Letters in Applied Microbiology 1996,22, 353-356

Development of a polymerase chain reaction assay for the

detection of Listeria monocyfogenes in foods
N.S.Bansal
Molecular Microbiology Laboratory, Division of Analytical Laboratories, NS W Health Department, Lidcornbe, NS W,
Australia
JIPA 16:received 21 August 1995 and accepted 9 October 1995

N .s. BANSAL. 1996.Species-specific oligonucleotide primers were selected from the

coding region of the listeriolysin 0 gene of Listeria monocytogenes a n d were used
in conjunction with genus-specific primers a n d a n internal control fragment for
polymerase chain reaction amplification. The specificity of the primers was confirmed by
testing 40 isolates of L. monocytogenes, other Listeria species a n d other micro-organisms
which are ubiquitous in the environment. T h e reliability of these primers was
further tested in parallel with standard cultural methods. In a preliminary study, over
250 different food samples were examined and PCR results were in complete agreement with
those obtained from standard cultural procedures.

INTRODUCTION applications published thus far appears to be suited for rou-

Listeriu monocytogenes is regarded as a highly significant
human pathogen. It is the only pathogenic Listeriu species
known to be incriminated in food-related human outbreaks
and sporadic cases of listeriosis (Faber and Losos 1988). The
ubiquitous distribution of this pathogen in nature, its ability
to proliferate at refrigeration temperature and its tolerance of
certain preservative agents make its elimination from food
very important. Current microbiological culture procedures
for the detection of Listeriu are laborious, cumbersome and
time consuming. T h e limited shelf-life of certain perishable
food products and the high cost of product storage present
further problems. As a consequence, there is an increased
demand for a rapid and reliable procedure for the detection
of L. monocytogenes to ensure food safety.
The polymerase chain reaction (PCR) allows rapid and
specific identification of micro-organisms. Several virulence-
associated genes have been sequenced and used as PCR tar-
gets for the detection of L. monocytogenes: for example, the
listeriolysin 0 gene (hlyA) (Bessesen et ul. 1990; Border et
al. 1990; Deneer and Boychuk 1991 ; Rossen et al. 1991), the
Dth 18 gene (Wernars et ul. 1991) and the iup gene (Jaton et
ul. 1992).
Although several published reports have described the use
of PCR for the detection of L. monocytogenes, none of the
Correspondence to :Dr N.S. Bansal, Molecular Microbiology Laboratory,
Division oJAndytica1 Laboratories, NS W Health Department, PO Box
162. Ltdcombe, NSW 2141, Australia.
8 1996 The Society for Applied Bacteriology
tine screening of large numbers of samples from a diverse
range of food types. In this present work, a set of specific
primers selected from the coding region hly A gene and
the amplification conditions, along with analytical quality
assurance measures are described which can be employed for
routine monitoring of Listeriu in food.
MATERIALS AND METHODS
Bacterial strains
Bacterial strains used in this study are listed in Table 1. T h e
40 L. monocytogenes isolates originated primarily from the
culture collection at the Division of Analytical Laboratories,
NSW Health Department, where they were identified and
confirmed by standard microbiological methods.
Culturing conditions
Samples of dairy products were tested for L. monocytogenes
using the Australian standard method (Standards Australia
1991). All other food samples were examined using the double
selective enrichment method published by the USDA-FSIS
(McClain and Lee 1989). PCR was conducted after selective
enrichment and centrifugation of propagated cells.
DNA extraction
Genomic DNA used in PCR specificity tests was purified
from bacterial colonies or cultures by the guanidium thio-
354 N.S.BANSAL

Table 1 Bacterial strains used in this

Bacterial strain No. of isolates tested Source studv
Listeria species
monocytogenes 40 DAL
FDA/V7
tnnucua 15 DAL
FDA/C 1-94
ivanovii FDA/KC1714
seeligeri DC
welshimeri DC
grayi DC
murrayi DC
Other bacteria
Aeromonas hydrophila 1 NCTC 8049
Bacillus cereus 1 NCTC 9945
Bacillus pumilus 1 NCTC 8241
Citrobacterfreundii 1 NCTC 9750
Escherichia coli 1 NCTC 9001
Enterobacter aerogenes 1 NCTC 10006
Legionella pneumophila 1 ATCC 33152
Micrococcus luteus 1 ATCC 9341
Proteus vulgaris 1 NCTC 4635
Pseudomonas aeruginosa 1 NCTC 6749
Ps. Juorescens 1 NCTC 10038
Salmonella monchaui 1 IMVS 100
Salm. salford 1 IMVS 1710
Salm. typhimurium 1 NCTC 74
Staph.ylococcus aureus b-haemolytic 1 FDA
Staph. epidemidis 1 NCTC 65 13
Staph . faecalis 1 NCTC 775
Vibrio parahaemotyticus I NCTC 10884

NCTC, National Collection of Type Cultures ; ATCC, American Type Culture Collection ;
FDA, Food and Drug Administration ; DC, Dairy Corporation (NSW) ; IMVS, Institute of
Medical and Veterinary Science (SA) ;DAL, Division of Analytical Laboratories (NSW).

cyanate method described by Pitcher and Sanders (1989). In
the detection of L. monocytogenes from food samples, bacterial
cells were recovered by the centrifugation of 10 ml of selective
enrichment. DNA was extracted by lysing bacterial cells at
96°C for 12-15 min on a hot block. T h e cellular debris was
pelleted by centrifugation at 12000 g for 10 min and the
clear supernatant fluid containing nucleic acids was used for
subsequent PCR reactions.
Synthetic oligonucleotide primers
Four oligonucleotide primers were used in the PCR assay.
All primers were synthesized by Beckman Instruments (Aus-
tralia) Pty Ltd. Primers UI and LII have been previously
described to be specific for all members of the genus Ltsteria
(Border et al. 1990). Two further oligonucleotide primers,
specific for L. monocytogenes were designed and synthesized
according to the determined sequence of the listeriolysin 0
0 1996 The Society for Applied Bacteriology, Letters in Applied Microbiology22, 353-356
gene (Mengaud et al. 1988). T h e sequences were
S'CAAACGTTAACAACGCAGTA3' and S'TCCAGAG
TGATCGATGTTAA3' (designated as LF and LR, re-
spectively).
PCR assay
PCR amplification was performed in 0 5 ml tubes in a total
reaction volume of 50 pl, consisting of: 10 mmol 1-' Tris-
HCl (pH 8.3), 50 mmol 1-' KCl, 1.5 mmol I-' MgC12,
O.O0lo/o (w/v) gelatin, 200 pmol I-' (each) deoxynucleoside
triphosphate, 1 pmol 1-' (each) primer and 2 U of Tug DNA
polymerase (Boeringer Mannheim). The reaction mixture
was overlaid with a drop of sterile mineral oil and incubated
in a programmable DNA thermal cycler (Perkin-Elmer DNA
Thermal cycler 480). The cycling parameters used were initial
denaturation at 95°C for 1 min followed by 30 cycles, each
consisting of 30 s at 94"C, 20 s at 51°C and 30 s at 72°C.

After the last cycle, the PCR tubes were incubated at 72°C
for 8 min and held at 4°C. A reagent blank, which contained
all the components of the reaction mixture with the exception
of template DNA (which was substituted with sterile distilled
water), was included in every PCR procedure. A Listeriu
internal positive control fragment (LIPC) (2 fg) was also
included in all PCR assays.
Detection of PCR products
PCR products (10 pl) were analysed by submarine gel electro-
phoresis (10 x 12 cm) in 1*2"/o agarose gel. Gels were run for
60 min at 90 V in Tris-acetate buffer and stained with ethi-
dium bromide (0.5 pg ml-I). The electrophoresed products
were visualized by U.V.transillumination and photography.
Molecular weight size markers (Lambda DNA cut with EcoRI
plus HindIII) were included in each gel.
RESULTS AND DISCUSSION
T o detect L. monocytogenes using PCR, potentially suitable
oligonucleotide primer sequences complementary to the
nucleotide sequence of the virulence gene listeriolysin 0
(hlyA) were examined from a region which is known to be
specific for L. monocytogenes (Mengaud et al. 1988). The
primers L F and LR were selected to amplify a 750 bp region
of the hlyA gene. On the basis of the published nucleotide
sequence reported by Mengaud et al. (1988), the primer LF
is located at nucleotides 577 to 597 and the primer LR is
located at nucleotides 1306 to 1326 within the coding region
of the hlyA gene. T o assess whether these primers were
specific for L. monocytogenes, PCR amplification was per-
formed on DNA purified from 40 isolates of L. monocytogenes
as well as other Listeria species (Table 1). T h e PCR ampli-
fication with LF and LR primers generated an expected size
product with a length of 750 bp (Fig. 1) from all L.
monocytogenes strains tested but not from other Listeria species.
The specificity of the primers employed was further demon-
strated by attempting to amplify purified genomic DNA from
other bacterial species including haemolytic bacteria (Table
1). However, no amplification products were apparent from
bacteria other than L. monocytogenes.
Border et al. (1990) described PCR conditions and a com-
bination of five different oligonucleotide primers for the
detection of Listeria and specifically L. monocytogenes. Using
two of these primers specific for L. monocytogenes (LM1 and
LM2), weak PCR products of different size than that
expected were observed with purified DNA from L. ivanovi,
L. innocua and L. gruyi (Fig. 2, lanes 8 , 9 and 11). Presumably,
these non-specific PCR amplicons were due to spurious prim-
ing. Production of non-specific PCR amplicons is known to
occur as the result of priming at loci that share some homology
with target sequences (Saiki et al. 1988). However, no such
0 1996 The Society for Applied Bacteriology, Letters in Applied Microbiology 22, 353-356
DETECTION OF L . MONOCYTOGENES IN FOOD 355
1 2 3 4 5 6 7 8 91011
938
750
525
Fig. 1 Agarose gel electrophoresis of PCR-amplified products
from different food samples. Lanes : 1 to 7 represent target
DNA prepared from secondary enrichment broth of different
food samples ; 8, positive control Listeviu monocytogetm
(FDA/V7) ; 9, reagent blank (no template); 10, negative control
(contains 2 fg LIPC); 11, molecular size markers (lambda DNA cut
with EcuRI plus HindIII). Lanes 1 and 2 , L. monocytogenes-
positive food samples ; lanes 3 to 7 , Listeriu-positive food
samples
spurious amplicons were evident using LF and LR primers
with any of the Listeria species tested (Fig. 2). These results
clearly indicate that the primers LF and LR have a high
affinity for the correct target sequence and are specific for L.
monocytogenes.
T h e LF and LR primers also amplified a Listeria internal
positive control (LIPC) fragment. T h e LIPC is a cloned
DNA sequence constructed by deleting the 225 bp DdeI
fragment located between nucleotides 1035 and 1259 of the
L. monocytogenes sequence so that it can be distinguished
from the target fragment on the basis of electrophoretic
mobility (Fig. 1, 525 bp band). The LIPC is a sensitive
indicator of poor amplification, which may be caused by
inhibitors of PCR in the sample or as a result of human error
in the setting up of PCR. The number of Listeria cells present
in the sample under investigation can be estimated semi-
quantitatively by comparing the intensity of target band(s)
and the LIPC band in a PCR assay. T h e intensity of the
ethidium bromide stained band of LIPC (2 fg) is equivalent
to approximately 100 cells m1-I.
In a multiplex PCR assay, the primers LF and LR could
356 N.S.BANSAL
1 2 3 4 5 6 7 8 91011121314
Fig. 2 Comparison of PCR products obtained when purified
DNA derived from different Listeria species were subjected
to amplification using LR and L F primers or L M l and LM2
primers. Lanes: 1-6, LF and LR primers; 8-13, LMl and
LM2 primers; 7, molecular size markers (Lambda DNA
cut with EcoRI plus HindIII) ; 1 and 8, L. ioanovii (FDA/
KC1714); 2 and 9, L. innocua (FDA/Cl-94); 3 and 10,
L. monoc,ytogenes (FDA/V7) ;4 and 11, L. grayi (DC) ;
5 and 12, L. seeligeri (DC); 6 and 13, L. melshimeri (DC);
14, reagent blank
be used in conjunction with a set of primers specific for
Listeriu reported by Border e t al. (1990). These primers (UI
and LII) are reported to detect all L z s t u i u spp., yielding a
938 bp PCR product (Fig. 1).
In a preliminary survey of a variety of over 250 food
samples, this multiplex PCR and standard culture results
were in perfect agreement, with no false positives or false
negatives (unpublished data). In addition, the PCR assay was
used on samples received in connection with two inter-
laboratory trials. Again, PCR and standard culture results
were in complete agreement (unpublished data). These find-
ings showed that the multiplex PCR assay is at least as sen-
sitive as standard culture procedures and can be applied
equally well to a diverse range of food products.
0 1996 The Society for Applied Bacteriology, Letters in Applied Microbiology 22, 353-356
ACKNOWLEDGEMENTS
T h e author wishes to thank Mrs C. Brown for her help in
preparing this manuscript, and is indebted to D r E.P. Crematy,
Director and Government analyst, NSW Health Department,
for permission to publish this paper.
REFERENCES
Bessesen, M.T., Luo, Q, Rotbart, H.A., Blaser, M.J. and Ellison,
R.T. (1990) Detection of Listeria monocytogenes by using poly-
merase chain reaction. Applied and Environmental Microbiology
56,2930-2932.
Border, P.M., Howard, J.J., Plastow, G.S. and Siggens, K.W. (1990)
Detection of Listeria and Listeria monocytogenes using polymerase
chain reaction. Letters in Applied Microbiology 11, 158-162.
Deneer, H.G. and Boychuk, I. (1991) Species-specific detection of
Listeria monocytogenes by DNA amplification. Applied and
Environmental Microbiology 57, 606-609.
Faber, J.M. and Losos, J.Z. (1988) Listeria monqtogenes: a food
borne pathogen. Canadian Medical Association Journal 138, 413-
418.
Jaton, K., Sahli, R. and Bille, J. (1992) Development of polymerase
chain reaction assay for detection of Listeria monorytogenes in
clinical cerebrospinal fluid samples. Journal of Clinical Micro-
biology 30, 1931-1936.
McClain, D. and Lee, W.H. (1989) Method for the isolation and
identification of Listeria monocytogenes from processed meat and
poultry products. Laboratory Communications No. 57. Revised
May 1989. USDA-FSIS, Beltville, MD.
Mengaud, J., Vincente, M.F., Chenevert, J., Pereira, J.M., Geof-
froy, C., Gicquel-Sanzey, B., Baquero, F., Perez-Diaz, J.C. and
Cossart, P. (1988) Expression in Escherichia coli and sequence
analysis of the listeriolysin 0 determinants of Listeria mono-
cytogenes. Infection and Immunity 51, 3 14-319.
Pitcher, D.G. and Saunders, N.A. (1989) Rapid extraction of bac-
terial genomic DNA with guanidium thiocyanate. Letters in
Applied Microbiology 14, 145-152.
Rossen, L., Holmstrom, K., Olsen, J.E. and Rasmussen, O.F. (1991)
A rapid polymerase chain reaction (PCR)-based assay for the
identification of Listeria monocytogenes in food samples. Inter-
nationalJoourna1 of Food Microbiology 14, 145-1 52.
Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, J., Higuchi, R.,
Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988) Primer-
directed enzymatic amplification of DNA with thermostable
DNA polymerase. Science 239,487494.
Standards Australia (1991) 1991b AS1766.2.15 (Int.) Food micro-
biology examination for specific organism-Listeria monocytogenes
in dairy products.
Wernars, K., Heuvelman, C.J., Chakraborty, T . and Notermans,
S.H.W. (1991) Use of the polymerase chain reaction for direct
detection of Listeria monocytogenes in soft cheese. Journal of
Applied Bacteriology 70, 121-126.