planta Piloto Noranda (1990)

4
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

ENSAYO DE DESAGUADO DE LODOS MEDIANTE DRENAJE

rsidad Catóhca deJ fl ri'.i1


VII-9

ESPECIFICACIONES DE DISEÑO –
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

CONDICIONES DE OPERACIÓN Y PARÁMETROS DE DISEÑO

Criterios Rango de Diseño


Condiciones Operativas del Proceso Normal Min. Máx
1Caudal de alimentación a la planta: m3/h - 25 20 30
pH de la alimentación - 2.5 1.0 2.8
1Descarga (agua tratada a pH: 9-9.5): m3/h - 34 27 43
2Diámetro del clarificador (m) - 14 12 16
Tasa total de lodo reciclado: m3/h - 12 10 15
3Consumo de cal: t/día 1
- 12 3 25
Parámetros de Diseño Tiempo de Retención (min.)
Volumen4 Normal Min. Máx
5Tanques de mezcla DAM/lodo (Tanque I y II) en (m3) 20 20 10 25
Agitación de alto corte y aereación sólo en Tanque II
28 30 15 38
Reactor de neutralización (Tanque III) 28 30 20 38
Agitación lenta y aereación '
Polímero (kg- seco /día) 12 2 19.5
Dosis de floculante @ 0.05% w/w (mg/L) 8.5 3 27
6Requerimiento

t~ total de aire : m3/min.


rornmaa uru1rersioaa Utollca oe-i l"er
8 3 15 --
bbL,v.da. ""
VII-10 ~


- r
- ~t1~~
1 ;.>..,

5
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Las especificaciones de diseño están preparadas en base


a “Supuestos” que por lo general son determinados a
partir de las pruebas a escala de banco/piloto. Ejemplo:

Supuestos:
1. Se usa composición química de DAM promedio (i.e., 0 - 5 m
niveles) y generación de lodos
2. Tasa de sedimentación inicial 0.6 m/h y factor de seguridad de 2
3. Se requiere 34 g Ca(OH)2 para tratar 1 L de DAM del nivel 232.8
m; se usa pulpa de cal al 15%
4. No incluye borde libre; se requiere de un borde libre de 30 cm
como mínimo.
5. El lodo total reciclado como proporción en volumen es hasta 50%
del volumen del agua ácida de mina de alimentación
6. 2800 mg/L de hierro ferroso a ser oxidado; 10% de eficiencia de
transferencia de de O2 y 50% de contingencia
rsidad Catóhca deJ fl ri'.i1
VII-11

Consideraciones de Diseño
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Son costo efectivas y flexibles que permiten:


• Una operación continua (redundancias,
respaldo)
• Fácil de operar y limpiar
• Fácil de expandir o mejorar para adecuarse a
los requerimientos futuros
• Enfoque en etapas (modular) (e.g., poza de
lodos)

VII-12

6
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Plan de Manejo de Aguas Específico al Sitio y


Diseño Conceptual de la Planta de Tratamiento
Tajo Los Frailes Molienda
Mineral
Tajo Aznallcollar Agua reciclada
Relaves y Agua
almacenamiento y adición de H2O2

Agua Compresor de Aire Floculante

Clarificador
Río
Cal

Lodo
Mezcla de cal
Mezcla Rápida Tanques de Neutralización/Oxidación Proceso

Lodos reciclados
Relaves

Disposición en el tajo

VII-13

Disposición de la Planta de Tratamiento de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

HDS en Kristineberg
Fresh (Clean) Water
OUTDOOR
Lime Silo
INDOOR
--------,
Fresh Water AMD
STORAGE
(or Treated) 1 AMD POND
Lime Slaking

D-01
STORAGE (8000m
3
)
Polymer POND
(2000m
3
)

Lime Slurry
Polymer Preparation Unit 1
Tank

Fresh
Water
(or Treated) Clarifier
TANK TANK TANK
1 2 3
NEUTRALIZATION Air
Split Box
TANKS ge
ud Clean
Sl
1 7
Process
Control Filter
Treated
Water
L_J
Room Sludge Recycle

L.-------------
NOT TO SCALE
Dewatered Sludge For
Sludge Disposal

VII-14

7
Ejemplos de Sistemas HDS a Escala Real
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Diseñados e Implementados por Golder

Boliden Apirsa,
España

rsidad Catóhca deJ fl ri'.i1


VII-15

• Neutralización con Cal


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

– Remoción de metales
– Lodos de hidróxido
– Problemas
• Volumen de lodos
• Estabilidad geoquímica

VII-16

8
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Planta de Tratamiento por Precipitación y


Neutralización con Cal HDS, Boliden Apirsa, España

DAM

Tanque de mezcla cal-lodo

rsidad Catóhca deJ fl ri'.i1


VII-17
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Planta de Tratamiento por Precipitación y


Neutralización con Cal HDS, Boliden Apirsa, España

Tanques de Neutralización/Oxidación

VII-18

9
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Planta de Tratamiento por Precipitación y


Neutralización con Cal HDS, Boliden Apirsa, España

Clarificador/Espesador

VII-19
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Aeropuerto de Ottawa
Diseño-Construcción-Operación por GAL y GAIA

VII-20

10
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

rsidad Catóhca deJ fl ri'.i1

VII-22
VII-21
de Cal
Preparación y Apagado

Preparación de Polímero

11
Planta de Tratamiento de HDS en Kristineberg,
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Boliden, Suecia

Silo de
Cal
Reactores internos

Clarificador

Lodo

VII-23

Clarificador/Espesador
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

VII-24

12
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Desagüado de Lodos

VII-26
VII-25

Mina Stora, Falun, Suecia

Lodos Filtrados

13
Monitoreo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Normalmente, el pH controla el
proceso del tratamiento
• El proceso es automatizado
mediante un PLC (controlador
lógico programable)
• La calidad del agua tratada debe
ser monitoreada de manera
contínua para determinar pH y
TSS (e.g., turbiedad)
• Algunos sistemas pueden también
controlar la densidad de los lodos

rsidad Catóhca deJ fl ri'.i1


VIII-1

Monitoreo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Debe monitorearse la calidad del agua tratada:


Periódicamente e.g., semanal y mensualmente, determinar:
• Metales (SO4 y otros parámetros según los estándares
establecidos)
• Pruebas de toxicidad acuática con algas (Dapnia Magna)
y trucha arco iris (y tal vez insectos, plantas)

Pruebas frecuentes para determinar parámetros críticos


(e.g., iones metálicos específicos) pueden ser
beneficiosas

VIII-2

1
Operación y Mantenimiento
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Las instalaciones y el proceso de tratamiento deben ser


verificados, calibrados, limpiados y fijados
periódicamente.
• Diariamente (sonda de pH, TSS, sedimentación de
lodos, sustancias químicas)
• Semanalmente (bombas, tubos, tanques)
• Mensualmente (mezcladores, unidades de ventilación)
• Anualmente (mantenimiento integral)

 La instalación debe contar con un sistema de alarma


 El diseño debe permitir el apagado automático.
 El desconocimiento puede traer como consecuencia
resultados muy costosos!

rsidad Catóhca deJ fl ri'.i1


VIII-3

Cuidados: Monitoreo, O & M


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Todos los documentos relacionados con el


sistema del tratamiento, equipo de proceso e
instrumentación deben mantenerse en un lugar
seguro
• Debe prepararse un archivo recordatorio de los
ítems y programas de monitoreo
• Todo trabajo debe ser registrado y archivado.
• Los operadores deben traslapar sus turnos de
tal manera que puedan coordinar antes del
cambio de turno.

VIII-4

2
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Sistemas Activos para el Tratamiento de DAM

• Plantas de Procesos
Químicos
–Reactores, tanques y pozas
–Clarificadores, precipitadores y
filtros
–Equipos de mezclado y
dosificación
–Bombeo y equipo de ventilación
• Ítems de mayor costo
–Capital y costos O&M
–Químicos y reactivos
–Manipuleo y disposición de lodos

HDS Plant At Iron Mountain


In California
VIII-5

Estimación de Costos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Costos de Capital
(principalmente los costos unitarios de construcción, costo del
terreno, costos de instalación: materiales y mano de obra, salarios,
equipos de procesamiento, obras civiles, tuberías, conexiones
eléctricas, ingeniería, administración y contingencias)

• Costos Anuales de Operación y Mantenimiento


(principalmente el costo de la mano de obra, productos químicos,
energía (demanda de energía), disposición de residuos, reemplazo
de equipos o piezas gastados, equipos de limpieza y reparación e
impuestos)

VIII-6

3
Modelos para la Estimación de Costos y su Uso
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Comparando el costo (capital y O&M ) de un proyecto


similar (e.g., precisión esperada ± 45% debido a los
requerimientos específicos del sitio)

• En base a la Regla de Un Sexto

Capacidad 2 0.6
Costo de Capital 2 = Costo de Capital 1 x
Capacidad 1

O&M 2 = O&M 1 x
-]Capacidad 2
Capacidad 1
0.85

VIII-7

Inclusión de los Índices de Inflación


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Índice de Costo Actual (CCI)

(CCI) =
[---] valor actual del índice

valor del índice al momento de la estimación

Costo de capital 2 = (costo de capital 1 x CCI) x


[-]
Capacidad 2 0.6

Capacidad 1

(e.g., el CCI para 1994 a 2002 es ~ 1.3)

VIII-8

4
Modelos Gráficos de Costo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Ítems de Costos de capital Ítems de Costos Operativos


• Construcción y cimentación • Reactivos, Floculante
• Equipos de neutralización • Mano de obra operativa
• Equipos de separación • Mano de obra de mantenimiento
sólido/líquido y consumibles
• Servicios de la instalación de • Energía eléctrica consumida
tratamiento
• Poza de limpieza • Costos de apoyo directo al 10%,
Contingencias al 10%
• Instrumentación y componentes
eléctricos
• Costos de construcción,
incluyendo gastos generales al
13% e ingeniería, adquicisiones
y gestión del proyecto al 15%
• Repuestos misceláneos al 15%,
contingencias al 25%

rsidad Catóhca deJ fl ri'.i1


VIII-9

Ítems no incluidos en los Modelos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Un sistema de gestión agua (de lluvia) del sitio;


• Infraestructura del sitio, incluyendo rutas de
acceso, distribución de la energía eléctrica en la
instalación de tratamiento e instalaciones y
servicios de soporte;
• Sistema de colección de DAR;
• Sistema de tratamiento terciario y sistema de
ajuste de pH como la inyección de CO2 en el
agua tratada antes de su liberación;
• Investigación del sitio y licencias; y
• Disposición de lodos (e.g., US$4/m3 de lodos).

VIII-10

5
Estimación de Costos a Largo Plazo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

æ (1 + i ) n - 1 ö
VPN = Açç n ÷
÷
è i (1 + i ) ø
Donde:
i: interés (o tasa de descuento para los años de operación)
n: tiempo (número de años considerados para la operación de la
instalación)
A: costos anuales del tratamiento (i.e., O&M y costos de disposición
de lodos)

El costo total del proyecto en ese momento para el tiempo proyectado


es igual a la suma del Costo de Capital y el VPN calculado. El VPN
debe ser usado para la comparación de alternativas.

rsidad Catóhca deJ fl ri'.i1


VIII-11
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Estimaciones del Costo de Capital para la


Neutralización con Cal*

3500
5000 mg/L Acidez Total
3000
Costo US$1000

2500
500 mg/L Acidez Total
2000
1500
50 mg/L Acidez Total
1000
500
0
0 200 400 600 800 1000
Flujo de DAR (m3/h)

VIII-12

6
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Costos Operativos para la Neutralización


Convencional con Cal
4000
5000 mg/L Acidez Total
3500
Costo US$1000

3000
2500
2000
1500
500 mg/L Acidez Total
1000
500
50 mg/L Acidez Total
0
0 200 400 600 800 1000
Flujo de DAR (m3/h)

rsidad Catóhca deJ fl ri'.i1


VIII-13
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Estimado de Costo de Capital* para la


Neutralización con Cal HDS
5,000
5000 mg/L Acidez Total
4,000
500 mg/L Acidez
Costo US$1000

3,000

2,000 50 mg/L Acidez Total

1,000

0
0 200 400 600 800 1000
Flujo de DAR (m3/h)

VIII-14

7
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Costos Operativos para la Neutralización con Cal HDS


4000
3500
3000
Costo US$1000

5000 mg/L Acidez Total


2500
2000
1500
1000 500 mg/L Acidez Total

500 50 mg/L Acidez Total


0
0 200 400 600 800 1000
Flujo de DAR (m 3/h)

rsidad Catóhca deJ fl ri'.i1


VIII-15

8
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Fundamentos de Microbiología en
el Tratamiento de Efluentes Mineros

Martha E. Ly Arrascue
Julio 2006

rsidad Catóhca deJ fl ri'.i1


IX-1
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

ce
pared celular

'
is,
cltoplasmaA
/

membrana cJt.op la smaU e a


»
e!ópacio per iplásmico

Fig. 1 01fl0RflNA OE LOS PRINCIPALES


COnPONE'1 TE$ DE UHA CEI.IJL A BAC TEfU AHA

IX-2

1
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

rsidad Catóhca deJ fl ri'.i1

IX-4
IX-3

Formas de Microorganismos

2
Algunos conceptos básicos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

 Quimiolitotrófico: para crecer solo necesitan sales inorgánicas,


obtienen energía de la oxidación de compuestos inorgánicos.
 Heterótrofo: crecen en medios orgánicos, carbohidratos para
formar nueva biomasa
 Autótrofo: usan el CO2 del aire como recurso de carbono para
síntesis de nueva biomasa
 Mixotrofo: tanto en medio inorgánico como orgánico
 Mesófilo: temperatura óptima 15-30ºC
 Termófilo: temperatura óptima mayor a 60º C
 Acidófilo: ambiente ácido
 Aeróbico: necesita presencia de O2 como aceptor de e-
 Anaeróbico: el O2 no es el aceptor de e-
 Facultativo:desarrollo tanto en medio aeróbico y anaeróbico

rsidad Catóhca deJ fl ri'.i1


IX-5

¿Cuán diversos filogenéticamente los acidófilos?


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Bacteria Archaea Eukarya

Animals
Entamoebae Slime
Molds
Fungi
Low G+C Gram-positive
Plants
Nitrospira Cytophagale
Proteobacteria s Thermoplasmales
Ciliates
Acidobacterium Thermoproteales Halobacteriales
m
Actinobacteria Sulfolobales Flagellates
Green
non-S Trichomonads
Korarcheaota
Thermotogales

Aquificales Microsporidia
Diplomonads

IX-6

3
Microorganismos Acidofílicos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Acidófilos Moderados (pH óptimo 3-5)

• Acidófilos extremos (pH óptimo <3)

• Pueden tener un rango amplio de


temperatura óptima.

rsidad Catóhca deJ fl ri'.i1


IX-7
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Microorganismos Acidófilos son predominantemente


procariotes
(bacteria y arquea)

Algunos acidófilos son eucariotes


(hongos, algas y protozoarios)
- éstos raramente se encuentran a altas temperaturas

IX-8

4
Clasificación de microorganismos según
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

temperatura óptima

a) Mesófilos (20º-40ºC): Acidithiobacillus ferrooxidans, At.


thiooxidans, Leptospirillum ferrooxidans, Ferroplasma
acidiphilum, F. acidarmanus
b) Termófilos moderados(40º-60ºC): At. caldus, L.
ferriphilum, L. thermoferrooxidans, Sulfobacillus
thermosulfidooxidans,
c) Extremófilos ó Termófilos obligados (> 60ºC):
Sulfolobus, Acidianus, Metallosphaera.

rsidad Catóhca deJ fl ri'.i1


IX-9

¿Cuán metabólicamente diversos son


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

los acidófilos?

• Recurso de Energía: química o solar

• Recurso de Carbono: orgánico o inorgánico


(o ambos)

IX-10

5
¿Cuán metabólicamente diversos son
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

los acidófilos?

• Donadores de electrones: hierro ferroso, azufre


reducido, sustratos orgánicos, hidrógeno

• Aceptores de electrones: oxígeno, hierro férrico,


azufre oxidado

rsidad Catóhca deJ fl ri'.i1


IX-11
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(J

"\1'111<11t d'Q :,.-ou me-a 'extreme'?


IX-12 We love h herel'

6
“Acidófilos” encontrados en ambientes mineros
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Acidófilos lixiviantes de Clasificación termal


minerales

1a. Hierro oxidantes


Leptospirillum ferrooxidans Mesófilo
L. ferriphilum Mesófilo
L. thermoferrooxidans Termófilo Moderado
“Ferrimicrobium acidiphilum” Mesófilo
Ferroplasma acidiphilum Mesófilo
“Fp. acidarmanus” Mesófilo/termotolerante

rsidad Catóhca deJ fl ri'.i1


IX-13
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

1b. Azufre-oxidantes
Acidithiobacillus thiooxidans Mesófilo
At. caldus Termófilo Moderado
Metallosphaera spp. Termófilo Extremo
Sulfolobus spp. TermófiloExtremo

1c. Hierro y Azufre oxidantes


Acidithiobacillus ferrooxidans Mesófilo
Acidianus spp. Termófilo Extremo
Sulfolobus metallicus Termófilo Extremo

IX-14

7
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

1d. Hierro reductores


Acidiphilium spp. Mesófilo

1e. Hierro oxidantes/reductores


Acidimicrobium ferrooxidans Termófilo Moderado

1f. Hierro oxidantes/reductores


azufre oxidantes
Sulfobacillus spp. Mesófilos y
Termófilos
Moderados
rsidad Catóhca deJ fl ri'.i1
IX-15

Género Acidithiobacillus
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Importantes en los ciclos • Amplio rango de pH


de S y Fe .
• Mesófilos. Amplio rango
• Gram negativos de temperatura
• Bacilos • Alta resistencia a los
• Flagelo polar, pili iones metálicos
• Aeróbicos estrictos • Amplia extensión
• Quimiolitotróficos
obligados, facultativos o
mixotrofos

IX-16

8
Acidithiobacillus ferrooxidans
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Temple and Colmer 1951) Kelly and Wood 2000

• El más estudiado • No es favorecido por


• La primera bacteria altos potenciales Redox
descubierta capaz de oxidar • Mesófilo (Óptimo rango
minerales 20º-35ºC)
• Autótrofo obligado • Alta tolerancia a iones
• Oxida compuestos metálicos
sulfurados y fierro ferroso • Capaz de crecer en
(donadores de e-) ácido fórmico (C1)
• Aeróbico (O2 aceptor e-)
• Acidófilo (pH óptimo 1.8-2.0)

rsidad Catóhca deJ fl ri'.i1


IX-17

Acidithiobacillus ferrooxidans
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(Thiobacillus ferrooxidans)

IX-18

9
Acidithiobacillus ferrooxidans
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(Thiobacillus ferrooxidans)

IX-19

Flexibilidad Metabólica del Acidithiobacillus ferrooxidans


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Ambientes aeróbicos Ambientes Anóxicos

CO2 Fe2+
O2 CO2
SO42- SRED Fe3+
H2O HCOOH

H2 H2

O2 Cell Carbon Fe3+

H2O
H2O

H2O SRED SO42- Fe2+


Fe2+ O2 Fe3+
Fe3+ H2O Fe2+

HCOOH

IX-20

10
Repaso acerca de Acidithiobacillus ferrooxidans
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Es un aneróbico facultativo
• Tiene menor afinidad al sustrato (Fe2+) que
Leptospirillum ferrooxidans
• Puede estar en gran cantidad en aguas de mina
microaeróbicos/anaeróbicos (ej. a ~104/ml en aguas
subterráneas de mina)
• Puede ser un anaeróbico-reductor de hierro?

rsidad Catóhca deJ fl ri'.i1


IX-21

Acidithiobacillus thiooxidans
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Waksman and Joffe 1922) Kelly and Wood 2000

• Nutricionalmente más • Acidófilo (rango de pH


parecido a At. 0.5-5.5, más ácido
ferrooxidans, excepto que tolerante que At.
no es capaz de oxidar el ferrooxidans)
ión ferroso • No es favorecido por
• Autótrofo obligado altos potenciales Redox
• Oxida azufre elemental, • Mesófilo (límite 35ºC)
compuestos reducidos de • Similitud entre At.
azufre thiooxidans y At.
ferrooxidans es cerca al
• Aeróbico (O2 aceptor e-) 20%.

IX-22

11
Acidithiobacillus caldus
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(Hallberg and Lindström 1995) Kelly and Wood 2000

• Similar a At. thiooxidans


• Acidófilo (pH 1.0-3.5)
en su capacidad de
oxidar compuestos • Moderadamente
reducidos de azufre pero termófilo (óptimo a
no el ión ferroso 45ºC); domina en
• Secuencia de 16S rRNA procesos operativos con
es muy cercana a la de rangos entre 35º-50º C
At. thiooxidans
• Capaces de crecer
mixotróficamente
utilizando extracto de
levadura, tetrationato y
glucosa.
rsidad Catóhca deJ fl ri'.i1
IX-23

Leptospirillum ferrooxidans
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(Markosyan 1972) Hippe 2000


• Mesófilo
• Acidófilo (pH óptimo 1.5- • Aeróbico obligado
1.8) • Gram negativo
• Solamente oxida ión • Quimiolitoautótrofo
ferroso (donador de obligado
electrones) • Tolera mayores
• A diferencia de At. concentraciones de U,
ferrooxidans, tiene gran Mo,Ag que At.
afinidad al ión ferroso y ferrooxidans
su capacidad de oxidarlo • Domina en procesos
no es inhibida por el ión junto con At. caldus o At.
férrico thiooxidans

IX-24

12
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Fe2+

Fe3+
O2
e-

IX-26
IX-25

ADP

H2O
H+

H+
Leptospirillum ferrooxidans

ATP
Metabolismo del Leptospirillum spp.

13
Leptospirillum ferriphilum
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Por lo menos existen 4


especies de
Leptospirillum
• L. thermoferrooxidans
reportado crecer a 45º C
ha sido perdido.
• L. ferriphilum (Coram and
Rawlings 2002) capaz de
crecer a 45º C,
predominante en plantas
comerciales de oxidación
en Sudáfrica, sobre L.
ferrooxidans

rsidad Catóhca deJ fl ri'.i1


IX-27

Heterótrofos: Acidiphilium
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• A. acidophilum (antes • Se alimenta de desechos


Thiobacillus acidophilus) orgánicos producidos por las
(Harrison 1983) Hiraishi et al. bacterias hierro y azufre
1998, capaz de crecer oxidantes
autotróficamente con • Utilizado en placas de
compuestos reducidos de crecimiento de
azufre inorgánico, o como microorganismos no tolerantes
heterótrofo o como mixotrofo a la materia orgánica
• Pueden utilizar hierro férrico
• Acido tolerantes
como aceptor de e-,
• Gram negativa regenerando el hierro ferroso
• Detectado en reactores batch
• Frecuentemente detectados
junto con At. ferrooxidans.

IX-28

14
Sulfobacillus y “parientes”
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Los Sulfobacillus son


moderadamente termófilos • S. thermosulfidooxidans más
activo para oxidar fierro y
• Forman esporas
minerales sulfurados
• Gram positivas
• S. acidophilus oxida azufre
• Aisladas de pilas y desmontes
más rápidamente en
• Autotrófas, oxidan ión ferroso,
ausencia de nutrientes
compuestos reducidos de
azufre inorgánico, o minerales orgánicos
sulfurados. • Capaz de utilizar glucosa
• Capacidad de fijar el CO2 es como recurso de carbono y
pobre energía
• Requieren, altas • Capaz de utilizar ión férrico
concentraciones de CO2, en ausencia de O2 como
pequeñas cantidades de aceptor de e-
extracto de levadura o estar
asociadas con heterótrofo • Acidofílicas extremas.
Acidimicrobium ferrooxidans
rsidad Catóhca deJ fl ri'.i1
IX-29

Arqueas
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Antes Arqueobacterias
• Difieren con las bacterias en composición de su
pared celular que la hace más “blanda” (sin ácido
murámico, con proteínas) y membrana celular
(hidrocarburos ramificados ligados al gllicerol, sin
lípidos).
• Más parecidos a los eucariotas que a las bacterias
por su organización de su cromosoma y sus
procesos de replicación, transcripción y traducción
• Igual que las bacterias presentan cromosoma con
única molécula de DNA circular y elementos
extracromosomales llamados plásmidos.

IX-30

15
Arqueas mesófilas
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Ferroplasma acidophilum • Ferroplasma acidarmanus


(Golyshina et al. 2000) aislada de drenaje ácido
aislada de planta piloto • Mixotrofo
arsenopirita/pirita de • Otras arqueas:
Kazakstan
Picrophilus shimae,
• Oxida hierro ferroso pero
no azufre Thermoplasma
acidophilum
• Aeróbico obligado
• Mesófilo (óptimo 33ºC)
• pH óptimo 1.7
• pH límite 1.3

rsidad Catóhca deJ fl ri'.i1


IX-31
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Ferroplasma
acidarmanus
oxidiza Fe(II) a
pH 0 (Edwards et
al. Science 2000)

IX-32

16
Arquea termófila: Sulfolobus
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La mayoría de estudios • Algunos Sulfolobus-like


de laboratorio se llevaron organisms son capaces de
a cabo con cepa oxidar rápidamentes
Sulfolobus BC (ahora minerales sulfurados a
conocido como
Sulfolobus metallicus 80º-85ºC
Huber and Stetter 1992 • S. acidocaldarius Brock et
• Autótrofo obligado al. 1972
• pH óptimo de 68º C • Se cuestiona la capacidad
• Rango pH 1.3-1.7 de Sulfolobus para tolerar
• Capaz de oxidar la abrasión que ocurre
arsenopirita y calcopirita, durante la mezcla vigorosa
con aire enriquecido con en reactores.
1% CO2
rsidad Catóhca deJ fl ri'.i1
IX-33

Sulfobolus sp.
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

SUJrolobus

IX-34

17
Flexibilidad Metabólica en `Sulfobacillus montserratensis’
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Ambientes Ambientes Anóxicos


Aeróbicos

CH2O
CH2O
CO2 Fe2+ CO2
O2 Fe3+ CH O
H2O 2

SRED Cell Carbon

O2
SO42-
H2O Fe2+
Fe2+ O2 SO42-
SRED Fe3+
Fe3+ H2O
CO2

rsidad Catóhca deJ fl ri'.i1


IX-35

Arqueas termófilas:
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Metallosphaera y Acidianus
Acidianus
Metallosphaera
• Se piensa que es menos
• M. sedula (Huber et al. 1989): promisoria que Sulfolobus y
pH 1.0-4.5; 80-85ºC. Metallosphaera
• Aeróbica • Acidianus brierleyi (Zillig et al.
• Quimiolitotrófica 1980, Segerer et al. 1986)
• Fierro y azufre oxidante autótrofo oxida fierro o azufre;
• Crece en presencia de heterótrofo en sustratos
extracto de levadura, pero no orgánicos complejos; pH 1.5-2,
de azúcares 70ºC.
• pH óptimo de 68º C • Ad. infernus (pH 2, 90ºC),Ad.
• Rango pH 1.3-1.7 ambivalens son quimiolitótrofos
obligados, crecen como
• Capaz de oxidar arsenopirita y aeróbicos o anaeróbicos para
calcopirita, con aire oxidar o reducir compuestos
enriquecido con 1% CO2 orgánicos sulfurados.

IX-36

18
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-38
IX-37
Bacteria Fe-oxidante moderadamente acidófila

Bacteria Fe-oxidante moderadamente acidófila: Thiomonas spp.

19
Importante bacteria hierro oxidante/acumulativa neutrofílica
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Leptothrix spp. (bacteria con vaina)

• Gallionella ferruginea

rsidad Catóhca deJ fl ri'.ii


IX-39

Leptothrix sp.
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-40

20
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-42
IX-41

Leptothrix sp.
Leptothrix sp.

21
Características del desarrollo bacteriano
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Fisión binaria
• Tiempo de duplicación: depende del
microorganismo, del sustrato, presencia de
sustratos orgánicos, condiciones del medio
• Constante específica de crecimiento
• El desarrollo bacteriano y la velocidad de
oxidación del mineral no está directamente
ligados.

rsidad Catóhca deJ fl ri'.i1


IX-43

Efectos tóxicos de los metales


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Las bacterias quimiolitotróficas acidofílicas


muestran alta resistencia a los efectos
tóxicos de los iones metálicos.
• La toxicidad de los metales depende de:
• a) El estado fisiológico de la bacteria
• b) Los estados de oxidación y formas
químicas de los metales, los cuales
gobiernan su biodisponibilidad.

IX-44

22
Estado fisiológico de la bacteria
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• La resistencia a los iones metálicos depende


del grado de adaptación y del hábitat de las
cepas silvestres.
• Mecanismos de resistencia debida a los
plásmidos (ej. al Hg 2+, UO2 2+).
• Construir tolerancia creciente por subcultivos
continuos

rsidad Catóhca deJ fl ri'.i1


IX-45

¿Dónde podemos encontrar


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

microorganismos acidófilos?

• Principales fuentes de cultivos bacterianos:


drenaje ácido de mina, mineral, agua y
pulpas de fuentes volcánicas.
• Aislamiento de cultivos puros.
• Mantenimiento, guardado y reserva de los
cultivos.

IX-46

23
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-48
IX-47

Formación de azufre: área volcánica. Montserrat, W.I.


Biomasa microbiana: área geotermal, Montserrat, W.I.

24
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-50
IX-49
Blue Star Spring, Yellowstone. U.S.A.

Crecimiento de algas: Prismatic Spring, Yellowstone, U.S.A.

25
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-52
IX-51
Mina Parys: Bocamina Mona

Mina Parys Mine: Bocamina Mona

26
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-54
IX-53

Microscopía electrónica: Efluente de Parys


Microscopía electrónica: Efluente de Parys

27
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-56
IX-55

Rio Tinto, España


Microscopía electrónica: Efluente de Parys

28
Lixiviación en pilas: Mina Escondida, Chile
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-57

Aislamiento
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Quimiolitóautótrofos obligados son difíciles de


cultivarse en medios sólidos (por sensibilidad
a azúcares de agar o agarosa)
• La más exitosa es la técnica de placa con
doble fase (heterótrofo se mezcla con medio
en capa del fondo y en la capa superficial se
inoculan quimiolitóautótrofos).
• Medios con sales: 9K, TK, entre otros
• Muchos son no cultivables

IX-58

29
Aislamiento
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Aplicación de técnicas de biología molecular,


PCR, se amplifican los genes el 16S rRNA
para detectar microorganismos sin requerir
crecimiento ni aislamiento en el laboratorio.
• Definición de composición de cultivos mixtos
en reactores, pilas, botaderos y relaves.
• Uso de sondas FISH (fluorescencia)
• DAPI

rsidad Catóhca deJ fl ri'.i1


IX-59

¿Qué métodos pueden (y deben) ser utilizados


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

para estudiar microbiología minera?


Métodos Cultivo Métodos Cultivo
dependientes independientes
• enumeración • PCR dependiente
• Aislamiento en - librerías de clones
placas - T-RFLP, DGGE etc.
• Enriquecimiento de • PCR-independiente
cultivos - FISH
• micromanipulación - citometría de flujo

IX-60

30
Métodos Cultivo Dependientes
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

rsidad Catóhca deJ fl ri'.i1


IX-61
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(A) - ,lid M d iu m {B) Liquid Me-dl um

P ond water or s.oi 1 ·ampl '

Added to
llq,uid
conta,ln ng
rnrllon

IX-62

31
(A l
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(11}

IX-63
..-...... ..... ,..,.u ......... _ -

Problemas con el crecimiento de los acidófilos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

en medio sólido

• Sensibilidad de muchos acidófilos a sustancias


orgánicas en general y a los ácidos orgánicos en
particular

• Pureza del agente gelante (ej. agar)


® lavado de agar antes de esterilización

• Hidrólisis del agente gelante


® necesita de una continua remoción de
pequeños hidrolisados de bajo peso molecular

IX-64

32
Colonias Acidófilas: Medio FeTSB
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Acidiphilium sp.

At. ferrooxidans
IX-65
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Técnica de doble capa “Overlay plate” para el


aislamiento y enumeración de microorganismos
acidófilos

Capa superior Capa inferior inoculada


estéril con heterótrofo acidófilo
Acidiphilium SJH o
Acidocella WJB3

IX-66

33
Colonias Acidófilas: Medio FeSo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

At. ferrooxidans

At. thiooxidans

Ferrimicrobium
IX-67

Colonias de Acidófilos moderados: FeTo medium


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Thiomonas sp

S-oxidizer

IX-68

34
Colonias de Acidófilos heterótrofos:
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

medio YE3o

Thiomonas s

IX-69

Métodos Moleculares
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

DAPI (4’,6’-diamidino-2-phenylindole) – colorante general para


ácidos nucleicos

Fluoresceína-marcada con sonda EUB338

GCTGCCTCCCGTAGGAGT

CY-3-marcada con sonda Objetivo


TAATGGGCCGCGAGCTCCC

IX-70

35
Sondas 16S rRNA usadas para estudiar comunidades microbianas
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Sonda Objetivo Secuencia de la sonda (5’- 3’)


ARCH915 Archaea GTGCTCCCCCGCCAATTCCT

EUB338Fl Eubacteria GCTGCCTCCCGTAGGAGT


23S rRNA of most α-Proteobacteria, some δ-
ALF1B CGTTCGYTCTGAGCCAG
Proteobacteria and most spirochetes
BET42a 23S rRNA of most β-Proteobacteria GCCTTCCCACTTCGTTT
GAM41a 23S rRNA of most γ-Proteobacteria GCCTTCCCACATCGTTT
LGC355 Low G+C Gram-positive bacteria GGAAGATTCCCTACTGCTG
TM1G138 Thiomonas Group 1 GCAGTTATCCCCCATCAAT
TM2G138 Thiomonas Group 2 GTAGTTATCCCCCATCACA
TF539 Acidithiobacillus ferrooxidans CAGACCTAACGTACCGCC
ATT223 Acidithiobacillus thiooxidans AGACGTAGGCTCCTCTTC
ACM732 Acidimicrobium and “Ferrimicrobium” GTACCGGCCCAGATCGCTG
ACM995 Acidimicrobium ferrooxidans CTCTGCGGCTTTTCCCTCCATG
LF655 Leptospirillum groups 1, 2 and 3 CGCTTCCCTCTCCCAGCCT

rsidad Catóhca deJ fl ri'.i1


IX-71

Cueva Trefriw Spa


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-72

36
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-74
IX-73
Biofilm de Trefriw teñido con DAPI

Misma muestra con sonda para Eubacterias

37
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-76
IX-75

Imágenes combinadas
Misma muestra con sonda para Acidithiobacillus ferrooxidans

38
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Lo
w % of Total Population
G
+C

0
10
20
30
40
50
60
70
80
90
100
Ar
G ch
ra ae
al
ph m a
-p
a- os
Pr i ti
ot ve
be eo s
ta ba
-P ct
ga ro er
m te ia
m ob
a- a

,-,
Pr ct
ot er
Ac eo ia
id ba
ith ct
io er
A
ba Th ia
ci io
m
Ac ci
'=--
id di llu
im th s on
ic io fe as
ro ba rro
bi ci
llu o xid
um s

rsidad Catóhca deJ fl ri'.i1


th an
an io s

IX-78
IX-77
Ac
id d o
im “F xid
ic er an
ro ri m s
bi i c
um ro
fe b iu
rro m
ox ”
• Parys

Le id
• Trefriw

pt an
os s
Análisis de biofilms con FISH

pi
ril
lu
G m
al
lio
ne
lla
TR
A3
-2
0

39
Notas Generales:
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Comunidades microbianas encontradas en un sitio


minero no son iguales a las encontradas en otro sitio.
Evidencia de gran biodiversidad.
• Nuevas especies se han detectado con métodos de
detección independientes de cultivo (ej. Un acidófilo
llamado Gallionella) que puede generar DAR.
• Las técnicas de detección cultivo dependientes
(overlay) permiten el aislamiento de microorganismos
detectados previamente con técnicas moleculares.
• Estos aislamientos pueden proveer de
microorganismos útiles para la remediación de DAR
y para el procesamiento de minerales/concentrados
minerales.

rsidad Catóhca deJ fl ri'.i1


IX-79

Biooxidación del Ión Ferroso


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

2 Fe2+ → 2 Fe3+ + 2 e-
2 H+ +½ O2 + 2 e- → H2O

2 Fe2+ + ½ O2 + 2 H+ → 2 Fe3++ H2O

IX-80

40
Oxidación de Sulfuros Metálicos por Catálisis
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Microbiana

Fe2+

FeS2 Microbio

Fe3+

rsidad Catóhca deJ fl ri'.i1


IX-81

Microorganismos de importancia
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Oxidation of
Bacteria/Archaea Fe(II) sulfur/
ions -compounds

Acidithiobacillus ferrooxidans + +
A. thiooxidans/ A. caldus - +

Leptospirillum ferrooxidans/ L. ferriphilum + -

Sulfobacillus sp. - +
Acidiphilium sp. - (+)

Sulfolobus/ Acidianus/ Metallosphaera sp. + +


Ferroplasma sp. + -

IX-82

41
Lixiviación de metales de minerales no
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

sulfurados
• Bacterias heterótrofas y hongos movilizan los
metales cambiando su estado de oxidación o por
acción de los ácidos orgánicos y compuestos
producidos por estos microorganismos.
• Disolución de metales pesados por desplazamiento
directo de los iones metálicos de la matriz por los
iones hidrógeno, y por la formación de de complejos
metálicos solubles.
• Bacillus (bacteria), Aspergillus, Penicillum para
silicatos con Ni (hongos)

rsidad Catóhca deJ fl ri'.i1


IX-83

Ataque microbiano sobre los sulfuros metálicos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Ataque microbiano sobre los sulfuros metálicos puede


proceder por via de un mecanismo “directo” o “indirecto”
(Silverman, M.P., 1967, J. Bacteriology)
• En el mecanismo directo, los microorganismos catalizan
la disolución del sulfuro por una reacción enzimática e
implica la adsorción del microorganismo sobre el mineral
• El mecanismo indirecto ocurre via el ataque del hierro
férrico y ocurre por los microorganismos adheridos o
planctónicos (no adheridos).
• Ahora es aceptado que el ión férrico es el único oxidante
del sulfuro metálico
• Por lo tanto, los términos “directo” and “indirecto” deben
ser reemplazados por los términos más exactos
“contacto” and “no-contacto”

IX-84

42
Células adheridas Células no adheridas
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(“lixiviación de (“lixiviación sin-contacto)


contacto”)

Fe2+ Fe3+

FeS2
Fe3+ Fe2+

S2O32-

Fe3+

Politionatos
Sulfato

Fe2+

SO42-, H+

IX-85

30,0
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

20.0
AFM-imagen
células de At.
ferrooxidans
adheridas a la
superficie de
FeS2
10.0 (Sand et al. 2001)

o
o 10.0 20.0
IX-86 30,0 IJN
~ -

43
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

rsidad Catóhca deJ fl ri'.i1


IX-87

¿Por qué los microbios oxidan Fe2+ y S?


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Hierro ferroso provee a las células la energía para su


crecimiento

• El transporte de electrones desde el Fe2+ hasta el


oxígeno genera energía metabólica como ATP

• Esta energía es utilizada para llevar a cabo las


funciones celulares incluyendo la fijación de CO2 en
la biomasa

IX-88

44
¿Cómo los microorganismos oxidan el hierro?
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Los electrones del Fe2+ son tomados por las enzimas


y pasan a través de la membrana que tiene una
cadena de transporte de electrones hacia el oxígeno

• Oxígeno es reducido con protones hacia el agua

• Durante el transporte de e-, protones son sacados de


la célula

• Estos protones pasan y regresan a través de la


membrana para formar el ATP

IX-89
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Fe2+ Fe3+

Fuera de la
le-

célula Citocromo c
o “hierro oxidasa”

rusticianina
Periplasma

Citocromo c

Citoplasma
IX-90

45
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Cadena de transporte de electrones en el microorganismo
I? - Jas:m

FJa -
® @
ATP
synthlkSI!
!


@ Elec roos ttow down
a casca;d e of ca rrEers.
l~ctron s; pass to Protoo,~are pumped
NADH, wñkh Dut oHh c:e 11, nd a
"í-eed5" them rnto tl':iarg eparatior,
electron rrie rs. d v@lops_

Cvt pla m IX-91

Oxidación Microbiana de RISC (Compuestos de Azufre


inorgánico reducido)
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Durante la oxidación de sulfuros metálicos, se descargan


“reduced inorganic sulfur compounds”
• Estos incluyen polisulfuros, azufre, tiosulfato and politionatos
• Así como con el Fe2+, los acidófilos pueden oxidar estos
compuestos a SO42- para obtener energía para su crecimiento
• La oxidación del hierro ferroso a férrico transfiere un electrón
• La oxidación de azufre a sulfato es una reacción que transfiere 6
electrones; la oxidación de tetrationato a sulfato produce 14e-
• Por lo tanto, RISCs dan mayores ventajas para el crecimiento
bacteriano que el ión ferroso
• Es decir más protones son transportados hacia fuera de la célula
durante la respiración con RISCs.

IX-92

46
Impacto del Carbono sobre las transformaciones
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Biogeoquímicas de hierro y azufre en DAM

Carbono inorgánico

Fe2+ D Sreducido
Autótrofos oxidantes de Fe/As

Heterótrofos Reductores Fe/S

Fe3+
D SO42-
Carbono orgánico

IX-93

Ciclo de energía en los ambientes mineros


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

SO42-
Acidófilos S-oxidantes
Sreducido CO2 acidofílica/ácido-tolerante
Fe2+
FeS2
~
BRS


Sreducido
Fe3+ FeS2 SO42-
At. ferrooxidans

\ o><
Generación L.ferrooxidans Consumo
de Acidez de Acidez
lisis
Fe3+ Fe2+
restos

Protozoos Acidófilos
Rotíferos Acidófilos restos (Y
Heterótrofos Acidófilos

Fe2+

IX-94

47
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

rsidad Catóhca deJ fl ri'.i1

IX-96
IX-95
Bioreactores Reductores de Hierro

Reducción de Hierro Férrico por Acidiphilium spp.

48
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-98
IX-97

Bioreactores de lecho fijo FRB


Reducción de Hierro Férrico por Acidiphilium SJH

49
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Bacterias Candidatas para los Bioreactores de lecho fijo


(Oxidación/Precipitación de hierro)

Organismo Rango de pH Afinidad al sustrato

Thiomonas/
Halothiobacillus-like 3-5 ?
isolates

Acidithiobacillus 2-3 baja


ferrooxidans

Leptospirillum 1-2 alta


ferrooxidans

rsidad Catóhca deJ fl ri'.i1


IX-99

Bioreactores de lecho fijo FRB


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

DAM IN VENT

GRAVA

Bacterias inmovilizadas
(sobre beads)

GRAVA

DAM OUT

PRECIPITADO /AIREACIÓN

IX-100

50
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

rsidad Catóhca deJ fl ri'.i1

IX-102
IX-101
Sistemas acidofílicos sulfidogénicos

Bacteria Reductora de Sulfato (BRS)

51
Bacteria Reductora de Sulfato (BRS)
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

 La reducción bacteriana de sulfatos es un proceso natural, bajo



Sulfato+ BRS
--
condiciones anaeróbicas.

Metales solubles + H 2S
H2S
sulfuro metálico insoluble
Precipitación de los metales y aumento de alcalinidad. Tratamiento in situ
para minas subterráneas en abandono. Preservación de lodos a largo
plazo.Bajos flujos, DAM de poca intensidad.

 Géneros: Desulfovibrio (5 sps), Desulfotomaculum 3 sps).


SO4 2-
- -
SO 3- S 2- H2S

 Sustratos (donadores de electrones y recursos de carbono) idóneos:


lactato, piruvato, citrato, etanol, almidón, melazas, otros ácidos orgánicos,
lodos y desechos orgánicos, como estiércol de cordero.
 El sulfato es el aceptor de electrones.
 Se obtienen por la fermentación de sustratos orgánicos más complejos:
putrefacción de vegetación en humedales, paja, aserrín, estiércol, etc.

rsidad Catóhca deJ fl ri'.i1


IX-103

Desulfosporosinus acidofílico: BRS


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-104

52
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Bioreactor de
lecho fijo- BRS

IX-106
IX-105

53
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-107

Acidophilic SRB Bioreactor


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

7
- SO4 red
Glycerol
Acetate
Zn
4.5E+08

4.0E+08

3.5E+08

6 3.0E+08
Solutes (mM)

Bacteria (/ml)

Cell
5 2.5E+08

4 2.0E+08

3 1.5E+08

2 1.0E+08

1 5.0E+07

0 0.0E+00
0 20 40 60 80 100 120 140
Time (h)

IX-108

54
Bioreactor de lecho fijo para oxidar y precipitar Mn
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

IX-109

Procesos Anaeróbicos que ocurren en los


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Humedales con compost


1. Reducción del ión férrico:
e.g. Fe(OH)3 + e- Fe2+ + 3OH-
2. Reducción del sulfato:
SO42-+ 9H+ +8e- HS- + 4H2O
(3. Metanogénesis:
CO2 + 2H2 + 4H+ + 4e- CH4 + 2H2O)
(4. Fermentación: proveer sustancias de bajo peso
molecular)

IX-110

55
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Alternativas de Tratamiento Pasivo

rsidad Catóhca deJ fl ri'.i1


X-1

Sistemas Pasivos - Aplicaciones


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Caudal
(L/s)

20
:i
: 1 Humedal Anaeróbico
\\
\\ OLD, ALD
\\

.__., .
\ \
10 '-_ \_

[JRAPS
SLB '
',,'___'· ......
0.1 t CaCO3/d
PRB

250 500 Acidez


(mg CaCO3/L)

X-2

1
Características del Tratamiento Pasivo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Énfasis en caliza (agregados de carbonato)


El diseño usualmente está enfocado a:
• Tasas de reacción lentas (i.e., tiempo de retención
prolongado)
• Minimizar el recubrimiento de las partículas (i.e., el yeso
(CaSO4), y precipitados de metal pueden formar
costras, obstrucción, etc.)
• Uso de materiales orgánicos para controlar el potencial
redox y minimizar el recubrimiento
• La expectativa de vida del sistema se basa en la caliza,
materia orgánica y porosidad disponibles.

rsidad Catóhca deJ fl ri'.i1


X-3

Sistemas de Tratamiento Pasivo


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Componentes del Diseño


Componentes biológicos Componentes de caliza
• Reactores SRB • Arena de caliza
anaeróbicos • Drenes anóxicos de
• Celdas aeróbicas o caliza (DCA)
filtros de roca • Pozas alcalinas
• Sistemas sucesivos de • Canales abiertos de
producción de calizas
alcalinidad (SAPS)

Pozas de sedimentación y pozas de compensación de flujos,


Transporte de fluídos (tuberías y canales)

X-4

2
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

AGUA DE
AGUA MALA
REGULAR CALIDAD

AGUA
BUENA

DIS CHARGE MODIFICADO SEGÚN


HEDIN, ET AL., 1994
rsidad Catóhca deJ fl ri'.i1
X-5

Precauciones
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Se encuentran definidos los principios de diseño


geotécnico y geoquímico. Sin embargo, en
algunos casos, como el de conductividad
hidráulica, la aplicación de estos principios a
situaciones reales es difícil.
• El diseño y la construcción de sistemas de
tratamiento pasivo sigue siendo una tecnología
en proceso de desarrollo. No todo lo que se
afirma hoy en día seguirá siendo cierto en
algunos años.

X-6

3
El triángulo de la Frustración en el
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Tratamiento Ambiental
DINERO

DISPONIBILIDAD
DEL TERRENO TIEMPO

rsidad Catóhca deJ fl ri'.i1


X-7

Objetivos del tratamiento


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Drenaje ácido de roca


– Remover la acidez del mineral, esp. Fe y Al
• Agua de procesamiento de minerales
– Usualmente cianuro y otros aniones de As y Se
• Aguas marginales
– Con pH cercano al neutro y niveles de
contaminantes superiores a los estándares de
calidad
• Aguas residuales
– Elevado contenido de sólidos totales disueltos (TSD)

X-8

4
Drenaje ácido de roca - DAR (mg/L)
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

SITIO A B C D
pH 2.5 2.9 2.9 5.9
Al 60 20 36 21
Fe 750 50 180 580
Mn 80 30 50 20 1
Cu 55 2.0 0.03
Zn 150 10 0.24
Cd 0.80 0.03
Pb 0.14 0.01 0.02
'
As 1.5 0.10 0.01
SO4 4,000 2,100 2,050 750 -
-
• Ponfüidil Uni--ersidad Catóhca deJ Peri'.i1
TndaL,v.<1,-,,. X-9 -~\:::=:,...-
• 1f3r~J

Agua de Procesamiento de minerales (mg/L)


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

SITIO A B C D
pH 9.0 8.0 8.6 5.5
Fe 470 0.05 0.5 0.60
Mn 0.47 187
Cu 78 3.3 8.3 0.024 A
1
Zn 0.06 657
Cd
As
0.09
0.09 20
1.9
~
Se 0.2 0.05 ......

CN (Total) 230 4 ~100 )


SO4 300 400 1,300 5,800 ---
1f3j~ 1~
• Pontilidil Uni--ersidad Catóbca deJ Perú
X-10 ,..~~
bi>L,v.d.,. r.
• ~ _,-1

5
Aguas marginales (mg/L)
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

SITIO A B C D
pH 7.9 6.6 7.1 7.0
Mn 0.01 0.03 0.37 0.66
Ni 0.05 7.5 0.01
Cu 0.02 20.6 0.015
Zn 0.21 0.07 0.20 11.4
Cd 0.002 0.003 0.009 0.03
Pb 0.70
SO4 63 48 1,005 450
Alc. 156 33 595

rsidad Catóhca deJ fl ri'.i1


X-11

Aguas residuales (TDS) en mg/L


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

SITIO Wyoming Coal Oil Shale Refinery


pH 8.2 7.1 7.9 – 8.8 7.8
Na 800 940 1,000 180
K 92 3 743 82
Ca 260 290 47 160
Mg 34 100 33 170
Cl 1,040 1,000 69 350
SO4 900 1,600 3,000 600
Alc. 280 200 371
TSD 3,500 4,200 5,300

X-12

6
Resumen
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Las aguas marginales son fácilmente tratadas por medio


de métodos pasivos
– Los caudales elevados pueden ser un problema

• El DAR y las aguas de proceso pueden ser tratados


mediante métodos pasivos.
– La carga químicas de las celdas puede ser un problema.

• Las aguas residuales son muy difíciles de tratar


mediante cualquier método químico (ésta es la razón de
la existencia del agua de mar).

rsidad Catóhca deJ fl ri'.i1


X-13

USO DE CALIZA
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Drenajes Anóxicos de Caliza (ALD)


se entierra un lecho de caliza para excluir el aire
a fin de prevenir oxidación de Fe2+
• Drenajes de caliza de canal abierto
• Medios de filtrado

X-14

7
Uso de Caliza
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El pH se elevó de 5.5 a ~ 7. Nunca alcanzó 8.


• La concentración de Ca se incrementó de 350 a
450 mg/L
• La alcalinidad se incrementó de 10 a 90
mg CaCO3/L

LA CALIZA SE DISUELVE

rsidad Catóhca deJ fl ri'.i1


X-15

Construcción de Drenaje Anóxico de Caliza


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

(Tratamiento Pasivo)

X-16

8
Drenes de Caliza Abiertos y Aeróbicos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Canales con contenido de agregados de caliza


gruesa (a través de los cuales percola el agua)
• Sistema expuesto a O2 (y el CO2 mejora la
presión parcial y solubilidad del carbonato)
• Inclinación de canales > 10o (i.e., a mayor
velocidad se minimiza el recubrimiento)

Eleva el pH a 6-7 e introduce alcalinidad


Neutraliza las concentraciones de metal soluble
menores y ácidas

rsidad Catóhca deJ fl ri'.i1


X-17

Drenes de Caliza Abiertos y Aeróbicos (OLD)


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

--------------------------------------------

Agregado de caliza

X-18

9
Drenes de Caliza Abiertos y Aeróbicos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El uso existoso requiere:


– O2 ambiental
– Carga ácida: < 500 mg/L como CaCO3
– pH > 2
– Flujo promedio: < 20 L/s
– Cargas máximas promedio: < 150 kg CaCO3/d

• Beneficios clave
– Caliza es de bajo costo y fácilmente disponible
– Bajos costos de construcción y operación

rsidad Catóhca deJ fl ri'.i1


X-19

Drenes de Caliza Abiertos y Aeróbicos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Limitaciones clave
– Recubrimiento y obstrucción de caliza por
precipitados de Fe, Al, Mn y yeso
– Insuficiente generación de alcalinidad si el talud es
>> 10o o se cuenta con poca retención
– pH máximo alcanzado 6 - 7.5; no todos los metales
precipitan
– Es necesario emplear sistemas de drenaje existentes
en áreas relativamente extensas
– Es incierta la duración de la efectividad (puede variar
de sitio a sitio)
– Mantenimiento necesario – No abandone el sitio
(WALK-AWAY)!

X-20

10
Colección de DAM y Tratamiento Pasivo
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

en una Cuneta

rsidad Catóhca deJ fl ri'.i1


X-21

DREN ANÓXICO DE CALIZA


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

pH-G
.....<l:l ., ... _e.....
~d.P; ,-! ~
c.., Z'rt , .....
Zf'I , ab:! .

to AeroblG w ·e1:1mc11 l
Fvª"-+ Flil:J "
F,¡¡.-, .. - Ftii fOJ-í,lr,.

LorlgllY!:IIJ1'1~'"51!MillQn allid c~a.-.e;eeuot,, ol !1111 ""AnD>il i::: Ul'rail!· D nlln-.. , W II ara, ltiil
l!l~ m f;! lling ~•-11 .. nc;1 tul'ii"-tll na, m petrl~rw;,, ~et 15,,.ln' N, fu rw;:lim'I..

X-22

11
Drenes Anóxicos de Caliza (DAC)
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Cunetas enterradas con agregados de caliza


relativamente gruesa
• La caliza es encerrada dentro de un revestimiento (de
plástico o geomembrana) de baja permeabilidad y
recubierta con arcilla
• Los flujos tratados con DAC requieren tratamiento
posterior empleando un humedal aeróbico.

 El pH es elevado a 6-7 aumentando la alcalinidad


 Puede requerirse un DAC posteriormente para neutralizar
la acidez generada por la precipitación de metales (e.g.,
Fe, Al, )
rsidad Catóhca deJ fl ri'.i1
X-23

Drenes Anóxicos de Caliza


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Requisitos para el uso exitoso:


– Condiciones anóxicas: O2 < 1 mg/L
– Fe: Fe2+ (por el contrario, Fe3+ puede precipitar en la celda)
– Rango de acidez: < 500 mg/L como CaCO3
– pH: > 2
– Flujo promedio: < 20 L/s
– Cargas de acidez promedio máxima total: < 150 kg CaCO3/d

 Por lo que, los DACs son más adecuados para el


tratamiento del DAR generado por las minas de carbón
que el generado por las minas metálicas.

X-24

12
Drenes Anóxicos de Caliza
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Ventajas:

• Caliza no es costosa y se encuentra fácilmente


• Bajos costos de operación
• Es posible que se requiera poco mantenimiento
durante períodos prolongados (e.g., minas de
carbón)

rsidad Catóhca deJ fl ri'.i1


X-25

Drenes Anóxicos de Caliza


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Limitaciones
– Recubrimiento y obstrucción de caliza por Fe, Al, Mn y
precipitados de yeso
– Máxima alcalinidad generada ~ 300 mg/L CaCO3
– pH máximo alcanzado de 6-7.5; no todos los metales
precipitan
– Es posible que se requiera DAC posteriormente
– Se emplea un pequeño % de caliza
– La expectativa de vida es limitada en muchos sitios
– No es de fácil mantenimiento – No abandone el sitio
(NOT WALK-AWAY)!

X-26

13
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

rsidad Catóhca deJ fl ri'.i1

X-28
X-27

para SRB
Caliza Anóxica

Evaluación de Sustrato/Nutriente
Evaluación de Drenaje de

14
Remoción Promedio en el Sistema
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

de Grava de Caliza, sin Aereación


Elemento Alimentación (mg/L) Efluente (mg/L)
Al 2.9 < 0.08
Fe 0.22 0.26
Mn 55 3.1
Co 1.0 0.02
Cd 0.02 0.002
Cu 4.0 < 0.02
Ni 0.62 0.04
Zn 2.2 < 0.04

rsidad Catóhca deJ fl ri'.i1


X-29

Pozo de Derivación de Caliza


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Descripción
• Parte del flujo del DAR es desviado al pozo
• El pozo (cilindro o tanque de metal o concreto) es llenado
con agregados de caliza (5-10 mm)
• El DAR es bombeado a la base del pozo
• La caliza se mezcla y desgasta de manera turbulenta
• El rebose transporta alcalinidad y caliza a la quebrada
 pH elevado a 6-7 y alcalinidad en exceso en el curso de
agua
 Neutraliza la acidez y las concentraciones menores de
metal soluble

X-30

15
Pozos de Derivación de Caliza
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

DAM
10-15 m altura
Presa de
Derivación

Lecho de caliza
(5-10 mm partícula)

X-31

Pozas de Derivación de Caliza


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El uso exitoso requiere:


– Concentraciones de O2 ambiental
– Carga ácida: < 500 mg/L como CaCO3
– pH > 2
– Flujo promedio: < 1000 L/s
– Cargas máximas promedio: 100 - 1000 kg CaCO3/d

• Beneficios clave
– Caliza barata fácilmente disponible
– El mezclado enérgico (alto flujo) reduce la obstrucción
con caliza
– Eficacia del uso de la caliza es mejor que el empleo de
DOC y DAC

X-32

16
Pozos de Derivación de Caliza
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Limitaciones
– Eficacia del uso de caliza es ~50% y se requeriría una adición
regular
– ~10 m cambio de elevación (altura) entre la presa y el pozo
requeridos
– obstrucción con Fe, Al, Mn y precipitados de yeso si el mezclado
fuera ineficaz
– Máximo pH alcanzado 6-7.5; no todos los metales precipitan
– Los precipitados no pueden ser capturados
– Es posible que se requiera tratamiento posteriormente
– Se emplea un pequeño % de caliza
– No es de fácil mantenimiento – No abandone el sitio (WALK-
AWAY)!

rsidad Catóhca deJ fl ri'.i1


X-33

Lechos de Caliza Pyrolusite®


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Los agregados de caliza son inoculados con


bacterias aeróbicas (e.g., algas) a fin de generar
O2, que cataliza la precipitación de Mn como
MnO2. Fe2+ también se oxida a Fe(OH)3 o
FeO·OH.

Concentraciones menores de Mn soluble


Elevar pH del agua a 6-7 e introducir alcalinidad
Neutralizar acidez generada por precipitación de
metales.

X-34

17
Módulo de Humedal a Escala de Banco
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

ENTRADA
REBOSE

SUSTRATO SALIDA

GRAVA

rsidad Catóhca deJ fl ri'.i1


X-35

Pruebas de Adición de Oxígeno para la Remoción de Mn


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

iPill. :'T il"i'I.Ti: ~


, t.i;; - ,. 1¡,:; / ~••MT
/ /

,_ .
1
, ~;J•

t
z ~c,· .1. r

l ._ --~~//~~~"~HI
,v.;:..., CiJ::4• •:itr

X-36

18
Lechos de Caliza Pyrolusite®
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Una aplicación exitosa requiere:


• Concentraciones de O2 ambiental
• Carga ácida: <500 mg/L CaCO3
• pH: 3 – 5
• Flujo que permita un tiempo máximo de
residencia (e.g., >algunas horas)

Caliza fácilmente disponible y barata


Remoción e inmovilización de Mn

rsidad Catóhca deJ fl ri'.i1


X-37

Lechos de Caliza Pyrolusite®


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Limitaciones
– Taponeo con precipitados de metales; se requiere
lavado
– Se requiere el reemplazo de sustratos orgánicos
– La eficacia es limitada porque se requiere tiempos de
residencia prolongados
– El abandono (WALK-AWAY) del sitio no es una
solución!

X-38

19
BARRERAS REACTIVAS PERMEABLES (PRB)
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• “Pared”
Pared” enterrada que contiene material reactivo
para tratar la pluma de agua subterrá
subterránea como:
como:
– Medio orgá
orgánico con SRB
– Hierro cero valente (Fe0) (o Cementación)
• La pluma atraviesa,
atraviesa, se remedian los
contaminantes
• Diversas configuraciones
– Pared porosa
– Cuneta y compuerta
– Embudo y compuerta
• Permanente, semi-
semi-permanente,
permanente, o recambiable

X-39
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Permeable
Reactive
- Contaminant Barrier
Source
- -- - - ... - -- -
Contaminant Plume

Blowes, 2004 X-40

20
Hierro cero valente (Fe0) para remover acidez
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

y metales (Cementación)

• Remoción de metales (e.g., Pb)


Pb2+ + Fe0 ® Pb0¯ + Fe2+

• El hierro reacciona con el agua:


Fe0(s) + 2H2O(aq) → Fe2+(aq) + H2(g) + 2OH-(aq)

Los metales tóxicos reducidos tienen baja solubilidad en


agua, y por lo tanto es menos probable que se lixivien
hacia las aguas subterráneas o superficiales. La
biodisponibilidad y biotoxicidad de los metales reducidos
es menor también.

rsidad Catóhca deJ fl ri'.i1


X-41

Diseño de Humedales Artificiales


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

X-42

21
Embudo y Compuerta PRB
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Funnul
Wall ~ , Reactive
r---.._..__
1

i ---
can -
..,,.,. '
-..._______'.'!---'!!!!f'LJ _,,,. '\

,. I I ,. j
L .,. ~ .,. Treat-ed )
Gata l, ., .1 1 .A Groundwatar}
r11J.d
..,..,,...,._,_;;;;,,;,;,¡,,,..i....;¡;;i;- - -.....
~../
FtJnneJ
Gavaskar, 1999
Blowes, 2004 WaU X-43

Los PRB Pueden tratar Plumas de Agua Subterránea


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

que contengan
• Metales Disueltos
– DAR, NMD (Fe, Al, Mn, etc.)
– Metaloides (Se, As)
– Metales Pesados (U, V, Mn, Ni, CrV, etc.)
– Otros propios de drenes de caliza

• Solventes Clorados Disueltos


– Fluidos de lavado en seco (TCE, PCE)
– Solventes alifáticos clorados

• Hidrocarburos Disueltos
– E.g., BTEX
• Percloratos

X-44

22
Selección de Medios Reactivos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Disponibilidad
• Costo
• Efectividad
• Estabilidad
• Reactividad
• Propiedades Hidráulicas
• Química
• Prueba en Columna
• Prueba de Capacidad de Tratamiento

rsidad Catóhca deJ fl ri'.i1


X-45

Tratamiento Pasivo de DAR – Procesos


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

“SRB”
• Humedales Artificiales
– Anaeróbicos (flujo de sub-superficie)
– Aeróbicos (pantanos – flujo superficial)
• Sistemas de Bioreactor
– Reservorios (e.g., pozas, celdas, tajo abierto, etc.)
– Minas subterráneas (e.g., chimeneas mineras/minas
inundadas)
– Biocunetas
– Paredes reactivas (o barreras reactivas permeables)

X-46

23
Bioreactor SRB
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Principales Componentes / Dimensiones


Aporte: flujo de 1,200 gpm; pH 7.8; Pb = 0.6 mg/L
– Poza de sedimentación 0.75 acres (0.3 ha)
– 2 Celdas Anaeróbicas (SRBR) 0.5 ac (0.2 ha) cada una
– Sustrato: 6 ft (2m) de profundidad, revestimiento HDPE 40 mil
• 67% aserrín, 19% caliza (bajo Mn),
• 12% abono, 2% heno
– Filtro de roca aeróbica – 1.4 acres (0.6 ha)
– Poza de aereación revestida en HDPE– 2 acres (0.8 ha)
– Costo total con ingeniería: US$ 700,000

Flujo de salida: pH 7.8; Pb=0.027-0.05 mg/L

rsidad Catóhca deJ fl ri'.i1


X-47

Humedales Artificiales
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

“Los humedales artificiales son sistemas


ecológicos que combinan procesos físicos,
químicos y biológicos en un sistema
diseñado y manejado”

EPA EE.UU., 1999

X-48

24
Humedales Artificiales
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

 Pueden remover acidez, metales, TDS y nutrientes (e.g.,


DBO/DQO, amonio/nitrato, fósforo)

• Humedales aeróbicos (apropiados para efluentes


neutros a alcalinos)
• Humedales anaeróbicos (apropiados para acidez,
metales)
• Humedales de flujo superficial (aeróbicos)
• Humedales de flujo de sub-superficie (aeróbicos o
anaeróbicos)

rsidad Catóhca deJ fl ri'.i1


X-49

Remoción de Metales mediante Humedales


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Procesos principales en Humedales Aeróbicos:


– Oxidación, hidrólisis (i.e., Al, Fe), precipitación y
adsorción en materia orgánica y superficies de
hidróxido de Al/Fe (y oxidación de NH3 a NO3)
• Procesos principales en humedales
anaeróbicos:
– Reducción de sulfato – generación de H2S–
precipitación de metales
– Degradación de nitrato
– Reducción del selenio
– La química de Mn y Fe es compleja

X-50

25
Humedal Aeróbico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Agua
15 – 100 cm

Arcilla

X-51

Humedales Aróbicos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Descripción
– Poza de contención de agua
– Vegetación plantada en sedimentos relativamente
impermeables (e.g., arcilla)
– Recibe agua neta alcalina – frecuentemente un
método de tratamiento posterior
Almacenan alcalinidad y precipitados
Facilitan la oxidación y presenta tiempo de
residencia para precipitación de metales
Neutralizan acidez generada por la precipitación
de metales

X-52

26
Sistema aeróbico de humedales
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

rsidad Catóhca deJ fl ri'.i1


X-53

Humedales Aeróbicos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Requisitos para una aplicación exitosa


– Aportes de agua neta alcalina capaz de tratar con
cargas ácidas latentes
– Cada 300 m2 de humedal puede tolerar
aproximadamente 1.0 kg H2SO4 por día
– Concentraciones de O2 ambiental
– pH > 6 del aporte
– Flujo que permita tiempos máximos de residencia
(e.g., 1-5 días)

X-54

27
Humedales Aeróbicos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Ventajas
• Las plantas de los humedales adsorben y
físicamente enlazan precipitados de metales
• Remoción de Fe, Al, Mn, Zn, Cu, etc. de la
columna de agua

Limitaciones
• Sólo adecuados para bajas cargas de metal
disuelto y metales seleccionados
• Se requiere mantenimiento periódico.

rsidad Catóhca deJ fl ri'.i1


X-55

Humedal Anaeróbico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Descripición
– Poza de contención de agua
– Contiene sustrato rico en materia orgánica (SRMO) y caliza

 Oxida metales en capas superficiales aeróbicas


 Genera alcalinidad mediante la actividad bacteriana y
disolución de caliza
 Reduce concentraciones de metal mediante
precipitación de sulfuro e hidróxido
 Eleva el pH a 6-7
 Neutraliza la acidez generada por la precipitación de
metales

X-56

28
Humedal Anaeróbico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Agua
3-10 cm

Materia Orgánica
30–60 cm

Grava de caliza
15-30 cm

X-57

Humedal Anaeróbico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Descripición
– Poza de contención de agua
– Contiene sustrato rico en materia orgánica (SRMO) y caliza

 Oxida metales en capas superficiales aeróbicas


 Genera alcalinidad mediante la actividad bacteriana y
disolución de caliza
 Reduce concentraciones de metal mediante
precipitación de sulfuro e hidróxido
 Eleva el pH a 6-7
 Neutraliza la acidez generada por la precipitación de
metales

X-58

29
Humedal Anaeróbico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Requisitos para una aplicación exitosa:


– Agua ácida neta (cargas bajas)
– Cargas ácidas: 200 – 500 m2 de humedal puede
neutralizar 1 kg H2SO4 por día
– Concentraciones de O2 ambiental cerca a la
superficie
– Concentraciones de O2 <1.0 mg/L en subsuelo
– pH > 2.5
– Flujo: que permita tiempos máximos de residencia
(e.g., 1-5 días)

rsidad Catóhca deJ fl ri'.i1


X-59

Humedal Anaeróbico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Ventajas
• Plantas de humedales adsorben y enlazan
físicamente precipitados de metales
• Remoción de Fe, Al, Mn, Zn, Cu, etc. de la
columna de agua
• Los precipitados de sulfuro son generalmente
menos solubles que sus correspondientes
hidróxidos de metales

X-60

30
Humedal Anaeróbico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Limitaciones clave
– Se requiere adición de rutina de nutrientes (material orgánico,
P/N para las bacterias)
– Es de gran ayuda el monitoreo de las bacterias sulforeductoras
– Insuficiente área de humedales, sobrecarga de metales y ácidos
– Recubrimiento de la caliza por precipitaciones de yesto, Fe, Al,
Mn, y sulfuro
– Máximo pH alcanzado de 6-7.5 – no todos los metales
precipitan
– Se requiere tiempos prolongados de residencia de agua

rsidad Catóhca deJ fl ri'.i1


X-61

Sistemas Reductores y Productores de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Alcalinidad
• Sistemas Productores de Alcalinidad (SPA)
• Sistemas sucesivos productores de alcalinidad
(SSPA)
• Sistemas inversos productores de alcalinidad
(SIPA)
• Humedales de flujo vertical

X-62

31
Sistemas Productores de Alcalinidad (SPA)
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Adaptados para superar los requerimientos de


áreas extensas de humedales anaeróbicos
• Consiste en un sistema de colección de
plataforma de drenaje con superposición de
grava de caliza, que a la vez presenta
superposición de materia orgánica
• El DAR fluye verticalmente hacia bajo del
sistema
• Los flujos de salida pueden requerir tratamiento
posterior empleando un humedal aeróbico

rsidad Catóhca deJ fl ri'.i1


X-63

Sistemas Productores de Alcalinidad (SPA)


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Afluente

90-200 cm Dirección del flujo


Water
Agua embalsada
15–50 cm
Materia orgánica
Grava de caliza
30-100 cm
Efluente

X-64

32
Sistemas Sucesivos Productores de
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Alcalinidad (SSPA)
• Dos o más SPA colocados consecutivamente –
número de recipientes por escalas para cumplir
con los requerimientos de flujos, estado del redox
y acidez promedio del afluente
• Usado cuando un SPA no genera suficiente
alcalinidad – debido frecuentemente a la
precipitación de metales en la caliza y capas
orgánicas
• Los flujos de salida pueden requerir tratamiento
posterior empleando un humedal aeróbico.

rsidad Catóhca deJ fl ri'.i1


X-65

Sistemas Sucesivos Productores de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Afluente
Alcalinidad (SSPA)

90-200 cm Agua embalsada

15–50 cm Materia orgánica


30-100 cm Caliza

Sistema de Drenaje 90-200 cm


Agua embalsada

15–50 cm Materia Orgánica


30-100 cm Caliza

Sistema de Drenaje Efluente

X-66

33
Sistemas Inversos Productores de
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Alcalinidad (SIPA)
• Similar al SPA pero el sistema es inverso
• El DAR ingresa verticalmente a través de la
base del embalse
• Después de su ingreso, el DAR se encuentra
con la capa de grava de caliza con
superposición de materia orgánica y una poza
de agua
• Los flujos de salida pueden requerir tratamiento
posterior empleando un humedal aeróbico

rsidad Catóhca deJ fl ri'.i1


X-67

Sistemas Inversos Productores de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Alcalinidad (SIPA)

Dirección del flujo

90-200 cm
Agua embalsada Efluente
15–50 cm Materia Orgánica
30-100 cm Caliza

Afluente

X-68

34
Humedales con flujo vertical (HFV)
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Consisten en una mezcla de materia orgánica y


caliza
• El DAR usualmente fluye de manera vertical
hacia abajo del sistema
• La precipitación de sulfuro ocurre dentro de los
HFV.

rsidad Catóhca deJ fl ri'.i1


X-69

Humedales de Flujo Vertical (HFV)


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Afluente

Dirección del

-Caliza
l
- - - - - - - - - - - flujo

- - - y--Materia
Orgánica
- - -
- - - - - -
- -- - - - -- - - - -- - -- - - - - - -
- ---- -- - - - - -
- - - -

Efluente

X-70

35
Sistemas Reductores y Productores de
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Alcalinidad
• Contienen un sustraro rico en materia orgánica (SRMO)
y caliza
generan alcalinidad mediante la actividad bacteriana y
disolución de caliza
generan condiciones reductoras – los metales
permanecen en solución o precipitados como sulfuros
 Eleva el pH a 6-7
 Sistema post reductor y productor de alcalinidad:
Neutralizan la acidez generada por la oxidación de
hierro

rsidad Catóhca deJ fl ri'.i1


X-71

Sistemas Reductores y Productores de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Alcalinidad
• Requerimientos para una aplicación exitosa
– Concentraciones de O2 <1-3 mg/L
– pH > 2.5
– Rango de acidez: <300 mg/L as CaCO3
– Flujo promedio: <15 L/s
• Carga de acidez: <100 kg CaCO3 / d

X-72

36
Sistemas Reductores y Productores de
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Alcalinidad
• Ventajas
– Bajo costo de operación
– Bajo condiciones ideales, la necesidad de
mantenimiento es menor
– Se requiere un área relativamente pequeña para la
instalación
– Adecuados para situaciones de bajo flujo y filtración
– Operan bien cuando el DAR es significativamente
reducido y contiene Fe elevado pero poco Al (e.g.,
minas de carbón)

rsidad Catóhca deJ fl ri'.i1


X-73

Sistemas Reductores y Productores de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Alcalinidad
• Limitaciones clave
– Alto costo de capital
– Obstrucción de poros por el yeso y precipitados de
metales (particularmente Al y sulfatos)
– La compactación progresiva disminuye la
permeabilidad
– Se requiere considerable mantenimiento si no puede
prevenirse la precipitación de Al (e.g., puede
requerirse lavado)
– Altura hidráulica insuficiente para SPA, SSPA y HFV
– El abandono (WALK-AWAY) no es la solución!

X-74

37
Cinética de la Oxidación de Mn y Fe
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

HJt,LF-LIVES FOR -OXYGENATI0N OF Fe( II) & Mn(II ) S IP'EC:I ES


(OM•,) MEANS BOUND TO A METAL 0 •X IDE l;IJl,IRFAl;e

Fe (11) SF'ECll=:S A!PPlilOX, pH M ~ (11) Sl?iECIES APPROX. pH

Fc ;íl -t - 3
10• y
Mln :z+ - a.
w 1 y -
li.
:::; >--- - MnOI-I + -7
__.
li.
~ -
:!
11
11 11
(1

F"'(OM=) :1: ~ 7
~-~- Mn(OM=} 2
Mn(OH}~ :;,
7
B,
1 m in ,=----· - - FCOH .,
1 ,;;

1 1'1'119; ~ --- F,\l{OHI) 2 - a

Fmm Wellrl'I & S~urnm (;t l'.NMI}

rsidad Catóhca deJ fl ri'.i1


X-75

Puntos Críticos del Manganeso


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• En los sistemas anaeróbicos, el Mn no se precipitará


hasta que el valor del pH sea aproximadamente 8.
• En los sistemas aeróbicos, la oxidación del Mn es
extremadamente lenta hasta alcanzar pH > 8.
• Si el Fe (II) está presente en el agua, reducirá el MnO2
a Mn(II).
• Límites del Mn:
– Límite del efluente de carbón: 2 mg/L
– Límite de toxicidad acuática: 1 mg/L
– Límite de MSF: 0.1 mg/L

El Mn es el último metal y el más difícil de remover

X-76

38
... _
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
7.2G - :a:_1

--- ... ~ -- . . ...


,.oo -- ---~
. ___O.¿ 15,
(l,00 H~~ , ,
........ ............
O.GO ...... ... _ 1D
...........
Anz0.1
0.40
~ ~T
5

~- D.20 pE
w
0.00
.... _Hz!J
-Q.20
H2··., -......

-[J.~0
Mnfc.iH"n
•(1.60 - - ~... _. . . -10

1 'I
liid
1 o 2; 4 G 8 1n 12 14
pHX-77
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Tratar 4,000 gpm (15.1 m3/min) de agua que contiene 70 –


80 mg/L de Mn en menos de 50 acres (20 hectáreas)

PROCESO DE REMOCIÓN del Mn


Mn+2(ac) + 2 H2O + O2(ac)  2 MnO2 + 4H+ (ac)

8 mg/L de O2 remueve 28 mg/L de Mn

Por lo tanto, se tiene que reponer el


doble de O2 para lograr la remoción
total

MnO2 CONCRETO

X-78

39
Resultados: Remoción Aeróbica del Mn
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

MUESTRA DEL ECOSISTEMA pH % Mn


REMOVIDO
Algas que crecen en drenaje ácido de ~4 0
mina

Precipitado marrón en el efluente en el ~5 0


humedal construído
Lodo negro en el efluente de la planta de ~8 34
tratamiento de aguas residuales
MnO2 sólido negro en drenaje ácido de ~ 6,5 51
mina
Espuma de poza (algas) del arroyo de ~7 100
agua dulce

rsidad Catóhca deJ fl ri'.i1


X-79

Comparación de Costos con el Sistema Activo


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Puede tratar 4,000 gpm (15.1 m3/min) con sistema


de 30 acres (12 hectáreas)
– Costos de capital ~ US$ 6 x 106
– Costos O&M (Incluyendo remplazo del substrato)
~ US$ 250,000 / año

• Tratamiento Activo
– Costos de capital ~ US$ 15 x 106
– O&M ~ US$ 1.5 x 106 /año

X-80

40
Condición de Movilidad y Oxidación de Fe en un
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Sistema Anaeróbico

1000 - - - - - -- - - -- -- - - -
n

100 -
MOVILIDAD DE
PRECIPITACIÓN Fe(II)
10 POR SULFURO

PRECIPITACIÓN
POR HIDRÓXIDO

·-·-- ~'":Fir,,:·r L.E'\IEL


(1.1 1.......__ _,__ ___._ _,.___...__ _.,_ _ ~ _ _..__ __,___ _..__ _,__ __._---'
1112-4 10/8 10/21 11113 1 213 118 212S 3124 4/.28 Ei/26 lit.30 7/27

OJI.TE

rsidad Catóhca deJ fl ri'.i1


X-81

Conclusiones de ingeniería
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Es esencial un proceso por etapas


• Funcionan los principios geoquímicos
• La estimación de la conductividad hidráulica
constituye un problema
• Algunos casos de remoción no se han
tomado a escala real
– Remoción de As y Se
– Remoción de cianuro
– DAR con alta acidez de mineral

X-82

41
Tratamiento Pasivo de Agua de Mina
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Fases del Diseño en Etapas

• Pruebas de Laboratorio (prueba del principio)


• Pruebas en plataforma
• Pruebas piloto
• Escala real limitada (módulos)
• Implementación a escala real

rsidad Catóhca deJ fl ri'.i1


X-83

Pruebas aeróbicas a nivel de banco


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

X-84

42
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Plantas de humedales

X-86
X-85

Pruebas anaeróbicas a escala de banco

43
Pruebas de campo a escala piloto
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Celda anaeróbica de 25 gpm Celda aeróbica de 10 gpm

rsidad Catóhca deJ fl ri'.i1


X-87

Uso integrado de las unidades de proceso


Curso de Especialización en Cierre de Minas y Pasivos Ambientales


Pump

X-88

44
Sistema Westfork a escala real
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• 1,200 gpm de agua, pH = 8, concentración de Pb 0.2 –


0.8 mg/L
• Límite ambiental para el Pb: 0.029 mg/L
• El costo fue US$ 500,000
• Operación dentro de los límites ambientales desde 1996.
• El gran problema operativo es la conductividad hidráulica
(hacer que 1,200 gpm (4.54 m3/min) atraviesen el
sustrato).

rsidad Catóhca deJ fl ri'.i1


X-89

Tratamiento pasivo de plomo disuelto a


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

1,200 gpm a escala real

5 acres, 1,200 gpm Premio a la excelencia en ingeniería,


Poza de 1998
sedimentación

Celdas anaeróbicas
Celda de
filtro de roca
aeróbica

rk
t Fo
W es
Poza de
limpieza

X-90

45
Costos aproximados del “Diseño”
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Prueba de verificación del principio


– US$ 5K-8K; 6-8 semanas
• Pruebas a escala de banco
– US$ 12K-20K; 12-24 semanas
• Pruebas a escala piloto
– US$ 20K-50K; 6 meses - 2 años
• Escala real
– En función del tamaño / capacidad

Es posible ahorrar si se utiliza un laboratorio interno y uno mismo


realiza las pruebas

rsidad Catóhca deJ fl ri'.i1


X-91

Comparación de Costos
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Dosificación de cal vs. Tratamiento pasivo


Agua de mina: 6.3 a 300 L/seg; pH 2.3-4.5; Metales 270-1,000 mg/L
$1.00

¡;;- Nota: Los costos de cal puede ser ligeramente


::::> más altos
.,,
U>
en $0.80
en
.....
e
w
o> $0.60
2
w
o:::
....1
e(
1-
w $0.40
2
C)
~
o:::
w $0.20
D..
1-
U)
o(.J
$0.00
LIM E CAP IT A L LI ME O PER A T ING LI ME N P V COST
WETL AND C AP ITAL W ETL AND O P ERATING \NETLAND NPV COST
X-92
HIGH ANO LOW RANGE OF CAPITAL, OPERATING & NPV COSTS

46
Resumen Económico
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Los costos capital del tratamiento pasivo pueden ser más altos que
los costos capital de dosificación de cal
• Los costos operativos de tratamiento pasivo típicamente son mucho
más bajos que los costos operativos de dosificación de cal (verificar
por su cuenta con software AMDTreat )
• Las comparaciones de costos entre las alternativas de tratamiento
de agua deben incluir el costo unitario de la remoción de la masa
metálica
• El análisis de Valor Presente Neto sugiere que el tratamiento pasivo
es mucho más económico (entre 10% y 50% ) que la dosificación de
cal durante un tratamiento prolongado de agua de mina

rsidad Catóhca deJ fl ri'.i1


X-93

Beneficios potenciales de los


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

procesos biológicos “pasivos”


• Es una alternativa sostenible frente a los métodos
químicos tales como neutralización con cal, precipitación
por sulfuro
• Mantenimiento potencialmente bajo, requerimientos
bajos de energía y de entrada de materiales
• Puede proteger los recursos hídricos manteniendo los
constituyentes inmovilizados
• Elimina la colección y disposición de lodos
• Estéticamente atractivo
• Puede convertirse en un valioso refugio para la vida
silvestre

X-94

47
Limitaciones y necesidades de investigación
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Su desempeño depende en gran parte de las condiciones


ambientales, por ejemplo, temperatura
• No puede manejar situaciones y fluctuaciones de carga
alta tanto en velocidad del flujo como en química del
agua.
• El costo depende mayormente de las condiciones del
sitio, la disponibilidad de espacio, la química del agua y
los requerimientos de tratamiento
• Puede requerir la integración de diversos métodos
• Su aplicación es mayormente específica para un sitio.

rsidad Catóhca deJ fl ri'.i1


X-95

Aplicación del Proceso SRB a un


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Reservorio en el “Tajo Abierto”

WASTE
ROCK

SURFACE
RUNOFF

SEEPAGE FINAL
LIMESTONE POLISHING DISCHARGE
(WETLANDS)
OPEN PIT

pH>7 NUTRIENT
REMOVAL
ER
IV
R

SUBSTRATE
AND SRB

pH 6.5

X-96

48
Curso de Especialización en Cierre de Minas y Pasivos Ambientales
Tratamiento Pasivo Aeróbico No-vegetado en sitio
“LTA”, Québec, Canadá
PLAN VIEW O F APPLICATIO N

ARD ARD

W ASTE ROCK STO NE BERM


DUMP

AMD COLLECTIO N
AND TREATMENT DITCH

STONE BERM
LIMESTO NE DRAIN

SETTLING PO ND
TRE ATED (CLEAN) AMD

....
STO N E BERM PEAT TILL BERM

SETTLING
POND
AMD SPILL WAY

TREATED
AMD

LIMESTONE CLAY LIMESTONE


(IMPERMEABLE DRAIN
GROUND)

CROSS SECTIO N

rsidad Catóhca deJ fl ri'.i1


X-97

Filtración por Membrana - Descripción General


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Procesos y aplicaciones de membrana


– Microfiltración: sólidos suspendidos (turbiedad,
quistes, bacterias)
– Ultrafiltración: sólidos suspendidos (turbiedad,
quistes, bacterias, virus)
– Nanofiltración: sólidos disueltos (dureza, sabor, olor,
color, carbono orgánico total)
– Ósmosis inversa: sólidos disueltos (sales acuosas,
pesticidas, carbono orgánico total)

• Diseño del módulo de la membrana

X-98

49
Características de las Membranas
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Proceseso Tamaño (mm) Presión (psi)

Microfiltración 0.1 – 3.0 5 – 30

Ultrafiltración 0.01 – 0.1 5 – 50

Nanofiltración 0.001 – 0.01 100 – 500

Osmosis Reversa 0.0001 – 0.001 100 – 1,200

rsidad Catóhca deJ fl ri'.i1


X-99

Diagrama de bloques de nanofiltración de


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

agua de lixiviación o agua subterránea ácida


Agua de Lixiviación

!- -
Agua Subterránea Ácida

Bombas de
Alimentació
n
Inyección
Antiescalante via celdas

Pre-
Bombas de
Celdas de Concentrado Scavenger y
Alimentación a línea de relaves
Filtración alta presión NF
al depósito de
relaves

Tanque de Sistema de
Agua de la Lavado
Planta Permeado
Permeado

Agua con Pluma de sulfato Celdas de


RO

X-100

50
Desafíos Ambientales
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Adoptar una “Política Ambiental”


– Evaluar, planear, construir y operar “cumpliendo con la legislación
aplicable”;
– En ausencia de legislación, aplicar las “Mejores Prácticas de
Gestión” costo efectivas;
– Mantener un programa activo, continuo y de automonitoreo;
– Promover la investigación;
– Trabajar proactivamente con el gobierno y el público; y
– Mejorar la comunicación y conocimiento sobre generación de
DAM, tratamiento para la prevención y el control.
• Considerar:
– Alternativas de desarrollo sostenible
– Requerimientos a largo plazo!!!!

rsidad Catóhca deJ fl ri'.i1


X-101

51
Ejemplos de la Experiencia de Golder
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Sistemas a Gran Escala, Demostración y Piloto


• West Fork, Missouri, EEUU (Gran escala)
• Judy 14, Pennsylvania, EEUU (Demostración)
• Fran Mine, Pennsylvania, EEUU (Piloto)
• Golinsky Mine, California, EEUU (Piloto)
• Fabius Coal Mine, Alabama, EEUU (Gran Escala)
• Wheal Jane Mine, Cornwall, Reino Unido (Piloto)
• Haile Mine, South Carolina, EEUU (Piloto Pleno)
• Barrick Gold LTA Site, Québec, Canadá (Pleno, Aireado, 1997)
• Barrick Gold Cadillac Moly Site, Québec, Canadá (Integrado,
2003)
• Otras aplicaciones: Tratamiento de Lixiviado de Rellenos
sanitarios, etc

rsidad Catóhca deJ fl ri'.i1


XI-1
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Ejemplo:
Cadillac Moly Site, (Val d’Or, Québec, Canadá)
• Se recopilaron/revisaron datos de las condiciones in situ
• Se identificaron fuentes de nutrientes localmente disponibles
• Se realizaron estudios de laboratorio
• Se evaluaron requerimientos hidráulicos
• Se diseñó un sistema de tratamiento
• Se preparó y acondicionó nutrientes/substrato

XI-2

1
Vista del Sitio y Ubicaciones de Tratamiento de DAR
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Relaves Estación 2

Lago Preissac
Estación 1

rsidad Catóhca deJ fl ri'.i1


XI-3

Corte transversal de Zanja Colectora de DAR


Curso de Especialización en Cierre de Minas y Pasivos Ambientales

\.
·,,
Relaves
... .:::---- __
--._ ,; ·"''' .. f "'

_,_._ .....
.:· - - - - - ' ~ - - - -- ..-='---rl-'"'"I~
11..-~ ......

C: r:! 0~'5-E.O:i lON or A.n: O


ClOLL,; CT ION C!l"TC i.l

XI-4

2
Diseño del Sistema de Tratamiento de DAR
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

PLA'N V IE!/1.'

~. . . . ..--tt
,
ARD c" ____LJ
Collection,.,,. · - - = ~ - -· - - - - ~ Limestone
Aerobic
SRB Cell Pond Drain


LA YOUT A INI O Cl'!OSS-SECTIONI OF AR
TR5ATMENT SY8T M A T !ilTATlON:t

rsidad Catóhca deJ fl ri'.i1


XI-5

Preparación de Nutrientes/Substrato
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Nutrientes Seleccionados
Virutas de madera
Fertilizante artificial
Piedra caliza

XI-6

3
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

XI-8
XI-7
Implementación

Implementación

4
Curso de Especialización en Cierre de Minas y Pasivos Ambientales Curso de Especialización en Cierre de Minas y Pasivos Ambientales

rsidad Catóhca deJ fl ri'.i1


XI-9

XI-10
Implementación
Implementación

5
Dos años después
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

XI-11

Resultados a la fecha
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

Calidad del agua antes y después del tratamiento


Parámetro MENVIQ Antes Después
Promedio Promedio
(mg/L) Promedio 2004 2005
pH 6.5 3.45 6.3 6.7
TSS 25 230 3.5 11.7
Al - 43 - 9.4
Cu 0.3 0.3 0.06 0.008
Fe 3 32 11 0.12
Mn - 5.8 - 3.5
Ni 0.5 0.6 0.18 0.01
Zn 0.5 1.35 0.3 0.012
SO4 - 887 690 530
 Potencial promedio de reducción/oxidación (ROP) en la celda SRB (-300 mV
entre Mayo & Agosto)
 Alcalinidad promedio generada ~440 mg/l.

XI-12

6
Resultados a la fecha
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• Con el sistema pasivo integrado incluyendo una


celda SRB se obtuvo un tratamiento adecuado
• Incremento del pH ~6.5
• Remoción de iones de metal hasta los límites
deseados
• La temperatura dentro de la celda SRB fue ~ 40 C
entre los meses de Diciembre y Abril
• El desempeño de la celda SRB mejora durante la
temporada más calida
• La preparación / acondicionamiento de los nutrientes
/ substrato bajo condiciones óptimas fue un factor
crítico.

rsidad Catóhca deJ fl ri'.i1


XI-13

Conclusiones
Curso de Especialización en Cierre de Minas y Pasivos Ambientales

• El rendimiento global del sistema de tratamiento muestra


buenos resultados, incluso en los períodos fríos
• SRB son el factor principal
• Se continuará monitoreando para recopilar más
información sobre:
– El desempeño del sistema y los mecanismos del
proceso
– Posibilidades de mejoras
– Costos y requerimientos de mantenimiento a largo
plazo
– Contingencias (e.g., manejo del substrato, reemplazo
futuro, clausura del sistema)

XI-14