Journal Pre-proof

Antioxidant defenses and non-specific immunity at enzymatic and transcriptional

levels in response to dietary carbohydrate in a typical carnivorous fish, hybrid grouper
(Epinephelus fuscoguttatus ♀�× E. lanceolatus ♂)

Songlin Li, An Wang, Ziqiang Li, Jiacan Zhang, Chunyan Sang, Naisong Chen

PII: S1050-4648(20)30173-X
DOI: https://doi.org/10.1016/j.fsi.2020.03.015
Reference: YFSIM 6886

To appear in: Fish and Shellfish Immunology

Received Date: 17 February 2020

Revised Date: 5 March 2020
Accepted Date: 6 March 2020

Please cite this article as: Li S, Wang A, Li Z, Zhang J, Sang C, Chen N, Antioxidant defenses and non-
specific immunity at enzymatic and transcriptional levels in response to dietary carbohydrate in a typical
carnivorous fish, hybrid grouper (Epinephelus fuscoguttatus ♀�× E. lanceolatus ♂), Fish and Shellfish
Immunology (2020), doi: https://doi.org/10.1016/j.fsi.2020.03.015.

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition
of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of
record. This version will undergo additional copyediting, typesetting and review before it is published
in its final form, but we are providing this version to give early visibility of the article. Please note that,
during the production process, errors may be discovered which could affect the content, and all legal
disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier Ltd.

Credit author statement
Songlin Li: Conceptualization, Supervision, Visualization, Writing - Review &
Editing; An Wang: Investigation, Formal analysis, Writing - Original Draft; Ziqiang
Li: Investigation, Methodology, Data Curation; Jiacan Zhang: Investigation,
Resources; Chunyan Sang: Investigation, Data Curation; Naisong Chen:
Conceptualization; Validation; Project administration; Funding acquisition
 1 Antioxidant defenses and non-specific immunity at
2 enzymatic and transcriptional levels in response to dietary
3 carbohydrate in a typical carnivorous fish, hybrid grouper
4 (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂)
5
6 Songlin Li1,2,3,4*, An Wang1, Ziqiang Li1, Jiacan Zhang1, Chunyan Sang1, Naisong
7 Chen 1,3,4*
8
1
9 National Demonstration Center on Experiment Teaching of Fisheries Science,
10 Shanghai Ocean University, Shanghai, 201306, China
2
11 Guangxi Key Laboratory of Marine Natural Products and Combinatorial
12 Biosynthesis Chemistry, Guangxi Beibu Gulf Marine Research Center, Guangxi
13 Academy of Sciences, Nanning 530007, China.
3
14 Research Centre of the Agriculture Ministry on Environmental Ecology and Fish
15 Nutrition, Shanghai Ocean University, Shanghai, 20136, China.
4
16 Shanghai Collaborative Innovation for Aquatic Animal Genetics and Breeding,
17 Shanghai Ocean University, Shanghai, 201306, China
18
*
19 Corresponding author.
20 Tel./Fax: +86 21 61900465.
21 E-mail address: slli@shou.edu.cn (Songlin Li)
22 E-mail address: nschen@shou.edu.cn (Naisong Chen)
23

1
24 Abstract
25 The present study was conducted to explore the influence of dietary carbohydrate
26 on antioxidant capacity and non-specific immunity of hybrid grouper, which would
27 contribute to determine the tolerable dietary carbohydrate content. Seven diets with
28 grade levels of carbohydrate (5.27, 8.95, 11.49, 14.37, 17.78, 20.82 and 23.65%) were
29 fed to triplicate groups of fish for 10 weeks. Results showed that the inclusion of
30 carbohydrate above 11.49% produced significant increased content of hydrogen
31 peroxide (H2O2) in liver and malondialdehyde (MDA) in both serum and liver. The
32 specific activity of catalase (CAT), superoxide dismutase (SOD), glutathione
33 peroxidase (Gpx) and total antioxidative capacity (T-AOC) were significantly
34 elevated with the increase of dietary carbohydrate from 8.95 to 23.65%, which may be
35 associated with the reduced hepatic soluble protein content. However, opposite
36 variation was observed in the expression of antioxidant related genes (SOD1 and
37 Gpx), which was partly caused by the activation of NF-E2-related factor 2 (Nrf2) and
38 inhibition of Kelch-like-ECH-associated protein 1 (Keap1) at the transcriptional level.
39 The immunoglobulin M (lgM) content and activity of lysozyme and CCP in serum
40 significantly depressed when dietary carbohydrate was above 11.49%. The expression
41 of pro-inflammatory cytokines (TNF-α, IL-1β and IL-8) was significantly increased
42 with the increase of dietary carbohydrate from 5.27 to 8.95% and thereafter
43 significantly reduced, which was consistent with the changed expression of toll-like
44 receptor 2 (TLR2) and nuclear factor κΒ (NF‐κΒ). In above, high dietary
45 carbohydrate significantly impaired the antioxidant capacity and reduced the
46 non-specific immunity of hybrid grouper, and the tolerable dietary carbohydrate
47 content not exceed 11.49%.
48
49 Keywords: Tolerable carbohydrate content; antioxidant capacity; innate immune
50 response; Enzyme activity; Gene expression; Carnivorous fish
51

2
52 1. Introduction
53 Carbohydrate has been widely used in aquafeed due to its function in protein
54 sparing effect [1-3] and improving feed physical quality [4]. However, fish, especially
55 carnivorous fish, exhibit limited utilization of dietary carbohydrate due to the low
56 glucose metabolic rate [5, 6]. The long-term intake of excessive dietary carbohydrate
57 commonly produces negative effect on growth performance [7-10], and further results
58 in metabolic stress and poor physiological functions of carnivorous fish [5, 11-13].
59 Numerous studies have been conducted to evaluate the maximum levels, rather than
60 the optimal level, of carbohydrate that fish can tolerate without physiological
61 disorders and growth impairment [14], and studies concerning the health implications
62 in response to dietary carbohydrate of fish would benefit for the rational use of
63 carbohydrate in aquafeeds.
64 Persistent hyperglycemia is commonly observed in fish following a glucose load
65 [15]. The hyperglycemia tends to produce an increase of oxidative stress in mammals
66 [16], while the influence of dietary carbohydrate on the antioxidant defenses and
67 oxidative damage of fish remains controversial. The antioxidative system is impaired
68 by high dietary carbohydrate in Atlantic salmon [17], black carp [7], Japanese
69 flounder[13] and largemouth bass [9]. However, high dietary carbohydrate cannot
70 lead to negative effect on antioxidant status in Indian major carp [18] and gilthead sea
71 bream [19], even improve the antioxidant status in common dentex [20]. Organisms,
72 including fish, have evolved both non-enzymatic and enzymatic system, such as
73 catalase (CAT), superoxide dismutase (SOD) and glutathione peroxidase (Gpx) [21,
74 22]. In mammals, the above antioxidant related genes are under the control of
75 NF-E2-related factor 2 (Nrf2) through the Nrf2-Keap1 (Kelch-like-ECH-associated
76 protein 1) system [23]. However, little information is available regarding the response
77 of Nrf2-Keap1 signaling molecules to high carbohydrate in fish, which may benefit
78 for illustrating the variation of antioxidant status of fish in response to dietary
79 carbohydrate.
80 Additionally, excessive hepatic glycogen deposition mainly caused by the intake
81 of high dietary carbohydrate in carnivorous fish would produce direct hepatocyte
82 injury and further influence normal liver function [11, 13, 24] and this may be
83 associated with the depressed non-specific immunity and the expression of immunity
84 genes [7, 25, 26]. However, no significantly negative effect on the non-specific

3
 85 immunity has been observed in yellow catfish fed high dietary carbohydrate [27], and
86 meanwhile, the sustained increase of dietary carbohydrate enhances the immunity of
87 fish through up-regulation the expression of related cytokines [18]. In general, the
88 glucose utilization capacity of carnivorous fish is much less carbohydrate than
89 omnivorous and herbivorous fish [15, 28], and this may account for the above
90 different immunity response.
91 The hybrid grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂) has been
92 largely cultured in China due to its fast growth performance and huge potential
93 market value. The glucose intolerance of this grouper has been determined through
94 both glucose tolerance test and feeding trial in our previous studies [10, 29, 30].
95 Meanwhile, the optimal dietary carbohydrate level of this grouper has been
96 determined based on growth performance [30]. The data from the above study pointed
97 to another need of antioxidant capacity and non-specific immunity study to
98 investigate the influence of dietary carbohydrate on health implications of this grouper.
99 Therefore, the present study was designed to investigate the alterations in antioxidant
100 capacity and non-specific immune responses in response to dietary carbohydrate,
101 which would determine the tolerable dietary carbohydrate of this fish species.
102

103 2. Material and methods

104 2.1. Diets and animal experiment
105 Seven isonitrogenous (48%) and isolipidic (12%) diets were formulated
106 containing graded levels of dietary carbohydrate (2.67, 6.19, 9.06, 12.56, 15.66, 18.97
107 and 21.39%) according to the description of Li et al. [30] (Table 1). Animal
108 experiment was carried out in an indoor temperature-controlled re-circulating
109 seawater system, located in Guangdong Yinhai Feed Company, Ltd., Zhanjiang, China,
110 following the standard operating procedures in the Guide for the Use of Experimental
111 Animals of Shanghai Ocean University. Briefly, grouper with similar size (9.16 ±
112 0.18g) were distributed into 21 tanks (1200 L) with 30 individuals per tank after two
113 weeks’ acclimation. Each diet was randomly fed to triplicate groups of fish twice
114 daily (8:00 and 16:00) for 10 weeks. At the termination of the feeding trial, ten fish
115 per tank was randomly collected and then anesthetized with eugenol (1:10000)
116 (Shanghai Reagent, China) following being starved for 24h. Blood samples were
117 obtained from the caudal vasculature and then centrifuged at 4000 × g for 10 min

4
118 (4°C) to obtain the serum samples to evaluate the response of non-specific immunity
119 to dietary carbohydrate content. Liver of six fish per tank was isolated for gene
120 expression analysis.
121
122 2.2. Lipid peroxidation and activity of antioxidant enzyme
123 Liver samples were prepared and homogenized in ice-cold phosphate buffer (1:10
124 dilution), and then centrifuged at 3000 rpm (4 °C, 10 min) to separate the supernatant.
125 The isolated supernatant was maintained at -20 °C until being used for biochemical
126 analysis.
127 Lipid peroxidation was assayed with the measurement of malondialdehyde (MDA)
128 content through the thiobarbituric acid-reactive substances (TBARS) assay following
129 the method of Livingstone et al. [31]. The hydrogen peroxide (H2O2) content was
130 determined based on the horseradish peroxidase (HRP)-mediated oxidation of phenol
131 red by H2O2 according to the method described by Pick & Keisari [32]. The content of
132 MDA and H2O2 were all expressed as per mg of soluble protein which was
133 determined with the coomassie brilliant blue staining method [33].
134 Superoxide dismutase (SOD) activity was measured following the
135 ferricytochrome C method using xanthine/xanthine oxidase as the source of
136 superoxide radicals [34]. Each activity unit was defined as the amount of enzyme
137 necessary to produce a 50% inhibition of the ferricytochrome C reduction rate.
138 Catalase (CAT) activity was determined by measuring the decreased concentration of
139 H2O2 per minute according to Aebi [35]. Each activity unit was defined as the amount
140 of enzyme required to resolve 1 µmol H2O2 per second. The activity of glutathione
141 peroxidase (Gpx) was determined with H2O2 as the substrate following the method
142 described by Drotar et al. [36]. Each unit was defined as the amount of enzyme made
143 the concentration of glutathione drop 1µmol/L per minute. Total antioxidative
144 capacity (T-AOC) was assayed by measuring the product of Fe2+ reduced from Fe3+
145 with the method of Benzie & Strain [37]. Each unit was defined as the amount of
146 enzyme caused the increase of absorbance by 0.01 per minute. The activity of the
147 above antioxidant enzymes was expressed as per mg of soluble protein.
148
149 2.3. Analysis of non-specific immunity indexes
150 The activity of serum lysozyme was measured with the turbidimetric assay [38]
151 according to the description of Zuo et al. [39]. Briefly, the absorbance was measured
5
152 spectrophotometrically at 0.5 and 4.5 min after serum sample being added to a
153 suspension of Micrococcus lysodeikticus (Sigma). Each activity unit was defined as
154 the amount of serum causing a decrease in absorbance of 0.001 per minute. The serum
155 classical complement pathway (CCP) activity was assayed according to Inglis et al.
156 [40] with some modification [41]. Briefly, the volume of plasma caused 50%
157 complement haemolysis (CH50) of sheep red blood cells was determined and result
158 was expressed as the number of CH50 unit per mL serum. Serum immunoglobulin M
159 (lgM) content was measured by radioimmunoassay using tilapia lgM as the standard
160 and rabbit anti-tilapia lgM as antiserum. The dose-effect curve was obtained based on
161 the lgM content and optical density (OD). After that, serum samples were added to the
162 precoated wells with corresponding monoclonal antibody of tilapia lgM. Then, the
163 anti-antibody labeled with horseradish peroxidase (HRP) was added to react at 37 °C
164 for 1 h to form immune complexes. The chromogen solutions were added to react at
165 37 °C for 15 min after the wells being washed carefully to calculate the content of
166 lgM.
167
168 2.4. RNA extraction and real-time quantitative PCR
169 Total RNA was extracted from liver samples with Trizol Reagent (Takara, Japan)
170 followed by quality measurement with denaturing agarose gel and concentration
171 determination with NanoDrop® ND-1000 (Wilmington, DE). After that, single
172 stranded cDNA was synthesized using Prime ScriptTM RT reagent Kit (Takara, Japan).
173 Specific primers for RT-qPCR were designed based on the obtained nucleotide
174 sequences (Table 2). The β-actin was used as reference gene after stability being
175 verified. The amplification was conducted in a quantitative thermal cycler
176 (Mastercycler EP Realplex, Eppendorf, Germany) with the program described
177 previously [30]. The 2-∆∆Ct method described by Livak & Schmittgen [42] was used to
178 calculate the relative expression of target genes.
179
180 2.5. Statistical methods
181 The results were expressed as the mean ± standard error of the mean (SEM). All
182 data were subjected to one-way analysis of variance (ANOVA), and Tukey’s multiple
183 range test was chosen as multiple comparison test with a significance level of 5%.
184
185 3. Results
6
186 Results of the feeding trial were not the aim of this study and are presented
187 elsewhere [30]. Briefly, the growth performance was significantly reduced with the
188 increase of dietary carbohydrate, and the optimal dietary carbohydrate was estimated
189 to be 7.22% based on specific growth ratio. Additionally, high dietary carbohydrate
190 led to a significant increase of hepatic glycogen. The present study was conducted to
191 investigate the influence of dietary carbohydrate on health implications of the grouper.
192
193 3.1. Lipid peroxidation status and antioxidant enzyme activity
194 The MDA content in serum of grouper fed the diet with 14.37% carbohydrate was
195 significantly higher than that of 5.27% grouper (P < 0.05), and remained significant
196 increase with the further increase of dietary carbohydrate from 14.37% to 23.65% (P
197 < 0.05) (Table 3). Hepatic MDA content followed a similar pattern with that of serum
198 (Table 3). Meanwhile, a significantly increased content of H2O2 was noted as dietary
199 carbohydrate rose from 11.49 to 23.65% (P < 0.05) (Table 3). The activity of hepatic
200 SOD increased significantly with the increase of dietary carbohydrate from 8.95 to
201 11.49% (P < 0.05), and then kept relatively constant until 17.78% dietary
202 carbohydrate (P > 0.05), followed by a remarkably increase from 17.78 to 23.65% (P
203 < 0.05) (Table 3). Also, the increase of dietary carbohydrate resulted in a sharp
204 increased activity of Gpx, CAT and T-AOC (P < 0.05), and grouper fed the diet with
205 23.65% dietary carbohydrate obtained the highest data (Table 3). The activity of the
206 above antioxidant enzymes was expressed as units per mg soluble protein, while
207 hepatic soluble protein content decreased significantly with the increase of dietary
208 carbohydrate (P < 0.05) (Table 3).
209
210 3.2. Serum innate immunity
211 The activity of lysozyme was not significantly changed until dietary carbohydrate
212 up to 11.49% (p > 0.05), and then significantly decreased with the further increase of
213 dietary carbohydrate (P < 0.05) (Table 4). Meanwhile, similar variation trend was also
214 found in the activity of CCP (P < 0.05) (Table 4). The serum protein content
215 decreased correspondingly in agreement with lysozyme and CCP, while grouper fed
216 the diet with 11.49% dietary carbohydrate obtained the highest lgM content,
217 significantly higher than that of groups with much higher dietary carbohydrate (P <
218 0.05) (Table 4).
219
7
220 3.3. Antioxidant related genes expressions
221 As dietary carbohydrate increased, the expression of Nrf2 decreased significant,
222 and grouper fed the diet with 21.36% dietary carbohydrate obtained the lowest
223 expression (P < 0.05) (Fig. 1). However, fish fed the diet with 23.65% obtained
224 significantly higher expression of Keap1 compared to other treatments (P < 0.05) (Fig.
225 1). The expression of SOD1 and Gpx were also decreased significantly with the
226 increase of dietary carbohydrate (P < 0.05), while dietary carbohydrate content cannot
227 lead to a significant influence on the expression of CAT (P > 0.05) (Fig. 1).
228
229 3.4. Non-specific immunity related genes expressions
230 The expression of nuclear factor κΒ (NF‐κΒ) p65 was significantly up-regulated
231 with the increase of dietary carbohydrate from 5.27 to 11.49%, and then decreased
232 significantly (P < 0.05) (Fig. 2). The variation in the expression of toll-like receptor
233 (TLR) 2 followed a similar pattern with that of NF‐κΒ p65 (P < 0.05), while no
234 significant difference was observed in the expression of TLR22 (P > 0.05) (Fig. 2).
235 The expression of tumor necrosis factor α (TNF-α) and interleukin 1β (IL-1β) was
236 significantly increased with the dietary carbohydrate inclusion from 5.27 to 8.95%,
237 and thereafter decreased significantly (P < 0.05) (Fig. 2). The expression of IL-8 in
238 fish fed the diet with carbohydrate above 8.95% was significantly lower than the first
239 two groups (P < 0.05) (Fig. 2).
240
241 4. Discussion
242 Previous studies in our lab have demonstrated the limited glucose utilization of
243 hybrid grouper [10, 29, 30], and meanwhile, the optimal dietary carbohydrate content
244 was determined based on growth performance [30]. Considering the popular price and
245 potential role in improving feed physical quality of carbohydrate of starch origin [4],
246 dietary carbohydrate that fish species could be tolerant without physiological
247 disorders should be determined. Therefore, the antioxidant defenses and non-specific
248 immunity of grouper fed diets with grade levels of dietary carbohydrate were
249 examined in the present study.
250 The antioxidant status of fish could be affected by dietary composition due to the
251 existence of reactive oxygen species (ROS) over the metabolism of nutrients[43]. In
252 the present study, the content of H2O2 in liver and MDA in both serum and liver were
253 significantly elevated with dietary carbohydrate over 11.49%, and grouper fed the diet
8
254 with 23.65% dietary carbohydrate obtained the highest value. The above result
255 indicated excessive dietary carbohydrate induced the oxidative stress of hybrid
256 grouper, in accordance with the result in Atlantic salmon [17], black carp [7] and
257 Japanese flounder [13]. However, the antioxidant status was not significantly
258 influenced by dietary carbohydrate in European sea bass [44], but remarkably
259 improved in common dentex [20]. The different response may be partly related to fish
260 species and their glucose utilization capacity. In general, the glucose utilization of
261 carnivorous fish species is far less than that of omnivorous and herbivorous fish [15,
262 28]. The excessive dietary carbohydrate commonly results in direct hepatocyte injury
263 and influence normal liver function in carnivorous fish [11, 13, 24, 45], and this may
264 account for the high carbohydrate induced oxidative stress in the present study.
265 The enzymatic system, including CAT, SOD and Gpx, is involved in the
266 antioxidant defense mechanism in organisms [21], and the ROS content may impact
267 the activity of the above enzymes [46]. Previous studies have demonstrated the
268 depressed activity of antioxidant enzyme with high dietary carbohydrate in black carp
269 [7] and Japanese flounder [13]. However, the activity of CAT, SOD, GPx and T-AOC
270 were all increased significantly with the increase of dietary carbohydrate in
271 accordance with the study in common dentex [20], which seems to improve the
272 antioxidant status of hybrid grouper. Notably, the hepatic protein concentration was
273 significantly decreased with the increase of dietary carbohydrate, while the specific
274 activity was used to express the antioxidant enzyme activity. Therefore, the enzyme
275 activity was closely associated with the variation of hepatic soluble protein content,
276 which cannot accurately clarify the antioxidant capacity of fish in the present study.
277 The activities of antioxidant enzymes are related to their transcriptional levels [47, 48].
278 In the present study, the expression of SOD1 and GPx decreased significantly as
279 dietary carbohydrate increased, which followed an opposite pattern with the variation
280 of enzyme activities. The reduced expression of SOD1 and Gpx in the present study
281 indicated the impaired antioxidant capacity to some extent. Nrf2 is a pleiotropic
282 transcription factor which plays a vital role in regulating the transcription of
283 antioxidant genes in terrestrial animal [23, 49], and the increased expression of Nrf2
284 significantly promotes the transcription of antioxidant related genes such as SOD1,
285 SOD2 and CAT [50]. Positive correlation was observed between the expression of
286 Nrf2 and antioxidant related genes in Zebrafish [51], Jian carp [52, 53], grass carp [54]
287 and blunt snout bream [55, 56]. In the present study, high inclusion of dietary
9
288 carbohydrate significantly down-regulated the expression of Nrf2, which was
289 consistent with the variation of the SOD1 and GPx expression. Additionally, Keap1
290 acts as a repressor to induce the degradation and inhibit the translocation of Nrf2 in
291 mammals [57], and the knockdown of Keap1 promotes the activation of Nrf2 in mice
292 [50]. The opposite changes in the expression of Keap1 and Nrf2 were also observed in
293 some fish species [54, 56]. Similarly, in the present study, the expression of Keap1
294 was significantly increased with high dietary carbohydrate inclusion. Therefore, high
295 dietary carbohydrate maybe impaired the antioxidant capacity of hybrid grouper
296 through the activation of Nrf2 and inhibition of Keap1 at least at the transcriptional
297 level.
298 The innate immune system acts as a fundamental defense mechanism of fish [58],
299 and the non-specific immune response could be influenced by dietary carbohydrate
300 content in fish [7, 12, 18, 26]. Lysozyme, an important component of innate immune
301 system, is essential in mediating protection against pathogen infection [59]. In the
302 present study, the activity of serum lysozyme was significantly decreased with the
303 inclusion of dietary carbohydrate above 11.49%. The downregulation of serum
304 lysozyme activity caused by high dietary carbohydrate has also been observed in
305 top-mouth culter [60], Wuchang bream [25], golden pompano [12] and black carp[7].
306 Notably, the dietary carbohydrate content, caused the decline of serum lysozyme
307 activity in the present study, was significantly lower than the above-mentioned fish
308 species, indicating the limited glucose utilization of hybrid grouper. The serum
309 protein mainly consists of albumin and immunoglobulin (Ig), and IgM is the most
310 prevalent Ig in fish plasma[61]. In the present study, the content of serum protein and
311 IgM were both significantly reduced with dietary carbohydrate inclusion above
312 11.49%, which followed a similar pattern with that of lysozyme activity. Meanwhile,
313 similar relationship between serum lysozyme activity and protein content has been
314 observed in dab [62]. Complement is an important component of the innate immune
315 system, which could effectively alter the host of the presence of potential pathogens
316 as well as their clearance [63, 64]. The inhibition of complement activity and related
317 gene expression has confirmed in some fish species [7, 12, 25, 60], and the activity of
318 CCP was also significantly decreased with high dietary carbohydrate in the present
319 study. The variation of the above parameters confirmed the reduced immunity with
320 the inclusion of dietary carbohydrate above 11.49%.
321 Inflammatory response is an important component of the innate immune system
10
322 response to varieties of challenges, which was primarily mediated by cytokines [65].
323 TNF-α has been considered as an important pro-inflammatory cytokine, and also
324 develops a vital role in the immune system during inflammation, cell proliferation,
325 differentiation and apoptosis [66]. In the present study, the expression of TNF-α was
326 significantly increased with the increase of dietary carbohydrate from 5.27 to 8.95%,
327 and thereafter significantly decreased. Similar result has been observed in black carp
328 [7], in which high dietary carbohydrate inclusion significantly reduced the expression
329 of TNF-α and interferon (IFN-α). Previous study has confirmed that optimal TNF-α
330 content benefits for the immunity, and meanwhile, the activation of TNF-α also leads
331 to the expression of some proinflammatory factors, such as IL-1β and IL8 [67], which
332 may partly account for the similar variation of IL-1β and IL8 expression in the present
333 study. In mammals, the reduced expression of TNF-α or IL-8 would alleviate the
334 tissue damage caused by excessive inflammatory response [68, 69]. High dietary
335 carbohydrate commonly produces direct hepatocyte injury due to the hepatic glycogen
336 accumulation in carnivorous fish [11, 13, 24]. Therefore, the reduced expression of
337 the above cytokines in the present study did not reflect the alleviation of liver injury,
338 but the impaired liver function. In mammals, the expression of pro-inflammatory
339 cytokines could be regulated by the NF‐κΒ [70] which was mediated by Toll
340 signaling pathways [71]. NF-κΒ P65 is a member of the family of NF-κΒ
341 transcription factors, which possesses the function in activating the transcription of
342 target genes [72]. The transcription of some pro-inflammatory cytokines, such as
343 TNF-α, IL-1β or IL-8, followed a similar pattern with that of NF-κB p65 in grass carp
344 [73]. Meanwhile, the inflammatory response, such as the expression of TNF-α and
345 IL-1β, has been demonstrated to be induced by the TLR-NF-κB pathway in large
346 yellow croaker [74]. In the present study, the expression of TLR2 and NF-κB p65 was
347 consistent with that of the detected pro-inflammatory cytokines, indicating that the
348 reduced inflammatory response caused by high dietary carbohydrate partly account
349 for TLR- NF-κB pathway.
350 In above, high dietary carbohydrate induced oxidative stress and impaired the
351 antioxidant capacity of hybrid grouper. Meanwhile, the non-specific immunity was
352 significantly impaired at both enzymatic and transcription level with the inclusion of
353 high dietary carbohydrate. The content of dietary carbohydrate could not exceed 11.49%
354 based on the antioxidant capacity and innate immunity response to dietary
355 carbohydrate.
11
356
357 Acknowledgement
358 The work was supported by Open fund of Key Laboratory of Mariculture of
359 Ministry of Education, Ocean University of China (KLM2017003), Shanghai
360 Agriculture Applied Technology Development Program, China (G20130508)
361

12
362 Reference
363 [1] D. Stone, G. Allan, Anderson, AJ, Carbohydrate utilization by juvenile silver perch,
364 Bidyanus bidyanus (Mitchell). III. The protein‐sparing effect of wheat starch‐
365 based carbohydrates, Aquacult. Res. 34(2) (2003) 123-134.
366 [2] K. Mohanta, S. Mohanty, Jena, JK, Protein‐sparing effect of carbohydrate in
367 silver barb, Puntius gonionotus fry, Aquacult. Nutr. 13(4) (2007) 311-317.
368 [3] P. Enes, S. Panserat, S. Kaushik, A. Oliva-Teles, Dietary carbohydrate utilization
369 by European sea bass (Dicentrarchus labrax L.) and gilthead sea bream (Sparus
370 aurata L.) juveniles, Rev. Fish. Sci. 19(3) (2011) 201-215.
371 [4] M. Sørensen, G. Nguyen, T. Storebakken, M. Øverland, Starch source, screw
372 configuration and injection of steam into the barrel affect the physical quality of
373 extruded fish feed, Aquacult. Res. 41(3) (2010) 419-432.
374 [5] G.I. Hemre, T.P. Mommsen, Å. Krogdahl, Carbohydrates in fish nutrition: effects
375 on growth, glucose metabolism and hepatic enzymes, Aquacult. Nutr. 8(3) (2002)
376 175-194.
377 [6] S. Polakof, S. Panserat, How Tom Moon's research highlighted the question of
378 glucose tolerance in carnivorous fish, Comp. Biochem. Phys. B 199 (2016) 43-49.
379 [7] C. Wu, J. Ye, L. Chen, Z. Lu, The effects of dietary carbohydrate on the growth,
380 antioxidant capacities, innate immune responses and pathogen resistance of
381 juvenile Black carp Mylopharyngodon piceus, Fish Shellfish Immunol. 49 (2016)
382 132-142.
383 [8] J. Wang, X. Li, T. Han, Y. Yang, Y. Jiang, M. Yang, Y. Xu, S. Harpaz, Effects of
384 different dietary carbohydrate levels on growth, feed utilization and body
385 composition of juvenile grouper Epinephelus akaara, Aquaculture 459 (2016)
386 143-147.
387 [9] H.J. Ma, M.M. Mou, D.C. Pu, S.M. Lin, Y.J. Chen, L. Luo, Effect of dietary starch
388 level on growth, metabolism enzyme and oxidative status of juvenile largemouth
389 bass, Micropterus salmoides, Aquaculture 498 (2019) 482-487.
390 [10] S. Li, Z. Li, N. Chen, P. Jin, J. Zhang, Dietary lipid and carbohydrate interactions:
391 implications on growth performance, feed utilization and non-specific immunity
392 in hybrid grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂ ), Aquaculture
393 498 (2019) 568-577.
394 [11] A. Amoah, S.D. Coyle, C.D. Webster, R.M. Durborow, L.A. Bright, Tidwell,
395 Effects of graded levels of carbohydrate on growth and survival of largemouth
396 bass, Micropterus salmoides, J. World. Aquacult. S. 39(3) (2008) 397-405.
397 [12] C. Zhou, X. Ge, H. Lin, J. Niu, Effect of dietary carbohydrate on non-specific
398 immune response, hepatic antioxidative abilities and disease resistance of
399 juvenile golden pompano (Trachinotus ovatus), Fish Shellfish Immunol. 41(2)
400 (2014) 183-190.
401 [13] K. Deng, M. Pan, J. Liu, M. Yang, Z. Gu, Y. Zhang, G. Liu, D. Liu, W. Zhang, K.
402 Mai, Chronic stress of high dietary carbohydrate level causes inflammation and
403 influences glucose transport through SOCS3 in Japanese flounder Paralichthys
404 olivaceus, Sci. Rep-UK. 8(1) (2018) 1-13.
405 [14] N.R. Council, Committee on the Nutrient Requirements of Fish and Shrimp,
13
406 Nutrient requirements of fish and shrimp (2011)186-220.
407 [15] D.A. Stone, Dietary carbohydrate utilization by fish, Rev. Fish. Sci. 11(4) (2003)
408 337-369.
409 [16] J.L. Rains, S.K. Jain, Oxidative stress, insulin signaling, and diabetes, Free
410 Radical Bio. Med. 50(5) (2011) 567-575.
411 [17] B. Lygren, G.I. Hemre, Influence of dietary carbohydrate on antioxidant enzyme
412 activities in liver of Atlantic salmon (Salmo salar L.), Aquaculture Int. 9(5)
413 (2001) 421-427.
414 [18] G. Anand, I.A. Bhat, T. Varghese, S.A. Dar, N. Sahu, M. Aklakur, S. Kumar, S.
415 Sahoo, Alterations in non-specific immune responses, antioxidant capacities and
416 expression levels of immunity genes in Labeo rohita fed with graded level of
417 carbohydrates, Aquaculture 483 (2018) 76-83.
418 [19] C. Castro, A.F. Diógenes, F. Coutinho, S. Panserat, G. Corraze, A. Pérez-Jiménez,
419 H. Peres, A. Oliva-Teles, Liver and intestine oxidative status of gilthead sea
420 bream fed vegetable oil and carbohydrate rich diets, Aquaculture 464 (2016)
421 665-672.
422 [20] A. Pérez-Jiménez, E. Abellán, M. Arizcun, G. Cardenete, A.E. Morales, M.C.
423 Hidalgo, Dietary carbohydrates improve oxidative status of common dentex
424 (Dentex dentex) juveniles, a carnivorous fish species, Comp. Biochem. Phys. A
425 203 (2017) 17-23.
426 [21] V.I. Lushchak, Environmentally induced oxidative stress in aquatic animals,
427 Aquat. Toxicol. 101(1) (2011) 13-30.
428 [22] F. Regoli, M.E. Giuliani, Oxidative pathways of chemical toxicity and oxidative
429 stress biomarkers in marine organisms, Mar. Environ. Res. 93 (2014) 106-117.
430 [23] M. Kobayashi, M. Yamamoto, Molecular mechanisms activating the Nrf2-Keap1
431 pathway of antioxidant gene regulation, Antioxid. Redox. Sign. 7(3-4) (2005)
432 385-394.
433 [24] A.E. Goodwin, R.T. Lochmann, D.M. Tieman, A.J. Mitchell, Massive hepatic
434 necrosis and nodular regeneration in largemouth bass fed diets high in available
435 carbohydrate, J. World. Aquacult. S. 33(4) (2002) 466-477.
436 [25] C. Zhou, B. Liu, X. Ge, J. Xie, P. Xu, Effect of dietary carbohydrate on the
437 growth performance, immune response, hepatic antioxidant abilities and heat
438 shock protein 70 expression of Wuchang bream, Megalobrama amblycephala, J.
439 Appl. Ichthyol. 29(6) (2013) 1348-1356.
440 [26] S.M. Lin, C.M. Shi, M.M. Mu, Y.J. Chen, L. Luo, Effect of high dietary starch
441 levels on growth, hepatic glucose metabolism, oxidative status and immune
442 response of juvenile largemouth bass, Micropterus salmoides, Fish Shellfish
443 Immunol. 78 (2018) 121-126.
444 [27] L.N. Wang, W.B. Liu, K.L. Lu, W.N. Xu, D.S. Cai, C.N. Zhang, Y. Qian, Effects
445 of dietary carbohydrate/lipid ratios on non-specific immune responses, oxidative
446 status and liver histology of juvenile yellow catfish Pelteobagrus fulvidraco,
447 Aquaculture 426 (2014) 41-48.
448 [28] N. Legate, A. Bonen, T. Moon, Glucose tolerance and peripheral glucose
449 utilization in rainbow trout (Oncorhynchus mykiss), American eel (Anguilla

14
450 rostrata), and black bullhead catfish (Ameiurus melas), Gen. Com. Endocr. 122(1)
451 (2001) 48-59.
452 [29] S. Li, C. Sang, J. Zhang, N. Chen, Z. Li, P. Jin, X. Huang, Effects of acute
453 hyperglycemia stress on plasma glucose, glycogen content, and expressions of
454 glycogen synthase and phosphorylase in hybrid grouper (Epinephelus
455 fuscoguttatus ♀ × E. lanceolatus ♂ ), Fish physiol. Biochem. 44(4) (2018)
456 1185-1196.
457 [30] S. Li, Z. Li, J. Zhang, C. Sang, N. Chen, The impacts of dietary carbohydrate
458 levels on growth performance, feed utilization, glycogen accumulation and
459 hepatic glucose metabolism in hybrid grouper (Epinephelus fuscoguttatus ♀ × E.
460 lanceolatus ♂ ), Aquaculture 512 (2019) 734351.
461 [31] D. Livingstone, P.G. Martinez, X. Michel, J. Narbonne, S. O'hara, D. Ribera, G.
462 Winston, Oxyradical production as a pollution-mediated mechanism of toxicity
463 in the common mussel, Mytilus edulis L., and other molluscs, Funct. Ecol. (1990)
464 415-424.
465 [32] E. Pick, Y. Keisari, Superoxide anion and hydrogen peroxide production by
466 chemically elicited peritoneal macrophages—induction by multiple
467 nonphagocytic stimuli, Cell. Immunol. 59(2) (1981) 301-318.
468 [33] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram
469 quantities of protein utilizing the principle of protein-dye binding, Anal.
470 Biochem. 72(1-2) (1976) 248-254.
471 [34] J.M. McCord, I. Fridovich, Superoxide dismutase an enzymic function for
472 erythrocuprein (hemocuprein), J. Biol. Chem. 244(22) (1969) 6049-6055.
473 [35] H. Aebi, Catalase in vitro, Methods Enzymol., Elsevier1984, pp. 121-126.
474 [36] A. Drotar, P. Phelps, R. Fall, Evidence for glutathione peroxidase activities in
475 cultured plant cells, Plant Sci. 42(1) (1985) 35-40.
476 [37] I.F. Benzie, J. Strain, Ferric reducing/antioxidant power assay: direct measure of
477 total antioxidant activity of biological fluids and modified version for
478 simultaneous measurement of total antioxidant power and ascorbic acid
479 concentration, Methods Enzymol., Elsevier1999, pp. 15-27.
480 [38] A.E. Ellis, Lysozyme assays, Techniques in fish immunology 1 (1990) 101-103.
481 [39] R. Zuo, Q. Ai, K. Mai, W. Xu, Effects of conjugated linoleic acid on growth,
482 non-specific immunity, antioxidant capacity, lipid deposition and related gene
483 expression in juvenile large yellow croaker (Larmichthys crocea) fed soyabean
484 oil-based diets, Brit. J. Nutr. 110(7) (2013) 1220-1232.
485 [40] J.E. Inglis, K.A. Radziwon, G.D. Maniero, The serum complement system: a
486 simplified laboratory exercise to measure the activity of an important component
487 of the immune system, Adv. Physiol. Educ. 32(4) (2008) 317-321.
488 [41] H. Zhou, N. Chen, X. Qiu, M. Zhao, L. Jin, Arginine requirement and effect of
489 arginine intake on immunity in largemouth bass, Micropterus salmoides,
490 Aquacult. Nutr. 18(1) (2012) 107-116.
491 [42] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using
492 real-time quantitative PCR and the 2− ∆∆CT method, Methods 25(4) (2001)
493 402-408.

15
494 [43] C. Bogdan, M. Röllinghoff, A. Diefenbach, Reactive oxygen and reactive
495 nitrogen intermediates in innate and specific immunity, Curr. Opin. Immunol.
496 12(1) (2000) 64-76.
497 [44] C. Castro, A. Peréz-Jiménez, F. Coutinho, P. Díaz-Rosales, C.A. dos Reis Serra,
498 S. Panserat, G. Corraze, H. Peres, A. Oliva-Teles, Dietary carbohydrate and lipid
499 sources affect differently the oxidative status of European sea bass
500 (Dicentrarchus labrax) juveniles, Brit. J. Nutr. 114(10) (2015) 1584-1593.
501 [45] X. Xu, N. Chen, Z. Liu, S. Gou, J. Yin, Effects of dietary starch sources and
502 levels on liver histology in largemouth bass, Micropterus salmoides, Journal of
503 Shanghai Ocean University 25(1) (2016) 61-70.
504 [46] S. Woo, S. Yum, H.S. Park, T.K. Lee, J.C. Ryu, Effects of heavy metals on
505 antioxidants and stress-responsive gene expression in Javanese medaka (Oryzias
506 javanicus), Comp. Biochem. Phys. C 149(3) (2009) 289-299.
507 [47] J. Chen, B.K. Lipska, N. Halim, Q.D. Ma, M. Matsumoto, S. Melhem, B.S.
508 Kolachana, T.M. Hyde, M.M. Herman, J. Apud, Functional analysis of genetic
509 variation in catechol-O-methyltransferase (COMT): effects on mRNA, protein,
510 and enzyme activity in postmortem human brain, Am. J. Hum. Genet. 75(5)
511 (2004) 807-821.
512 [48] K. Lyu, X. Zhu, R. Chen, Y. Chen, Z. Yang, Molecular cloning of manganese
513 superoxide dismutase gene in the cladoceran Daphnia magna: effects of
514 microcystin, nitrite, and cadmium on gene expression profiles, Aquat. Toxicol.
515 148 (2014) 55-64.
516 [49] V.R. Muthusamy, S. Kannan, K. Sadhaasivam, S.S. Gounder, C.J. Davidson, C.
517 Boeheme, J.R. Hoidal, L. Wang, N.S. Rajasekaran, Acute exercise stress
518 activates Nrf2/ARE signaling and promotes antioxidant mechanisms in the
519 myocardium, Free Radical Bio. Med. 52(2) (2012) 366-376.
520 [50] S.A. Reisman, R.L. Yeager, M. Yamamoto, C.D. Klaassen, Increased Nrf2
521 activation in livers from Keap1-knockdown mice increases expression of
522 cytoprotective genes that detoxify electrophiles more than those that detoxify
523 reactive oxygen species, Toxicol. Sci. 108(1) (2009) 35-47.
524 [51] A.R. Timme-Laragy, L.A. Van Tiem, E.A. Linney, R.T. Di Giulio, Antioxidant
525 responses and NRF2 in synergistic developmental toxicity of PAHs in zebrafish,
526 Toxicol. Sci. 109(2) (2009) 217-227.
527 [52] J. Zhao, L. Feng, Y. Liu, W. Jiang, P. Wu, J. Jiang, Y. Zhang, X. Zhou, Effect of
528 dietary isoleucine on the immunity, antioxidant status, tight junctions and
529 microflora in the intestine of juvenile Jian carp (Cyprinus carpio var. Jian), Fish
530 Shellfish Immunol. 41(2) (2014) 663-673.
531 [53] P. Wu, W.D. Jiang, Y. Liu, G.F. Chen, J. Jiang, S.H. Li, L. Feng, X.Q. Zhou,
532 Effect of choline on antioxidant defenses and gene expressions of Nrf2 signaling
533 molecule in the spleen and head kidney of juvenile Jian carp (Cyprinus carpio
534 var. Jian), Fish Shellfish Immunol. 38(2) (2014) 374-382.
535 [54] H. Wen, L. Feng, W. Jiang, Y. Liu, J. Jiang, S. Li, L. Tang, Y. Zhang, S. Kuang, X.
536 Zhou, Dietary tryptophan modulates intestinal immune response, barrier function,
537 antioxidant status and gene expression of TOR and Nrf2 in young grass carp

16
538 (Ctenopharyngodon idella), Fish Shellfish Immunol. 40(1) (2014) 275-287.
539 [55] H. Liang, A. Mokrani, K. Ji, X. Ge, M. Ren, J. Xie, B. Liu, B. Xi, Q. Zhou,
540 Dietary leucine modulates growth performance, Nrf2 antioxidant signaling
541 pathway and immune response of juvenile blunt snout bream (Megalobrama
542 amblycephala), Fish Shellfish Immunol. 73 (2018) 57-65.
543 [56] H. Yu, H. Liang, M. Ren, K. Ji, Q. Yang, X. Ge, B. Xi, L. Pan, Effects of dietary
544 fenugreek seed extracts on growth performance, plasma biochemical parameters,
545 lipid metabolism, Nrf2 antioxidant capacity and immune response of juvenile
546 blunt snout bream (Megalobrama amblycephala), Fish Shellfish Immunol. 94
547 (2019) 211-219.
548 [57] D.D. Zhang, Mechanistic studies of the Nrf2-Keap1 signaling pathway, Drug
549 Metab. Rev. 38(4) (2006) 769-789.
550 [58] B. Magnadóttir, Innate immunity of fish (overview), Fish Shellfish Immunol.
551 20(2) (2006) 137-151.
552 [59] S. Saurabh, P. Sahoo, Lysozyme: an important defence molecule of fish innate
553 immune system, Aquacult. Res. 39(3) (2008) 223-239.
554 [60] B. Liu, J. Xie, X.P. Ge, L.H. Miao, G. Wang, Effect of high dietary carbohydrate
555 on growth, serum physiological response, and hepatic heat shock cognate protein
556 70 expression of the top-mouth culter Erythroculter ilishaeformis Bleeker,
557 Fisheries Sci. 78(3) (2012) 613-623.
558 [61] M.F. Flajnik, Comparative analyses of immunoglobulin genes: surprises and
559 portents, Nat. Rev. Immunol. 2(9) (2002) 688-698.
560 [62] T.H. Hutchinson, M.J. Manning, Seasonal trends in serum lysozyme activity and
561 total protein concentration in dab (Limanda limanda L.) sampled from Lyme Bay,
562 UK, Fish Shellfish Immunol. 6(7) (1996) 473-482.
563 [63] H. Boshra, J. Li, J. Sunyer, Recent advances on the complement system of teleost
564 fish, Fish Shellfish Immunol. 20(2) (2006) 239-262.
565 [64] M.C.H. Holland, J.D. Lambris, The complement system in teleosts, Fish
566 Shellfish Immunol. 12(5) (2002) 399-420.
567 [65] J. Han, R.J. Ulevitch, Limiting inflammatory responses during activation of
568 innate immunity, Nat. Immunol. 6(12) (2005) 1198-1205.
569 [66] V. Baud, M. Karin, Signal transduction by tumor necrosis factor and its relatives,
570 Trends cell Biol. 11(9) (2001) 372-377.
571 [67] J. Zou, S. Peddie, G. Scapigliati, Y. Zhang, N. Bols, A. Ellis, C.J. Secombes,
572 Functional characterisation of the recombinant tumor necrosis factors in rainbow
573 trout, Oncorhynchus mykiss, Dev. Comp. Immunol. 27(9) (2003) 813-822.
574 [68] B.Y. Chen, D.P.C. Lin, C.Y. Wu, M.C. Teng, C.Y. Sun, Y.T. Tsai, K.C. Su, S.R.
575 Wang, H.H. Chang, Dietary zerumbone prevents mouse cornea from
576 UVB-induced photokeratitis through inhibition of NF-κB, iNOS, and TNF-α
577 expression and reduction of MDA accumulation, Mol. Vis. 17 (2011) 854.
578 [69] Y. Wada, T. Nakajima-Yamada, K. Yamada, J. Tsuchida, T. Yasumoto, T.
579 Shimozato, K. Aoki, T. Kimura, S. Ushiyama, R-130823, a novel inhibitor of p38
580 MAPK, ameliorates hyperalgesia and swelling in arthritis models, Euro. J.
581 Pharmacol. 506(3) (2005) 285-295.

17
582 [70] P.A. Baeuerle, V.R. Baichwal, NF-kB as a frequent target for immunosuppressive
583 and anti-inflammatory molecules, Adv. Immunol. 65 (1997) 111-138.
584 [71] K.V. Anderson, Toll signaling pathways in the innate immune response, Curr.
585 Opin. Immunol.12(1) (2000) 13-19.
586 [72] U. Siebenlist, G. Franzoso, K. Brown, Structure, regulation and function of
587 NF-kappaB. Annu. Rev. Cell Bio. 10(1994) 405-455.
588 [73] B. Wang, L. Feng, W.D. Jiang, P. Wu, S.Y. Kuang, J. Jiang, L. Tang, W.N. Tang,
589 Y.A. Zhang, Y. Liu, Copper-induced tight junction mRNA expression changes,
590 apoptosis and antioxidant responses via NF-κB, TOR and Nrf2 signaling
591 molecules in the gills of fish: preventive role of arginine, Aquat. Toxicol. 158
592 (2015) 125-137.
593 [74] P. Tan, X. Dong, K. Mai, W. Xu, Q. Ai, Vegetable oil induced inflammatory
594 response by altering TLR-NF-κB signalling, macrophages infiltration and
595 polarization in adipose tissue of large yellow croaker (Larimichthys crocea), Fish
596 Shellfish Immunol. 59 (2016) 398-405.
597

18
598 Figure legends
599 Fig.1 The expression of antioxidant related genes, NF-E2-related factor 2 (Nrf2),
600 Kelch-like-ECH-associated protein 1 (Keap1) (A), superoxide dismutase 1 (SOD1),
601 glutathione peroxidase (Gpx) and catalase (CAT) (B), in response to graded levels of
602 dietary carbohydrate in hybrid grouper for 10 weeks. Values (means ± standard error
603 of the mean, SEM) in bars that have the same letter are not significantly different (P >
604 0.05; Tukey’s test) among treatments (N=3).
605 Fig.2 The expression of non-specific immunity related genes, toll-like receptor 2
606 (TLR2), toll-like receptor 22 (TLR22), nuclear factor κΒ (NF-κΒ) p65 (A), tumor
607 necrosis factor α (TNF-α), interleukin 1β (IL-1β) and interleukin 8 (IL8) (B), in
608 response to graded levels of dietary carbohydrate in hybrid grouper for 10 weeks.
609 Values (means ± standard error of the mean, SEM) in bars that have the same letter
610 are not significantly different (P > 0.05; Tukey’s test) among treatments (N=3).
611

19
612 Table 1. Formulation and chemical composition of experimental diets (%dry matter)
Dietary carbohydrate level (%)
5.27 8.95 11.49 14.37 17.78 20.82 23.65
a
White fish meal 47.30 47.30 47.30 47.30 47.30 47.30 47.30
Shrimp meala 8.00 8.00 8.00 8.00 8.00 8.00 8.00
a
Fermented soybean meal 6.00 6.00 6.00 6.00 6.00 6.00 6.00
a
Corn gluten meal 6.00 6.00 6.00 6.00 6.00 6.00 6.00
a
Brewer’s yeast meal 1.50 1.50 1.50 1.50 1.50 1.50 1.50
a
Squid viscera meal 1.50 1.50 1.50 1.50 1.50 1.50 1.50
a
Soybean phospholipid 1.50 1.50 1.50 1.50 1.50 1.50 1.50
a
Chromium oxide 0.50 0.50 0.50 0.50 0.50 0.50 0.50
b
Vitamin mixture 1.00 1.00 1.00 1.00 1.00 1.00 1.00
c
Mineral mixture 1.00 1.00 1.00 1.00 1.00 1.00 1.00
Ca(H2PO3)2 1.00 1.00 1.00 1.00 1.00 1.00 1.00
Fish oil* 4.70 4.70 4.70 4.70 4.70 4.70 4.70
α-cassava-starch 0.00 3.00 6.00 9.00 12.00 15.00 18.00
Microcrystalline cellulose 2.00 2.00 2.00 2.00 2.00 2.00 2.00
Zeolite powder 18.00 15.00 12.00 9.00 6.00 3.00 0.00
Proximate analysis (%, on a dry weight basis)
Crude protein 48.47 48.42 48.68 48.64 48.50 48.47 48.36
Crude lipid 11.65 11.92 11.94 11.73 12.01 11.71 11.90
Ash 28.13 24.11 22.48 19.75 17.39 14.94 11.80
Starch 2.67 6.19 9.06 12.56 15.66 18.97 21.39
Crude fiber 5.48 5.60 5.42 5.52 5.31 5.05 5.29
Nitrogen free extract 5.27 8.95 11.49 14.37 17.78 20.82 23.65
Gross energy (MJ/kg) 17.12 17.85 18.18 18.58 19.08 19.47 20.01
a
613 All the ingredients were supplied by Nonghao Feed Corporation (Shanghai, China)；
b
614 Vitamin Premix (mg kg −1 diet): vitamin A, 16000 IU; vitamin D3, 8000 IU; vitamin
615 K3, 14.72; vitamin B1, 17.80; vitamin B2, 48; vitamin B6, 29.52; vitamin B12, 0.24;
616 vitamin E, 160; vitamin C, 800; niacinamide, 79.20; calcium-pantothenate, 73.60;
617 folic acid, 6.40; biotin, 0.64; inositol, 320; choline chloride, 1500; L-carnitine, 100.
c
618 Mineral Premix (mg kg −1 diet): Cu (CuSO4), 2.00; Zn (ZnSO4), 34.4; Mn (MnSO4),
619 6.20; Fe (FeSO4), 21.10; I (Ca (IO3)2), 1.63; Se (Na2SeO3), 0.18; Co (COCl2), 0.24;
620 Mg (MgSO4· H2O), 52.70.
621

20
622 Table 2. Primers used in the present study.
Sequence (5’-3’)
Gene
Forward Reverse
NF‐κΒ p65 AAACCCACTCAACCCAGTC ACCTAAACCTCATGCCCCT
TLR2 GAGCACTCACATCCCCAAC GCCTGAAAATCAGCTTTCC
TLR22 TGCTTTATCTCCACCACAT GCATAGGCCAAGTACCACC
TNF-α GAGGACGGTGGTGTTGGTGG TTCTCTTTGGCCTGATTGCG
IL-1β AGTCTGACCGTCCTCCTGT ATCCTCGCTGATGCTCTTT
IL8 GTGTTTGTGTCAGCGTGTG TGTGGTTGAGGTTTTTGGT
Nrf2 GTGGCAAGAACAAGGTAGC GTATTCGGAGGGGGAGTAG
Keap1 TACGCTGTTTGGACTGCTCT GCTGGACTCGGTGTTGTTTT
SOD1 CAGCGGGACCGTGTATTTT TTGTTGTGGGGGTTGAAGT
Gpx CCCATCCCCTGTTTGTGTT CCTGGCTGAGGAGCTTCTT
CAT GGCAACAACACCCCCATT CCAGAAGTCCCACACCAT
β-actin CTCTGGGCAACGGAACCTCT GTGCGTGACATCAAGGAGAAGC
623 NF‐κΒ p65: nuclear factor κΒ p65; TLR2: toll-like receptor 2; TLR22: toll-like
624 receptor 22; TNF-α: tumor necrosis factor α; IL-1β: interleukin 1β; IL8: interleukin 8;
625 Nrf2: NF-E2-related factor 2; Keap1: Kelch-like-ECH-associated protein 1; SOD1:
626 superoxide dismutase 1; CAT: catalase; Gpx: glutathione peroxidase.

21
Table 3. Lipid peroxidation status and antioxidant enzyme activities of hybrid grouper fed diets with varying dietary carbohydrate levels for 10
weeks*.
Dietary carbohydrate level (%)

5.27 8.95 11.49 14.37 17.78 20.82 23.65

Serum
MDA1 (gprot/L） 21.84 ± 0.46d 21.23 ± 0.49cd 23.68 ± 0.80cd 22.28 ± 0.75c 26.58 ± 0.31b 35.00 ± 0.61a 36.93 ± 0.88a
Liver
MDA (nmol/mgprot) 0.31 ± 0.00d 0.30 ± 0.02d 0.32 ± 0.00d 0.36 ± 0.02bc 0.33 ± 0.01cd 0.38 ± 0.01ab 0.42 ± 0.02a
d cd d bcd b bc
H2O2 (mmol/mgprot) 8.05 ± 0.07 8.12 ± 0.22 8.01 ± 0.15 8.43 ± 0.15 8.59 ± 0.10 8.53 ± 0.07 9.45 ± 0.11a
CAT2 (U/mgprot) 16.62 ± 0.24ef 16.06 ± 0.24f 17.31 ± 0.25d 17.05 ± 0.06de 22.49 ± 0.18c 26.58 ± 0.14b 25.22 ± 0.27a
SOD3 (U/mgprot) 120.98 ± 0.79d 124.91 ± 1.31d 152.81 ± 1.57c 156.75 ± 1.56c 152.31 ± 2.48c 165.00 ± 0.96b 180.40 ± 1.17a
Gpx4 (U/mgpro) 353.98 ± 1.89e 361.50 ± 1.33d 359.84 ± 2.66d 370.16 ± 0.98c 375.52 ± 2.24c 383.36 ± 0.67b 452.19 ± 2.18a
T-AOC5 (U/mgprot) 0.61 ± 0.01e 0.60 ± 0.01e 0.72 ± 0.01d 0.69 ± 0.00d 0.87 ± 0.00c 0.97 ± 0.01b 1.15 ± 0.01a
*
Values (means ± SEM, n=3) within a row with a common superscript letter are not significantly different from the other dietary groups (P >
0.05).
1
MDA: Malondialdehyde; 2CAT: Catalase; 3 SOD: Superoxide dismutase; 4Gpx: Glutathione peroxidase; 5T-AOC: total antioxidative capacity.

22
Table 4. Serum innate immunity parameters of hybrid grouper fed diets with varying dietary carbohydrate levels for 10 weeks*.
Dietary carbohydrate level (%)

5.27 8.95 11.49 14.37 17.78 20.82 23.65

Lysozyme (U/mL) 139.61 ± 2.08a 149.02 ± 2.08a 143.53 ± 10.25a 124.70 ± 3.59b 79.22 ± 4.37c 80.78 ± 1.57c 75.29 ± 2.35c
IgM1 (µg/mL) 20.10 ± 0.39a 20.75 ± 0.37a 21.19 ± 0.45a 18.10 ± 1.27b 17.51 ± 0.14b 18.52 ± 0.21b 19.82 ± 1.10ab
CCP2 (U/mL) 281.45 ± 4.23a 278.62 ± 3.15a 286.61 ± 2.90a 254.81 ± 1.87b 220.24 ± 4.89c 218.71 ± 3.19c 215.78 ± 5.20c
Protein (gprot/L) 48.68 ± 0.21a 51.73 ± 0.53a 48.79 ± 0.65a 45.57 ± 1.93b 43.22 ± 0.64bc 41.81 ± 0.74c 41.70 ± 1.02c
*
Values (means ± SEM, n=3) within a row with a common superscript letter are not significantly different from the other dietary groups (P >
0.05).
1
IgM: Immunoglobulin M; 2CCP: Classical complement pathway.

23
Fig.1

A
1.60
a
Relative gene expression

b
1.20 a b b
b b
ab ab b

0.80 bc
bc Nrf2
c Keap1
c
0.40

0.00
5.27 8.95 11.49 14.37 17.78 20.82 23.65

Dietary cabohydrate content (% dry weight)

1.20 a
B
a
Relative gene expression

a
ab

0.80 b
b
bc b b b
c
c SOD1
c
c GPx
0.40
CAT

0.00
5.27 8.95 11.49 14.37 17.78 20.82 23.65

Dietary cabohydrate content (% dry weight)

24
Fig.2

Relative gene expression 3.00 A

2.50 a

2.00 a ab
ab
bc ab TLR2
1.50 ab ab ab bc b TLR22
c b
c
1.00 NF-κΒ p65

0.50

0.00
5.27 8.95 11.49 14.37 17.78 20.82 23.65
Dietary cabohydrate content (% dry weight)

2.00 B
Relative gene expression

1.60 a
a

1.20 b b a a b b
c
TNF-α
c
0.80 c b c c b IL-1β
b b b
c c c
IL-8
0.40

0.00
5.27 8.95 11.49 14.37 17.78 20.82 23.65
Dietary cabohydrate content (% dry weight)

25
1. High dietary carbohydrate impaired the antioxidant capacity of hybrid grouper.
2. High dietary carbohydrate reduced the non-specific immunity of hybrid grouper.
3. The tolerant dietary carbohydrate of hybrid grouper was determined.